Antisense oligonucleotides for treating diseases or conditions associated with abnormal processing of APP

Abstract

The present invention relates to the field of human genetics, and more particularly to the treatment of diseases or conditions associated with abnormal processing of the amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD). In particular, the present invention relates to antisense oligonucleotides (AONs) useful for the treatment of such diseases or disorders.

Description

Technical Field

[0001] The present invention relates to the field of human genetics, more specifically to the treatment of diseases or disorders associated with abnormal (or altered) processing of amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD). The present invention particularly relates to antisense oligonucleotides (AONs) that can be used to treat such diseases or disorders. Background Art

[0002] Neurocognitive disorders include a broad category of degenerative brain diseases that are marked by progressive decline in memory, learning, perception, social interaction, recognition, orientation, language, comprehension, and judgment (American Psychiatric Association, 2013, 5th ed. Arlington). Neurocognitive disorders are manifestations of impaired multiple molecular pathways and cellular functions that lead to synaptic loss, cell death, inflammation, gliosis, and disruption of functional networks that underlie cognitive, sensory, and motor skills (Elahi and Miller, 2017 Nature Reviews. Neurology, 13:457-476). The continued decline in the patient's physical function ultimately leads to loss of autonomy and death. Alzheimer's disease (AD) is the most common neurocognitive and neurodegenerative disease and the most common cause of dementia (60%-80% of cases). AD involves both monogenic and complex forms of inheritance and is characterized by accumulation of insoluble amyloid-β plaques (also called Aβ plaques) in the extracellular space and vascular walls, aggregation of tubulin tau proteins in neurofibrillary tangles of neurons, dystrophic neurites, synaptic loss, neurotransmitter alterations (acetylcholine deficiency and glutamate excitotoxicity), and microgliosis and astrogliosis. Molecular and cellular pathological events begin decades before dementia becomes apparent. AD onset is over 65 years of age, with risk polymorphisms in genes that regulate microglial immune activation, lipid metabolism, and endocytosis. (Masters et al., 2015 Nature Reviews, 1: 1-18; Congdon et al. 2018, Nature Reviews Neurology, 14 (7), 300-415; Long and Holtzman et al., 2019 Cell, 170 (2), 312-339).

[0003] Familial Alzheimer's disease (FAD) is an early-onset AD (EOAD) (before the age of 65 years) caused by mutations in the following genes involved in the production of Aβ peptides: APP (OMIM 104760), PSEN1 (OMIM 104311) or PSEN2 (OMIM 1600759) (Lanoiselée et al., 2017, PLoS Medicine [Public Library of Science Medicine], 14:3). FAD has an autosomal dominant inheritance pattern and a prevalence of 1% of all AD cases. In FAD patients, Aβ plaque deposition is detected in asymptomatic patients and most likely drives the progression of tau protein pathology. A high rate of tau protein accumulation can be observed in symptomatic FAD patients, and tau protein pathology has been suggested as an indicator of the onset of cognitive impairment (Gordon et al., Brain. [Brain] 2019 April 1; 142 (4): 1063-1076). In humans, Aβ plaque deposition is not thought to correlate with the extent of cognitive decline but may be required for the progression of tau pathology.

[0004] Aβ is produced by cleaving β-amyloid precursor protein (APP) in sequence by β-secretase and γ-secretase. β-secretase (BACE1) cuts APP at the N-terminus of the Aβ sequence, thereby releasing secreted APP-β and membrane-bound C99 fragments. After cleavage by BACE1, the γ-secretase complex binds to the APP fragment (C99) cleaved at the N-terminus and performs intramembrane cleavage at the ε site, thereby releasing the C-terminal fragment (CTF) and Aβ49 or Aβ48. The γ-secretase complex then processes along the remaining AβC-terminus, thereby producing peptides that become shorter in sequence until the Aβ peptide is released from the complex (usually after producing peptides of 38, 40 and 42 amino acids in length). Therefore, the continuous processing capacity of the γ-secretase complex limits the length of the Aβ peptide produced. The Aβ peptide tends to aggregate into a β sheet conformation in the form of high-order oligomers, protofibrils and protofibrils, which are detectable in AD brains. Longer Aβ peptides (≥Aβ42) are more hydrophobic and show better ability to aggregate and form Aβ plaques (L. Chávez-Gutiérrez and M. Szaruga, 2020, Seminars in Cell and Developmental Biology 105, 75-85; Long and Holtzman et al., 2019, Cell 170, 312-339). Importantly, the γ-secretase complex exhibits broad substrate specificity, with nearly 100 type 1 membrane proteins listed as potential substrates in addition to APP (Wakabayashi et al., 2008, Physiology 23, 194-204).

[0005] The γ-secretase complex is composed of four protein subunits: presenilin (PSEN), presenilin enhancer 2 (PEN-2), anterior pharyngeal defect protein (APH), and Nicastrin. There are multiple isoforms of PSEN (PSEN1 or PSEN2) and APH (APH1A or APH1B); therefore, up to four different γ-secretase complexes may exist in a single cell (De Strooper., 2003 Neuron, 38, 9-12). PSEN1 is an aspartyl protease and the catalytic subunit of γ-secretase, PEN-2 is required for γ-secretase maturation, APH stabilizes the complex and Nicastrin is thought to play a role in substrate binding (De Strooper et al., 1998, Nature 391, 387-390; De Strooper et al., 1999, Nature 398, 518-522; Wolfe et al., 1999, Nature 398, 513-517; N. Takasugi et al., 2003, Nature 422, 438-441; S. Shah et al., 2005, Cell 122, 435-447; R. Zhou et al., 2019, Science 363, 6428).

[0006] The proteins involved in the production of Aβ peptides form part of a membrane-embedded protease complex called the γ-secretase complex and are composed of the following four proteins in a 1:1:1:1 stoichiometry: Nicastrin (NCT), anterior pharyngeal defect protein 1 (APH1A or APH1B), presenilin enhancer 2 (PEN-2) and presenilin (PSEN-1 or PSEN-2). Presenilin-1 and presenilin-2 are the catalytic subunits of the complex (De Strooper., 2003 Neuron, 38, 9-12). Presenilin 1 and presenilin 2 are paralogs. The γ-secretase complex exhibits a wide range of substrate specificity, with nearly 100 type 1 membrane proteins listed as potential substrates (Wakabayashi et al., 2008, Physiology 23, 194-204). One of the substrates of the γ-secretase complex is the amyloid precursor protein (APP), which is converted into Aβ peptide by the complex (DeStrooper et al., 1998, Nature 391, 387-390). APP can be processed through two different pathways: the non-amyloidogenic pathway and the amyloidogenic pathway.

[0007] Mutations in APP (OMIM 104760), PSEN1 (OMIM 104311), and PSEN2 (OMIM 1600759) have been found to be the main cause of familial Alzheimer's disease (FAD) (Lanoiselée et al., 2017, PLoS Medicine, 14:3). Currently, almost 300 mutations in PSEN1, more than 10 mutations in PSEN2, and more than 18 mutations in APP are associated with early-onset FAD. Mutations in PSEN1 are not only significantly more common than mutations in PSEN2 or APP, but are also associated with earlier clinical onset and atypical cognitive manifestations (such as motor impairment) (L. Chávez-Gutiérrez and M. Szaruga, 2020, Seminars in Cell and Developmental Biology 105, 75-85); mutations in PSEN1 have the following different effects:

[0008] 1. Some reduce or eliminate γ-secretase activity,

[0009] 2. Others reduce the processivity of γ-secretase activity, thereby shifting γ-secretase activity toward the production of longer Aβ peptide species from APP,

[0010] 3. Others reduce the stability of γ-secretase and Aβ peptide during sequential cleavage, or

[0011] 4. Reduce PSEN1 mutation.

[0012] It is strongly debated whether presenilin mutations cause Alzheimer's disease through loss of function or gain of function (Xia et al., 2015, Neuron, 85(5), 967-81; Veugelen et al., 2016, Neuron, 90(2), 410-6). The most simplified explanation is that mutations in PSEN1 affect the activity of γ-secretase, leading to an increase in the Aβ42 / 40 ratio, which increases the assembly of neurotoxic oligomers that cause synaptic dysfunction and neurodegeneration (Zoltowska and Berezovska, 2017, Molecular Neurobiology, 55, 2275-2284; Chavez-Gutierrez et al., 2012. The EMBO Journal, 31, 2261-2274; Szaruga et al., 2017, Cell, 170, 443-456).

[0013] Until 2021, AD patients could only achieve symptomatic treatment, mainly including cholinesterase inhibitors and NMDA inhibitors (Long and Holtzman et al., 2019, Cell 170(2), 312-339). On June 7, 2021, the US Food and Drug Administration (FDA) authorized the accelerated approval of the first disease-modifying treatment for AD: Aduhelm (aducanumab). However, post-approval trials are required to verify that the drug provides the expected clinical benefit and to authorize the continued approval of Aduhelm. Adulhelm is a monoclonal antibody that targets extracellular Aβ plaques in the brain. (https: / / www.fda.gov / news-events / press-announcements / fda-grants-accelerated-approval-alzheimers-drug)

[0014] Therefore, there is still a need for a new and more efficient treatment for diseases or illnesses related to the abnormal (or changed) processing of amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD). The inventors have designed antisense oligonucleotides that can be used for this treatment. It is expected that such antisense oligonucleotides do not have all the shortcomings of existing treatments. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1.

[0016] Analysis of the effects of AON20 (SEQ ID NO: 118) treatment on PSEN1 protein levels (A) and γ-secretase activity (BD) of Tg / Tg A431E mouse neurons is shown. (AB) Western blot analysis of protein levels of full-length PSEN1 (A) or CTF APP protein levels normalized to full-length APP (B) is shown after 8 days of treatment with the specified concentrations of AON20. Data relative to the untreated condition (0 μM) are shown in A and B. (CD) ELISA analysis of the profiles of soluble Aβ38, Aβ40, and Aβ42 species in the supernatant of mouse Tg / Tg A431E neurons after 8 days of treatment with the specified concentrations of AON20 is shown. Data are shown as Aβ levels (C) and Aβ42 / 38 ratios (D). Each point in the figure corresponds to a cell culture well, and the error bars indicate standard deviations (n=2-3). *p<0.05, **p<0.01 (one-way ANOVA test). CTF=C-terminal fragment. FL=full length.

[0017] Figure 2.

[0018] Shown is an ELISA analysis of the profile of soluble Aβ38, Aβ40 and Aβ42 species in the supernatant of mouse Tg / Wt A431E neurons after treatment with specified concentrations of AON21 (SEQ ID NO: 120) for 7d. Data are shown as Aβ levels (A) and Aβ42 / 38 ratios (B). Each point in the figure corresponds to a cell culture well, and the error bars indicate standard deviations (n=3). *p<0.05, **p<0.01 (one-way ANOVA test).

[0019] Figure 3.

[0020] The effectiveness and allele-specific Wes analysis of AONs targeting human A431E PSEN1 transfected into NIH3T3 cells overexpressing Flag-tagged human WT or A431E PSEN1 are shown. Data are shown as the ratio of Flag and NPT-II protein levels normalized to untreated samples. AONs were transfected at 10 nM and cells were harvested 24 h after transfection. (A) Protein levels of WT and A431E PSEN1 after treatment with AONs in which the sequence and nucleotide position relative to the mutation varied from the 5' end to the 3' end. (B) Protein levels of WT and A431E PSEN1 after treatment with derivatives from AON4, AON5 and AON6 (SEQ ID NOs: 8, 10 and 12) containing T (thymine) to U (uracil) substitutions at positions relative to the mutation. (C) Backbone modifications used in the AONs listed in Table 4. (D) Protein levels of WT and A431E PSEN1 after treatment with derivatives from AON14 (SEQ ID NO: 28) incorporating PO and / or PNms bonds. NT = untreated. Each point in the graph corresponds to one cell culture well, and the error bars indicate standard deviation.

[0021] Figure 4.

[0022] Analysis of the effect of the position of mutation within AON and the T (thymine) to U (uracil) substitution relative to the mutation position on the effectiveness and allele selectivity of AON targeting human A431E (A) or S212Y mutation (B) is shown. NIH3T3 cells were transfected with plasmids encoding WT, A431E or S212Y human PSEN1. Three hours later, 10nM of the specified AON was transfected, and cells were harvested 24h after transfection. (dd)PCR was used to measure WT and mutant mRNA levels. The data are shown as the ratio of WT to A431E (A) or S212Y (B) PSEN1 mRNA levels. The AONs used are listed in Table 5. Each point in the figure corresponds to a cell culture well (n=1 or 2), and the error bars indicate the standard deviation.

[0023] Figure 5 .

[0024] Shown is (dd)PCR analysis of mRNA levels of WT and A431E PSEN1 in human neurons differentiated from patient-derived iPSCs after 10 days of treatment with AON14 (SEQ ID NO: 28), AON15 (SEQ ID NO: 30) and AON16 (SEQ ID NO: 33). WT and A431E mRNA copies were quantified using SNP assays and normalized to mRNA copies of two housekeeping genes (TFRC and GAPDH). Data relative to untreated conditions (NT) are shown, n = 1 cell culture well.

[0025] Figure 6.

[0026] Analysis of the effects of AON87 (SEQ ID NO: 202) treatment on WT and A431E mouse Psen1 mRNA levels (A) and γ-secretase activity (BD) in Tg / Wt A431E primary mouse neurons. AON87 specifically targets mouse WT Psen1. (A) RT-qPCR analysis of mRNA levels of A431E and WT mouse Psen1 after 7 days of treatment with specified concentrations of AON87 is shown. The mRNA levels of A431E and WT Psen1 were normalized to the levels of two housekeeping genes (actin and Rsp23). Data relative to the untreated condition (0 μM) are shown. (BD) ELISA analysis of the profiles of soluble Aβ38, Aβ40, and Aβ42 species in the supernatant of Tg / Wt A431E primary mouse neurons after 7 days of treatment with specified concentrations of AON87 is shown. Data are shown as total Aβ levels (B), levels of Aβ38, Aβ40 and Aβ42 relative to untreated conditions (C), and ratio Aβ42 / 38 (D). mRNA and soluble Aβ levels were measured in the same sample, and each point in the figure corresponds to a cell culture well (n=9), and error bars indicate standard deviation. ****p<0.0001 (A and C, two-way ANOVA test and Dunnett's multiple comparison test; B and D, t test).

[0027] Figure 7.

[0028] RT-qPCR analysis of mRNA levels of WT and A431E Psen1 in primary neurons of Tg / Tg (A) and Tg / Wt (B) mice after treatment with indicated concentrations of AON20 (SEQ ID NO: 118) and AON88 (SEQ ID NO: 204) for 7 days is shown. Data relative to untreated conditions (0 μM) are shown. Each point in the figure corresponds to a cell culture well (n=9), and error bars indicate standard deviations. ***p<0.001, ****p<0.0001 (one-way ANOVA test and Dunnett's multiple comparison test).

[0029] Figure 8.

[0030] ELISA analysis of the profile of soluble Aβ38, Aβ40 and Aβ42 species in the supernatant of Tg / Wt primary mouse neurons after treatment with 10 μM concentrations of AON20 (SEQ ID NO: 118) and AON88 (SEQ ID NO: 204) for 7 days is shown. Data are shown as total Aβ levels (A), levels of Aβ38, Aβ40 and Aβ42 relative to untreated conditions (B), and ratio Aβ42 / 38 (C). Each point in the figure corresponds to a cell culture well (n=9), and error bars indicate standard deviations. ***p<0.001, ****p<0.0001 (A and C, one-way ANOVA test and Dunnett's multiple comparison test; B, two-way ANOVA test and Dunnett's multiple comparison test). NT: untreated.

[0031] Fig. 9 .

[0032] Analysis of in vivo efficacy and allele selectivity of AON20 (SEQ ID NO: 118) is shown. wt / A431E ; APPKi mice received a single intracerebroventricular injection of 150 μg AON20. Animals were sacrificed after 2 weeks, and hippocampal mRNA levels of WT and A431E Psen1 were measured by RT-qPCR. Results were normalized to actin and GAPDH levels. Data relative to vehicle conditions are shown. Each point in the figure corresponds to one animal (n=7, vehicle; n=4, AON20), and error bars indicate standard deviation. Statistical test: T test. DETAILED DESCRIPTION

[0033] The present invention uses oligonucleotides of the invention as defined herein to target the real potential source of FAD by depleting the mutant form of the allele and in this way restoring the normal activity of the catalytic subunit of the γ-secretase complex. Such oligonucleotides preferentially target and degrade alleles carrying mutations in PSEN1 or PSEN2, which will reduce the level of mutant PSEN1 or PSEN2, allowing replacement by the corresponding wild-type protein, increasing the level of functional γ-secretase, and thus reducing the production of toxic forms of Aβ peptides. This strategy is different from attempts to inhibit or downregulate the γ-secretase itself, which causes severe (Notch-) signaling side effects, and is also expected to be more effective than current methods for treating familial AD that focus on more downstream features of the disease (such as tau protein aggregation) or more general features of the disease (like inflammation). This strategy is quite unique: oligonucleotides are selected to have the highest possible efficiency and the highest possible specificity for mutant alleles of PSEN1 or PSEN2, while these oligonucleotides are selected to have the lowest possible efficiency and the lowest possible specificity for wild-type alleles of PSEN1 or PSEN2. This means that the oligonucleotides have been designed to specifically inactivate, delete, knock down, suppress, and predominantly leave intact the wild type allele of PSEN1 or PSEN2.

[0034] Antisense Oligonucleotides

[0035] The inventors have unexpectedly discovered antisense oligonucleotides that exhibit attractive therapeutic activity and can be used to treat diseases or disorders associated with abnormal (or altered) processing of the amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD).

[0036] Such antisense oligonucleotides are described in more detail below.Such antisense oligonucleotides will be referred to herein as antisense oligonucleotides according to the invention (or antisense oligonucleotides of the invention or oligonucleotides of the invention or oligonucleotides or AONs).

[0037] In a first aspect, an antisense oligonucleotide is provided which, when present in a cell comprising (preferably expressing) a mutated allele of a protein of the γ-secretase complex, preferentially targets the mutated allele. In a preferred embodiment, the protein of the γ-secretase complex is PSEN1 or PSEN2, preferably PSEN1, and the allele of the protein of the γ-secretase complex is mutated. In a preferred embodiment, the antisense oligonucleotide is single-stranded.

[0038] In a second aspect, an antisense oligonucleotide is provided, comprising 15 to 30 or 20 to 30 nucleotides, including a central region of 5 to 15 consecutive DNA nucleotides and / or DNA nucleotide analogs, the central region being flanked at each end by wing regions comprising 1 to 5 RNA nucleotide analogs, the antisense oligonucleotide preferentially targeting the mutated allele when present in a cell comprising and preferably expressing a mutated allele of a protein of the y-secretase complex, wherein the mutation present in the mutated allele is targeted by the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh or twelfth nucleotide of the central region of the oligonucleotide. In a preferred embodiment, the protein of the y-secretase complex is PSEN1 or PSEN2, preferably PSEN1, and the allele of the protein of the y-secretase complex is mutated. In a preferred embodiment, the antisense oligonucleotide is single-stranded.

[0039] As shown in the Examples section of the present application, the antisense oligonucleotides of the second aspect were shown to efficiently target mutant alleles of proteins of the γ-secretase complex, such as PSEN1.

[0040] In an embodiment, an antisense oligonucleotide is provided, the antisense oligonucleotide comprising 15 to 30 or 20 to 30 nucleotides, including a central region of 5 to 15 consecutive DNA nucleotides and / or DNA nucleotide analogs, the central region being flanked at each end by a wing region comprising 1 to 5 RNA nucleotide analogs, the antisense oligonucleotide preferentially targeting the mutant allele when present in a cell containing and preferably expressing a mutant allele of a protein of the y-secretase complex, wherein the mutation present in the mutant allele is targeted by the sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth or eighteenth nucleotide from 5' to 3' in the oligonucleotide sequence. In a preferred embodiment, the protein of the y-secretase complex is PSEN1 or PSEN2, preferably PSEN1, and the allele of the protein of the y-secretase complex is mutant. In a preferred embodiment, the antisense oligonucleotide is single-stranded.

[0041] Unless otherwise indicated, all definitions and / or embodiments described herein relate to both the first and second aspects of the invention.

[0042] In an embodiment, the cell is a cell in which the protein is endogenously expressed (mutated allele and preferably wild-type allele). In a preferred embodiment, the cell is a mammalian cell, preferably a mouse or human cell. In a more preferred embodiment, the cell represents the disease FAD.

[0043] In the first embodiment, the cell representing the disease FAD is a neuron cell.Preferred neuron cells are cells of the central nervous system.Preferred cells of the central nervous system can come from or can be derived from the brain regions known to be affected in FAD.Such brain regions include hippocampus, amygdala, cerebral cortex (such as frontal lobe, parietal lobe, temporal lobe and / or occipital lobe), cerebellum and thalamus.Therefore, in an embodiment, the activity of antisense oligonucleotides is assessed in such neuron cells.It can also be assessed in vitro by culturing such cells and contacting them with oligonucleotides.

[0044] In a second embodiment, the cell representing disease FAD is a human iPSC (induced pluripotent stem cell) that is triggered to differentiate or mature into a neuron. As shown in Example 5, the antisense oligonucleotides of the present invention can successfully target the protein (PSEN1) of γ-secretase complex, and the allele of the protein is mutated in a biologically relevant FAD system (such as iPSC cells). Preferably, iPSC is from such a subject, and the subject has a changed or weakened PSEN1 or PSEN2 activity, and is a FAD patient or is suspected of becoming a FAD patient due to his / her genetic background. Therefore, in an embodiment, the activity of antisense oligonucleotides is assessed using such neuronal cells derived from human iPSC. Such cells can be evaluated in vitro by culturing them and contacting them with oligonucleotides.

[0045] Alternatively, in another embodiment, the cell is a cell in which the protein is endogenously expressed (mutated allele or wild-type allele). In a preferred embodiment, the cell is a mammalian cell, preferably a mouse or human cell. In this embodiment, the nucleic acid encoding the mutant protein is introduced into the cell. The cell can be a non-neuronal cell, including but not limited to fibroblasts, HeLa or HEK293 cells. The nucleic acid encoding the mutant protein can be introduced by a viral or non-viral vector, more preferably by a plasmid expressing the mutant protein or its fusion derivative.

[0046] Depending on the oligonucleotide used, the technician will understand which cell is suitable for evaluating the activity of the oligonucleotide. As mentioned above, in an embodiment, the cell is a cell in which the protein is endogenously expressed. Alternatively, in another embodiment, the nucleic acid encoding the mutans is introduced into the cell. The technician can also evaluate the activity of the oligonucleotide in cells of exogenous expression mutans and subsequently in cells of endogenous expression mutans.

[0047] The choice of readout is a key feature of the invention, as the use of a given readout may lead to the identification of a suboptimal oligonucleotide when later validated using a more relevant readout. Here, the inventors demonstrate the effect of using oligonucleotides on mutant PSEN1 or PSEN2 transcripts and / or no effect on the wild-type allele of said transcript, and / or the effect of oligonucleotides to normalize, reverse or correct abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios (preferably Aβ42 / 38 and / or Aβ43 / 40 ratios) is critical, more preferably the Aβ42 / 38 ratio is critical. In particular, the inventors unexpectedly found that the antisense oligonucleotides of the invention had the greatest effect on Aβ38 peptide levels and the Aβ42 / Aβ38 ratio, while the effect on other Aβ species (such as Aβ40) was less pronounced (Examples 2, 6 and 8). This observation confirms the need for the use of a comprehensive readout to evaluate the therapeutic benefit of antisense oligonucleotides;

[0048] In a preferred embodiment, an antisense oligonucleotide is provided which, when present in a cell comprising (preferably expressing) a mutant allele of a protein of the γ-secretase complex (preferably PSEN1), preferentially targets the mutant allele. More preferably, the cell is a neuronal cell, even more preferably a human neuronal cell. Preferably, the cell expresses an endogenous mutant allele of a protein of the γ-secretase pathway. In a preferred embodiment,

[0049] - the oligonucleotide is capable of preferentially silencing, inactivating, degrading, knocking down, reducing or decreasing a mutant PSEN1 or PSEN2 transcript, preferably a mutant PSEN1 transcript, and even more preferably

[0050] The oligonucleotide is not (or minimally) capable of silencing, inactivating, degrading, knocking down, decreasing or reducing a wild-type PSEN1 or PSEN2 transcript, preferably a wild-type PSEN1 transcript.

[0051] In a more preferred embodiment,

[0052] - the oligonucleotide is capable of preferentially silencing, inactivating, degrading, knocking down, reducing or decreasing a mutant PSEN1 or PSEN2 transcript (preferably a mutant PSEN1 transcript), and even more preferably the oligonucleotide is not (or minimally) capable of silencing, inactivating, degrading, knocking down, reducing or decreasing a wild-type PSEN1 or PSEN2 transcript (preferably a mutant PSEN1 transcript), and / or

[0053] - The oligonucleotide is capable of normalizing, reversing or correcting an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio, preferably an Aβ42 / 38 and / or Aβ43 / 40 ratio, and more preferably an Aβ42 / 38 ratio.

[0054] In an embodiment, the oligonucleotide:

[0055] 1. preferentially silencing or inactivating or decomposing mutant PSEN1 transcripts, and knocking down or reducing or decreasing mutant PSEN1 protein expression, and preferentially not silencing or inactivating or decomposing wild-type PSEN1 transcripts, and not knocking down or reducing or decreasing wild-type PSEN1 protein expression,

[0056] and / or

[0057] 2. Capable of normalizing, correcting or reversing an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio, preferably an Aβ42 / 38 and / or Aβ43 / 40 ratio, and more preferably an Aβ42 / 38 ratio.

[0058] In an embodiment, the oligonucleotide:

[0059] 1. preferentially silences, inactivates or degrades mutant PSEN1 transcripts, and / or preferentially does not silence, inactivates or degrade wild-type PSEN1 transcripts, and / or

[0060] 2. Capable of normalizing, correcting or reversing an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably an Aβ42 / 38 and / or Aβ43 / 40 ratio, more preferably an Aβ42 / 38 ratio).

[0061] Each of these readouts is broadly defined below.

[0062] In the context of the present invention, the activity elicited or exhibited by the antisense oligonucleotide of the present invention is preferential targeting of a mutant allele of a protein of the γ-secretase complex when present in a cell comprising said mutant allele. In an embodiment, said protein is a human protein and / or is PSEN1.

[0063] The targeted mutant allele, in particular the region or segment of such mutant allele that is targeted may also be designated as the targeting region of the oligonucleotide.

[0064] Such a mutated allele of a human protein of the γ-secretase complex may be a disease-associated allele or a pathogenic allele in a patient's cells, in a patient's tissues and / or in a patient, as explained later herein. In an embodiment, the patient is a mammal. In a preferred embodiment, the patient is a human.

[0065] Throughout the application, the words "bind", "specifically bind", "target", "specifically target", "hybridize" or "specifically hybridize" are used interchangeably when used in the context of an antisense oligonucleotide that is reverse complementary to a portion of an allele, particularly in the form of a transcript encoding this allele as identified herein. Therefore, in the context of the present application, the expression "oligonucleotide" is synonymous with the expression "antisense oligonucleotide".

[0066] Throughout the application, the words "preferentially bind", "preferentially target" or "preferentially hybridize" are used interchangeably when used in the context of antisense oligonucleotides of the invention that are reverse complementary to a portion of a mutant allele, particularly in the form of a transcript encoding such a mutant allele as identified herein. This "preferential binding / targeting / hybridization" is subsequently defined herein by comparison to a wild-type / control / non-mutated allele that "specifically binds / targets / hybridizes".

[0067] The word "transcript" refers to the pre-mRNA or mRNA encoded by an allele. In the context of the present invention, a mutant allele is a gene encoding a mutant transcript encoding a mutant protein of the γ-secretase complex.

[0068] In this context, the wild-type genomic DNA of mouse PSEN1 comprises SEQ ID NO:145, the corresponding coding RNA comprises SEQ ID NO:146, and the mouse PSEN1 protein comprises SEQ ID NO:147.

[0069] In this context, the A431E genomic DNA of mouse A431E PSEN1 comprises SEQ ID NO:148, the corresponding coding RNA comprises SEQ ID NO:149, and the mouse A431 EPSEN1 protein comprises SEQ ID NO:150.

[0070] In this context, the wild-type genomic DNA of human PSEN1 comprises SEQ ID NO: 151, the corresponding coding RNA comprises SEQ ID NO: 152 or 169, and the human PSEN1 protein comprises SEQ ID NO: 153 or 159.

[0071] In this context, the A431E genomic DNA of human A431E PSEN1 comprises SEQ ID NO: 154, the corresponding coding RNA comprises SEQ ID NO: 155 or 170, and the human A431E PSEN1 protein comprises SEQ ID NO: 156 or 161.

[0072] In this context, the wild-type genomic DNA of human PSEN2 comprises SEQ ID NO: 165, the corresponding coding RNA comprises SEQ ID NO: 171 or 172, and the human PSEN2 protein comprises SEQ ID NO: 166 or 168.

[0073] As used herein, "hybridization" refers to the pairing of complementary oligomeric compounds (e.g., antisense compounds and their target nucleic acids / target regions). Although not limited to a specific mechanism, the most common pairing mechanism involves hydrogen bonding between complementary nucleosides or nucleotide bases (nucleobases), which can be Watson-Crick, Hoogsteen or reverse Hoogsteen hydrogen bonding. For example, the natural base adenine is a nucleobase complementary to the natural nucleobases thymine, 5-methyluracil and uracil (they are paired by the formation of hydrogen bonds). The natural base guanine is a nucleobase complementary to the natural base cytosine and 5-methyl-cytosine. Hybridization can occur in different situations. Specifically, the hybridization of the oligonucleotide of the present invention with the pre-mRNA and / or mRNA of targeting can occur in different situations. Similarly, the combination of the oligonucleotide of the present invention with the pre-mRNA and / or mRNA of targeting (i.e., targeting region) can occur in different situations. Preferably, the hybridization or the combination is evaluated in cells, more preferably in human cells, under physiological conditions. Preferred cells have been defined earlier herein. When said binding or hybridization occurs in a cell (preferably a human cell) under physiological conditions, the oligonucleotides of the present invention are preferably considered to be capable of binding or capable of binding or capable of hybridization or capable of hybridization. Preferred cells have been defined earlier herein.

[0074] In the context of the present invention, unless otherwise indicated, "hybridization" or "binding" (or "preferentially hybridizing" or "preferentially binding", or "preferentially binding" or "preferentially hybridizing") is used in cells (preferably human cells) under physiological conditions.

[0075] In an embodiment, when the oligonucleotide is reversely complementary to at least 10 or at least 15 consecutive (contiguous) bases of a mutant allele of a mutant protein (preferably PSEN1) of the γ-secretase complex or the mutant transcript encoding the mutant protein, the antisense oligonucleotide is referred to as targeting the allele encoding the mutation. This "at least 10 or at least 15 consecutive bases" of the mutant allele can also be referred to as the targeting region or target region of the antisense oligonucleotide. In an embodiment, the length of the reverse complementary portion can be at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 nucleotides. In the context of the present invention, the oligonucleotide comprises up to 50 nucleotides and / or nucleotide analogs. The oligonucleotide can be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides and / or nucleotide analogs. The reverse complementary portion of the oligonucleotide itself does not need to be 100% reverse complementary to the mutant allele or transcript of the mutant protein of the γ-secretase complex. In an embodiment, one or two mismatches can exist in a total length of at least 15 nucleotides defining the portion that is reverse complementary to the mutant allele or transcript.

[0076] The activity of the oligonucleotide of the present invention is to preferentially target a mutated allele or a mutated transcript of a mutant protein encoding a γ-secretase complex. This activity can mean that the targeted mutant allele (or corresponding transcript) is silenced or knocked down (or decomposed) or inactivated or reduced or decreased. In other words, the level of the mutated transcript is knocked down (or decomposed), reduced or reduced. In this context, the protein of the γ-secretase complex is PSEN1. In a preferred embodiment, the protein is a human protein. More preferably, human PSEN1.

[0077] Therefore, a first method for evaluating the activity of the antisense oligonucleotides of the invention is to evaluate whether the oligonucleotides are able to knock down (or decompose) or reduce or decrease (the level of) the mutated transcript (preferably a PSEN1 or PSEN2 mutated allele or transcript). This reduction or decrease in the level of the mutated transcript can be a reduction or decrease of at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% compared to the level of the same transcript at the beginning of treatment. In a preferred embodiment, the mutated transcript is no longer detectable. The reduction or decrease can be assessed in cells or tissues treated with the oligonucleotides or in subjects treated with the oligonucleotides and using Northern blots or (semi) quantitative RT-qPCR or RT-ddPCR analysis of the number of copies of the mutant transcripts (preferably as performed in the experimental section).

[0078] In a preferred embodiment, for this first way of assessing the activity of the antisense oligonucleotides of the present invention, the level of wild-type alleles or wild-type transcripts that are not targeted by oligonucleotides (or not specifically targeted) is also assessed. Therefore, the wild-type allele or transcript is still detectable, and the level of the wild-type allele or transcript is not less than 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of the level of the same allele or transcript at the beginning of treatment. In a preferred embodiment, the level of the wild-type allele or transcript is the same as the level detected at the beginning of treatment. The presence of the transcript can be assessed in cells or tissues treated with the oligonucleotides or in subjects treated with the oligonucleotides and using northern blotting or (semi) quantitative RT-qPCR or RT-ddPCR analysis of the mutant transcript copy number (preferably as performed in the experimental section).

[0079] Therefore, in a preferred embodiment, the activity of the antisense oligonucleotides of the invention is assessed as follows:

[0080] - whether the oligonucleotide is able to knock down or reduce or decrease the level of the mutant PSEN1 or PSEN2 transcript, and

[0081] - Whether the oligonucleotide is (or minimally is) capable of knocking down or reducing or decreasing the level of wild-type PSEN1 or PSEN2 transcript.

[0082] This reduction or decrease in the level of a mutated transcript can be a reduction or decrease of at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% compared to the level of the same transcript at the start of treatment. In a preferred embodiment, the mutated transcript is no longer detectable.

[0083] An oligonucleotide is said to be not (or minimally) capable of knocking down or reducing or decreasing a wild-type PSEN1 or PSEN2 allele or transcript when the wild-type allele or transcript is still detectable at no less than 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of the level of the same allele or transcript at the start of treatment.

[0084] In a more preferred embodiment, the oligonucleotide is capable of knocking down or reducing or decreasing the level of a mutated PSEN1 or PSEN2 transcript by at least 20% or at least 30% or at least 40% or at least 50% or at least 80% or at least 90% or at least 95% compared to the level of the mutated allele or transcript at the start of treatment, and the level of the wild-type PSEN1 or PSEN2 transcript remains at least 50% or at least 80% or at least 90% or at least 95% of the level of the transcript of the allele at the start of treatment.

[0085] The presence of mutant or wild-type alleles or transcripts is assessed as described earlier herein.

[0086] As explained in the background section, some mutations in the PSEN1 or PSEN2 genes can shift the activity of the γ-secretase complex toward the production of abnormal Aβ profiles [these abnormal Aβ profiles are from short peptides (Aβ38, Aβ40) to longer peptides (Aβ42, Aβ43 and even longer to Aβ48 or Aβ49, although there are no readily available tools to measure those species, while other species can be easily measured with ELISA assays)], which is a result of impaired carboxypeptidase-like activity of the γ-secretase. The underlying mechanism is destabilization of the substrate-enzyme complex, i.e., the interaction of the APP substrate with the catalytic presenilin subunit in the γ-secretase complex is reduced due to mutations in the PSEN1 or PSEN2 genes. This results in faster release of longer (less processed) forms of Aβ, i.e., any peptide up to 49 amino acids in length. Longer (longer than or equal to Aβ49 or longer than or equal to Aβ48, longer than or equal to Aβ42 or longer than or equal to Aβ43) forms of Aβ peptide species are toxic because they are more hydrophobic and more easily aggregate and form oligomeric species and protofibrillar species that are more easily toxic. The processing of Aβ occurs stepwise, and there are two production lines, one starting with Aβ49>46>43>40>37, and one starting with Aβ48>45>42>38 (Takami et al., 2009, J Neurosci [Journal of Neuroscience] 29, 13042-52). In other words, due to PSEN1 or PSEN2 mutations, it is expected that the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios are increased in the brain, cerebrospinal fluid (CSF) and / or plasma of FAD patients. In an embodiment, the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio) in the plasma and / or CSF and / or brain of a FAD patient is increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% compared to the levels in healthy subjects. The Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio) can be assessed by techniques known to the skilled person.

[0087] In an embodiment, cell extracts, cell culture medium, brain extracts, CSF or plasma of FAD patients carrying PSEN1 or PSEN2 mutations can be used to assess the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio).

[0088] In the embodiments, cell extracts, cell culture medium of cells endogenously or exogenously expressing mutant PSEN1 or PSEN2 can be used to assess the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio).

[0089] In the examples, the assessment is performed using ELISA, preferably as performed in the experimental part.

[0090] In the in vivo situation (in transgenic mice), these ratios in CSF, plasma and / or brain extracts are first expected to increase and then decrease due to aggregation of A[beta] peptides to form A[beta] plaques.

[0091] In the in vivo situation (in FAD patients), these ratios in CSF and / or plasma are first expected to increase and then decrease due to aggregation of A[beta] peptides to form A[beta] plaques.

[0092] Typically, this increase is observed in FAD patients without detectable Aβ plaques in the brain. FAD patients without detectable Aβ plaques in the brain can be referred to as asymptomatic FAD patients. During disease progression, Aβ plaques are formed, and these ratios are reduced in CSF samples. In plasma, these ratios increase during all progressions of the disease. Therefore, if a patient already has detectable Aβ plaques in the brain, the determination should be performed in the patient's plasma. ELISA determination only assesses soluble Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios (preferably Aβ42 / 38 and / or Aβ42 / 40 ratios, more preferably Aβ42 / 38 ratios), and the effect of the aggregation process on the ratio level cannot be specified. The ELISA determination mainly visualizes the primary effect of the mutation of the activity of the γ-secretase complex (which is the generation of longer forms of Aβ peptide species).

[0093] In an embodiment, an asymptomatic FAD subject or patient is selected or identified in view of his / her family history (in which several FAD patients have PSEN1 or PSEN2 mutations). It is crucial to diagnose this type of subject while they are still asymptomatic (and therefore as early as possible) so that treatment can be started as early as possible. The skilled person can use an alternative in vitro assay that is able to assess the presence of aggregated Aβ peptides in mouse brain extracts.

[0094] Therefore, the second way to evaluate the activity of the oligonucleotides of the present invention is to determine the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably Aβ42 / 38 and / or Aβ42 / 40 ratio, and more preferably Aβ42 / 38 ratio) in the cell culture, tissue, plasma and / or CSF of the FAD subject treated. In an embodiment, the FAD patient is asymptomatic and has no detectable Aβ plaques in the brain. It is expected that the oligonucleotides reduce the production of long Aβ species, resulting in a reduction in soluble Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably Aβ42 / 38 ratio). When evaluating in a subject, it is preferably performed in the plasma and / or CSF of the subject.

[0095] Normalization, correction or reversal of an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio) may mean that the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio) is reduced by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% compared to the level at the start of treatment. The Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio) can be assessed by techniques known to the skilled person. In the examples, the assessment is performed using ELISA, preferably as performed in the experimental part.

[0096] If the assessment is performed in FAD patients with detectable A[beta] plaques in the brain, it is preferably performed in the patient's plasma rather than in the CSF.

[0097] The present invention uniquely uses such a readout, which directly proves the therapeutic effect of oligonucleotides on diseases or disorders associated with abnormal (or altered) processing of APP. This readout directly proves the downstream consequences of defects in the γ-secretase complexes present in cells, tissues, plasma and / or CSF of FAD patients by assessing Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios (preferably Aβ42 / 38 and / or Aβ42 / 40 ratios, more preferably Aβ42 / 38 ratios). In an embodiment, FAD patients are preferably asymptomatic, with no detectable Aβ plaques in the brain, as defined earlier herein. It is expected that the impact of oligonucleotides on this readout represents the therapeutic effect of patients with mutated γ-secretase complexes (preferably PSEN1) who will suffer from FAD. It is expected that the readout used (i.e., the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio)) is representative of FAD disease, and therefore normalization, correction or reversal of an abnormally increased soluble Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio) predicts the therapeutic activity of the oligonucleotide. This readout (any soluble Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably Aβ42 / 38 ratio), also referred to as the "long / short" Aβ ratio) is more representative and more predictive than a readout limited to a single "long" Aβ peptide (such as soluble Aβ42). The goal of therapy is to restore the normal enzymatic activity of the γ-secretase complex or to convert the activity of the complex to a more normal activity. Therefore, the skilled person understands that the long / short Aβ peptide ratio provides a better representation of the enzymatic activity of the γ-secretase complex than using only a single long form of Aβ. In other words, in order to better understand, visualize or monitor the activity state of the γ-secretase complex (preferably PSEN1), it is preferred to assess the production of several Aβ peptide species rather than just the production of its long form.

[0098] In the Examples, it is inferred that the antisense oligonucleotides of the invention can be considered active if:

[0099] The oligonucleotide is capable of normalizing, correcting or reversing an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably an Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably an Aβ42 / 38 ratio), wherein the evaluation result is compared with the level of the same Aβ ratio at the beginning of treatment (or the corresponding level of the same Aβ ratio in a healthy subject). The evaluation can be performed in cells, tissues, plasma, or CSF or a subject. When treating a subject, the ratio is preferably evaluated in the plasma of the subject. The subject can be an asymptomatic FAD subject. Alternatively, the subject can be a symptomatic FAD subject. If the subject is a symptomatic FAD subject, it is preferably evaluated using plasma. An alternative way to assess the effect of the oligonucleotides on the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratios, more preferably the Aβ42 / 38 ratios) is to assess the accumulation of Aβ plaques in the brain of the treated subject using imaging techniques. Imaging techniques may include PET scans of FAD patients. Imaging techniques may also include histological examinations of murine tissues.

[0100] In preferred embodiments, the antisense oligonucleotides of the present invention are considered active when:

[0101] - The oligonucleotide is capable of preferentially silencing, inactivating, degrading, knocking down or reducing or decreasing or correcting (the amount or level of) a mutant PSEN1 (or PSEN2) transcript

[0102] - the oligonucleotide is not (or minimally) capable of silencing, inactivating, degrading, knocking down or lowering or reducing or correcting (the amount or level of) a wild-type PSEN1 (or PSEN2) transcript, and

[0103] The oligonucleotide is capable of normalizing, correcting or reversing an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably an Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably an Aβ42 / 38 ratio), preferably wherein the evaluation result is compared with the level of the same mutant transcript or the same Aβ ratio at the beginning of treatment (or the corresponding level of the same Aβ ratio in a healthy subject). The evaluation can be performed in cells, tissues, plasma, or CSF or a subject. When treating a subject, the ratio is preferably evaluated in the plasma of the subject. The subject may be an asymptomatic FAD subject. Alternatively, the subject may be a symptomatic FAD subject. If the subject is a symptomatic FAD subject, plasma is preferably used for evaluation. An alternative way to assess the effect of the oligonucleotides on the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratios, more preferably the Aβ42 / 38 ratios) is to assess the accumulation of Aβ plaques in the brain of the treated subject using imaging techniques. Imaging techniques may include PET scans of FAD patients. Imaging techniques may also include histological examinations of murine tissues.

[0104] In another preferred embodiment, the antisense oligonucleotides of the present invention are considered active when:

[0105] - the oligonucleotide is capable of preferentially silencing, inactivating, degrading, knocking down or lowering or reducing or correcting (the amount or level of) a mutant PSEN1 (or PSEN2) protein,

[0106] - the oligonucleotide is not (or minimally) capable of silencing, inactivating, degrading, knocking down or lowering or reducing or correcting (the amount or level of) wild-type PSEN1 (or PSEN2) protein, and

[0107] - The oligonucleotide is capable of normalizing, correcting or reversing an abnormally increased soluble Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably Aβ42 / 38 ratio), preferably wherein the evaluation result is compared with the level of the same mutant protein or the same Aβ ratio at the beginning of treatment (or the corresponding level of the same Aβ ratio in a healthy subject). The evaluation can be performed in cells, tissues, plasma, or CSF or in a subject. The subject can be an asymptomatic FAD subject. Alternatively, the subject can be a symptomatic FAD subject. If the subject is a symptomatic FAD subject, it is preferably evaluated using plasma.

[0108] Silencing or inactivation or degradation or reduction or decrease or knockdown of the mutant transcript is expected to induce a similar decrease or reduction in the level of the mutant protein (preferably PSEN1).

[0109] In a more preferred embodiment, the antisense oligonucleotides of the present invention can be considered active in the following situations:

[0110] - the oligonucleotide is capable of preferentially silencing, inactivating, degrading, knocking down or lowering or reducing or correcting (the amount or level of) the mutant PSEN1 (or PSEN2) transcript,

[0111] - the oligonucleotide is not (or minimally) capable of silencing, inactivating, degrading, knocking down or lowering or reducing or correcting (the amount or level of) a wild-type PSEN1 (or PSEN2) transcript,

[0112] - the oligonucleotide is capable of normalizing, correcting or reversing an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably an Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably an Aβ42 / 38 ratio), and,

[0113] - The oligonucleotide is capable of reducing the formation of Aβ plaques, preferably when compared to the level of the same (mutated) transcript or the same Aβ ratio or the amount of Aβ plaques at the start of treatment (or to the corresponding level of the same transcript or Aβ ratio in healthy subjects).

[0114] ELISA can be used to assess the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios, preferably as performed in the experimental section. Imaging techniques can be used to assess the formation of Aβ plaques in the brain of treated subjects. Imaging techniques can include PET scans of FAD patients. Imaging techniques can also include histological examinations of murine tissues.

[0115] The ratio can be assessed in cells, tissues, plasma, or CSF or in a subject. When treating a subject, the ratio is preferably assessed in the subject's plasma. The subject can be an asymptomatic FAD subject. Alternatively, the subject can be a symptomatic FAD subject. If the subject is a symptomatic FAD subject, plasma is preferably used for assessment.

[0116] In an embodiment, when present in a cell expressing a mutated allele of the protein PSEN1 or PSEN2, the antisense-oligonucleotides of the invention preferentially target said mutated allele (and do not target or minimally target the WT allele). Preferred cells have been defined earlier herein. In a preferred embodiment, when present in a cell expressing a mutated allele of the protein PSEN1 of the γ-secretase complex (preferably the human protein PSEN1), the antisense-oligonucleotides of the invention preferentially target said mutated allele (and do not target or minimally target the WT allele). Preferred cells have been defined earlier herein.

[0117] Preferably, the antisense oligonucleotides of the present invention are said to be active if,

[0118] - it is capable of silencing, inactivating, knocking down, lowering, decomposing, correcting or reducing (the amount or level of) said mutant allele or transcript, and

[0119] The level of the corresponding wild-type allele or transcript is no less than 50%, 60%, 70%, 80%, 90%, 95% or 100% of the level of the same allele or transcript at the start of treatment.

[0120] The allele or transcript is preferably from the PSEN1 or PSEN2 gene, more preferably from the PSEN1 gene. In principle, the present invention is not limited to specific mutations found in PSEN1 or PSEN2. There are already several hundred mutations in PSEN1 known to be associated with FAD. Examples of mutations in PSEN1 that cause FAD and can be potentially targeted by the oligonucleotides of the invention: R35Q; E69D; A79V; V82L; I83T; M84V; L85P; P88L; V89L; V89L; C92S; V94M; V96F; V97L; T99A; F105C; F105I; F105L; F105V; R108Q; L113P; L113Q; Y115C; Y115D; Y115H; T116I; T116N; T116R; P117A; P117L; P117R ;P117S; E120D; E120D; E120G; E120K; E123K; H131R; S132A; L134R; N135D; N135S; M139T; M139V; V142F; I143F; I143M; I143N; I143T; I143V; M146I; M146I; M146I; 53V; Y154C; Y154N; Y156F; R157insIY; R157S; H163P; H163R; H163Y; A164V ;W165C; W165C; W165G; L166H; L166P; L166R; L166V; S169L; S169P; S170F; S170P; L171P; L173F; L173F; L173W; L174del; L174M; L174R; F175S; F176L ;F177L;F177S;S178P;G183V;E184D;E184G;V191A;I202F;G206A;G206D;G 206S; G206V; G209A; G209E; G209R; G209V; S212Y; I213F; I213L; I213T; H2 14D; H214N; H214Y; G217D; G217R; L219F; L219P; L219R; R220P; Q222H; Q22 2P; Q222R; Q223R; L226F; L226R; I229F; S230I; S230N; S230R; A231P; A231 T;A231V;L232P;M233I;M233I;M233L;M233L;M233T;M233V;L235P;L235R;L235V; F237I; F237L; 1238M; K239N; T245P; A246E; A246P; L248P; L248R; L250F; L250S; L250V; Y2 56S; D257A, A260V; V261F; V261L; L262F; L262V; C263F; C263R; P264L; G266S; P267A; P267L; P267S ; R269G; R269H; L271V; V272A; E273A; E273G; T274R; A275V; R278I; R278K; R278S; R278T; E280A; E2 80G; E280K; L282F; L282R; L282V; F283L; P284L; P284S; A285V; L286P; L286V; T291A; T291P; K311R ;E318G; D333G; R352C; R352_S353insR; T354I; R358Q; S365A; S365Y; R377M; R377W; G378E; G378V ;G378fs; L381F; L381V; G384A; F386I; F386S; F388L; S390I; S390N; V391F; V391G; L392P; L392V; G 394V; A396T; N405S; I408T; A409T; C410Y; V412I; I416T; G417S; L418F; L420R; L424F; L424H; L424R; L424V; A426P; A431E; A431V; A434C; A434T; L435F; P436Q; P436S; I437V; I439S; I439V; or M457V. ;

[0121] Examples of mutations in PSEN2 that cause FAD and can be targeted by the oligonucleotides of the invention: T18M; R29H; G34S; R62C; R62H; P69A; R71W; K82R; A85V; V101M; K115Efs; T122P; T122R; P123L; E126fs; E126K; S130L; V139M; N141I; N141Y; L143H; V148 I; K161R; R163H; H169N; M174V; S175C; G212V; V214L; Q228L; Y231C; 1235F; A237V; L238F; L238P ;M239I; M239V; A252T; A258T; T301M; K306fs; P334A; P334R; P348L; A377V; V393M; T430M; or D439A

[0122] In an embodiment, the PSEN1 mutation is selected from the group consisting of the following most common PSEN1 mutations: P117L, M139T, M139V, M146I, H163R, G206A, P264L, E280A, L392V and A431E, more preferably E280A and A431E. The most preferred mutation in PSEN1 is A431E. In an embodiment, the PSEN1 mutation is selected from the group consisting of the following most common PSEN1 mutations: P117L, M139T, M139V, M146I, H163R, G206A, P264L, E280A, L392V, A431E and S212Y, more preferably E280A and A431E. The most preferred mutation in PSEN1 is A431E.

[0123] In an embodiment, the PSEN1 mutation is selected from the group consisting of mutations caused by changes of guanine, thymine or cytosine in the coding sequence to adenosine, which change results in one of the following mutations in the PSEN1 protein: R35Q, V94M, F105I, R108Q, L113Q, T116N, P117T, P117Q, E120K, E123K, M139K, M139I, V142I, M146I, V151M, Y154N, L166H, L174M, I180N, G206S, G206D, G 209R, G209E, S212Y, H214N, G217D, S230N, A231T, M233I, F237I, A246E, Y256N, V261I, G266S, R269H, V272D, T274K, R278K, E280K, R358Q, A360T, S365Y, G378E, F386I, F386L, S390N, A396T, A409T, C410Y, G417S, L424H, A431E, A434T, P436Q. The most preferred mutation in PSEN1 is A431E. For all of these mutations, the oligonucleotides can be designed as follows: when the base of the nucleotide present in the oligonucleotide and targeted for mutation is thymine, the thymine is replaced by uracil. Examples of oligonucleotides targeting the A431E mutant allele of PSEN1 are provided. Such examples are disclosed in SEQ ID NOs: 26, 28, 30, 33, 35, 37, 39. Examples of oligonucleotides targeting the S212Y mutant allele of PSEN1 are also provided. Such examples are disclosed in SEQ ID NOs: 188, 190, 192, 194, 198, 200.

[0124] This thymine of the preferred oligonucleotide of this sudden change via thymine targeting is replaced by uracil, and this uracil is located at the first, second or third position of its central part. This thymine of the preferred oligonucleotide of this sudden change via thymine targeting is replaced by uracil at the sixth, seventh or eighth nucleotide from 5' to 3' in the oligonucleotide sequence. This thymine of other preferred oligonucleotides of this sudden change via thymine targeting is replaced by uracil, and this uracil is located at the first, second, third or seventh position of the oligonucleotide central part. This thymine of the preferred oligonucleotide of this sudden change via thymine targeting is replaced by uracil at the sixth, seventh, eighth or twelfth nucleotide from 5' to 3' in the oligonucleotide sequence. This replacement increases the mutant allele selectivity (referring to Example 3-4), and it may be due to the slight reduction of melting temperature (Tm). Indeed, Examples 3 and 4 show that antisense oligonucleotides with thymine-uracil substitutions at the preferred nucleotide positions above exhibit increased selectivity for mutant alleles of PSEN1. Examples of oligonucleotides targeting the A431E or S212Y mutant alleles of PSEN1 are provided. Preferred examples can be found in SEQ ID NO: 28, 30, 33, 37, 39, 47, 97, 99, 115, 192, 194, 198.

[0125] As used herein, the "central portion" or "central region" of the term antisense oligonucleotide refers to a specific portion or segment of an oligonucleotide sequence. The precise definition and boundaries of the central portion can vary according to the context of the present invention. In the context of the first aspect of the present invention, the central portion can be determined based on the nucleotide position relative to the end of the oligonucleotide. In the context of the second aspect of the present invention, the central portion refers to the different regions of the spacer oligomer present between the two flanking regions / wings. With regard to these two aspects, the technician understands that the central portion is designed to specifically target the allele of the mutation of the protein of the γ-secretase complex.

[0126] As known to the skilled person, oligonucleotides are polymers of nucleotides and / or polymers of nucleotide analogs. The expression "nucleotide analogs" can be replaced by "derived from nucleotides". Oligonucleotides comprise or consist of repeating monomers. In the context of the present invention, oligonucleotides comprise up to 50 nucleotides and / or nucleotide analogs. The oligonucleotides can have 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides. Such oligonucleotides can also be identified as oligonucleotides with 10 to 50 nucleotides or 12 to 50 nucleotides. Attractive results were obtained with oligonucleotides ranging in length from 15 to 30 nucleotides (15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides).

[0127] In an embodiment, the antisense oligonucleotide of the present invention comprises nucleotides and / or nucleotide analogs. In another embodiment, the antisense oligonucleotide of the present invention comprises 15 to 30 nucleotides, which include a central region of DNA nucleotides (and / or DNA nucleotide analogs), and the central region is flanked by a wing region comprising an RNA nucleotide analog at each end. In a preferred embodiment, the antisense oligonucleotide comprising 15 to 30 nucleotides (these nucleotides include a central region of DNA nucleotides, and the central region is flanked by a wing region comprising an RNA nucleotide analog at each end) relates to the antisense oligonucleotide of the second aspect of the present invention. DNA nucleotide analogs may be present in the central region of DNA nucleotides, as long as RNase H is naturally recruited to the AON target RNA duplex without being significantly reduced or hindered or completely eliminated and / or the activity of DNA nucleotides to the target is not significantly reduced. In this context, "its activity is not significantly reduced" means that the activity of the oligonucleotide having one or more DNA analog nucleotides in the central portion is better or similar or not less than 50%, 60%, 70%, 80% or 90% compared to the oligonucleotide having only DNA nucleotides in the central portion. Thus, the antisense oligonucleotide as defined herein is capable of recruiting RNase H to silence, inactivate, knock down, degrade, reduce or decrease (the level or expression of) the targeted mutant allele.

[0128] In another embodiment, the antisense-oligonucleotide of the present invention comprises 15 to 30 nucleotides, including a central region of continuous DNA nucleotides (and / or DNA nucleotide analogs), and the central region is flanked by a wing region comprising an RNA nucleotide analog at each end. In another embodiment, the antisense-oligonucleotide of the present invention comprises 15 to 30 nucleotides, including a central region of continuous DNA nucleotides (and / or DNA nucleotide analogs), and the central region is flanked by a wing region comprising continuous RNA nucleotide analogs at each end. In a preferred embodiment, the antisense-oligonucleotide of the present invention comprises 15 to 30 nucleotides, including a central region of 5 to 15 continuous DNA nucleotides (and / or DNA nucleotide analogs), and the central region is flanked by a wing region comprising 1 to 5 RNA nucleotide analogs at each end. In a preferred embodiment, the antisense-oligonucleotide of the present invention comprises 15 to 30 nucleotides, including a central region of 5 to 15 continuous DNA nucleotide analogs, and the central region is flanked by a wing region comprising 1 to 5 RNA nucleotide analogs at each end. In a preferred embodiment, an antisense oligonucleotide comprising 15 to 30 nucleotides (these nucleotides include a central region of (continuous) DNA nucleotides (and / or DNA nucleotide analogs) which is flanked at each end by a wing region comprising (continuous) RNA nucleotide analogs) relates to the antisense oligonucleotide of the second aspect of the invention. In another preferred embodiment, an antisense oligonucleotide comprising 15 to 30 nucleotides (these nucleotides include a central region of 5 to 15 (continuous) DNA nucleotides (and / or DNA nucleotide analogs) which is flanked at each end by a wing region comprising 1 to 5 RNA nucleotide analogs) relates to the antisense oligonucleotide of the second aspect of the invention.

[0129] In an embodiment, the central region comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 DNA nucleotides and / or DNA nucleotide analogs. Preferably, the length of the central region is 9, 10 or 11 DNA nucleotides and / or DNA nucleotide analogs. In another embodiment, a wing region comprises 1, 2, 3, 4 or 5 RNA nucleotide analogs. Preferably, the length of a wing region is 2 or 4 RNA nucleotide analogs. In another embodiment, each wing region comprises 1, 2, 3, 4 or 5 RNA nucleotide analogs. Preferably, the length of each wing region is 2 or 5 RNA nucleotide analogs. The present invention also encompasses that each wing region is different in length and / or in the chemical type used in the RNA nucleotide analogs.

[0130] In an embodiment, the central region comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 continuous DNA nucleotides and / or DNA nucleotide analogs. Preferably, the length of the central region is 9, 10 or 11 continuous DNA nucleotides and / or DNA nucleotide analogs. In another embodiment, a wing region comprises 1, 2, 3, 4 or 5 continuous RNA nucleotide analogs. Preferably, the length of a wing region is 2 or 5 continuous RNA nucleotide analogs. In an embodiment, each wing region comprises 1, 2, 3, 4 or 5 continuous RNA nucleotide analogs. Preferably, the length of each wing region is 2 or 5 continuous RNA nucleotide analogs. The present invention also encompasses that each wing region is different in length and / or in the chemical type used in the RNA nucleotide analogs.

[0131] In an embodiment, the central region is 10 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 5 continuous RNA nucleotide analogs. In another embodiment, the central region is 10 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 4 continuous RNA nucleotide analogs. In another embodiment, the central region is 10 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 3 continuous RNA nucleotide analogs. In another embodiment, the central region is 10 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 2 continuous RNA nucleotide analogs. In another embodiment, the central region is 10 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 1 continuous RNA nucleotide analog.

[0132] In an embodiment, the central region is 11 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 5 continuous RNA nucleotide analogs. In another embodiment, the central region is 11 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 4 continuous RNA nucleotide analogs. In another embodiment, the central region is 11 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 3 continuous RNA nucleotide analogs. In another embodiment, the central region is 11 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 2 continuous RNA nucleotide analogs. In another embodiment, the central region is 11 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 1 continuous RNA nucleotide analog.

[0133] In an embodiment, the central region is 9 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 5 continuous RNA nucleotide analogs. In another embodiment, the central region is 9 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 4 continuous RNA nucleotide analogs. In another embodiment, the central region is 9 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 3 continuous RNA nucleotide analogs. In another embodiment, the central region is 9 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 2 continuous RNA nucleotide analogs. In another embodiment, the central region is 9 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 1 continuous RNA nucleotide analog.

[0134] In an embodiment, the central region is 12 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 5 continuous RNA nucleotide analogs. In another embodiment, the central region is 12 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 4 continuous RNA nucleotide analogs. In another embodiment, the central region is 12 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 3 continuous RNA nucleotide analogs. In another embodiment, the central region is 12 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 2 continuous RNA nucleotide analogs. In another embodiment, the central region is 12 continuous DNA nucleotides and / or DNA nucleotide analogs, and each wing region is 1 continuous RNA nucleotide analog.

[0135] In a preferred embodiment, a mutation in an allele or transcript of PSEN1 or PSEN2 is targeted by a nucleotide of an oligonucleotide present in the central portion of the oligonucleotide; the central portion is 5 to 15 nucleotides, and each wing is 1 to 5 nucleotides. In a preferred embodiment, an antisense oligonucleotide comprising a nucleotide present in the central portion of the oligonucleotide (the nucleotide targets a mutation in an allele or transcript of PSEN1 or PSEN2) relates to an antisense oligonucleotide of the second aspect of the invention. It was unexpectedly found that when the nucleotide of the mutant nucleotide targeting PSEN1 or PSEN2 in the oligonucleotide is located in the central portion of the oligonucleotide, the efficacy and selectivity of the oligonucleotide to the mutant PSEN1 or PSEN2 allele or transcript are optimal. Specifically, as shown in Examples 3 and 4, when the nucleotide of the mutant nucleotide targeting PSEN1 is located in the first five nucleotides from 5' to 3' of the central portion of the oligonucleotide (i.e., a nucleotide located at position 6, 7, 8, 9 or 10 from 5' to 3' in the oligonucleotide sequence), the antisense oligonucleotide has an increased selectivity for the mutant PSEN1 allele.

[0136] In an embodiment, the nucleotide is the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, tenth, eleventh or twelfth nucleotide from 5' to 3' in the central part of the oligonucleotide. In a described embodiment, the nucleotide is the sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth or eighteenth nucleotide from 5' to 3' in the oligonucleotide sequence. In a preferred embodiment, the nucleotide is the first, second, third, fourth or fifth nucleotide from 5' to 3' in the central part of the oligonucleotide. Therefore, in the described preferred embodiment, the nucleotide is the sixth, seventh, eighth, ninth or tenth nucleotide from 5' to 3' in the oligonucleotide sequence. In an embodiment, the nucleotide is the first, second, third or fifth nucleotide from 5' to 3' in the central part of the oligonucleotide. In the described preferred embodiment, the nucleotide is the sixth, seventh, eighth or tenth nucleotide from 5' to 3' in the oligonucleotide sequence portion. In an embodiment, when the base of the nucleotide present in the oligonucleotide and targeted for mutation is thymine, the thymine is replaced by uracil. Examples of oligonucleotides targeting the A431E mutant allele of PSEN1 are provided. Such examples are disclosed in SEQ ID NO: 26, 28, 30, 33, 35, 37, 39.

[0137] Examples of oligonucleotides targeting the S212Y mutant allele of PSEN1 are also provided. Such examples are disclosed in SEQ ID NO: 188, 190, 192, 194, 198, 200.

[0138] This thymine of the preferred oligonucleotide of this sudden change via thymine targeting is replaced by uracil, and this uracil is located at the first, second or third position of its central part.Therefore, the preferred oligonucleotide of targeting this sudden change is replaced by uracil at the sixth, seventh or eighth position of the oligonucleotide sequence from 5' to 3'.This thymine of other preferred oligonucleotides of this sudden change via thymine targeting is replaced by uracil, and this uracil is located at the first, second, third or seventh position of the oligonucleotide central part.Described preferred oligonucleotide is replaced by uracil at the sixth, seventh, eighth or twelfth position of the oligonucleotide sequence from 5' to 3'.This replacement increases the mutant allele selectivity, probably because Tm is slightly reduced.Preferred examples are found in SEQ ID NO:28,30,33,37,39,47,97,99,115,192,194,198.

[0139] Thus, in a preferred embodiment, the oligonucleotide is as follows:

[0140] - it comprises a central portion of 5 to 15 nucleotides and two wings, each with 1 to 5 nucleotides, and

[0141] - A mutation present in a mutant allele or transcript of PSEN1 or PSEN2 is targeted by the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh or twelfth nucleotide of the central portion of the oligonucleotide.

[0142] In a preferred embodiment, the oligonucleotide is as follows:

[0143] - it comprises a central portion of 5 to 15 nucleotides and two wings, each with 1 to 5 nucleotides, and

[0144] - A mutation present in a mutant allele or transcript of PSEN1 or PSEN2 is targeted by the sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth or eighteenth nucleotide starting from 5' to 3' of the oligonucleotide sequence.

[0145] Therefore, in a preferred embodiment, the antisense oligonucleotide relates to the antisense oligonucleotide of the second aspect of the invention.

[0146] In another preferred embodiment, the base of the nucleotide in the oligonucleotide that targets a mutation present in a PSEN1 or PSEN2 allele or transcript is an RNA base. In a more preferred embodiment, the RNA base is uracil. More preferably, the target mutation is a C to A mutation, but the target mutation may also be a G or T to A mutation.

[0147] In an embodiment, the antisense oligonucleotide of the present invention comprises nucleotides and nucleotide analogs. Nucleotides can be RNA or DNA nucleotides. The most common naturally occurring nucleotides in RNA are adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, thymidine monophosphate and uridine monophosphate. They consist of a 5'-connected phosphate group and a 1'-connected base connected via a phosphate ester. The same applies to DNA in which deoxyribose is present instead of ribose. Sugar connects bases and phosphate bonds, and is therefore generally referred to as a scaffold of nucleotides. Therefore, the modification in pentose is generally referred to as a scaffold modification. Therefore, sugar modification can be referred to as a scaffold modification. For several modifications, the original pentose may be completely replaced by another part that is similarly connected to a base and phosphate. Therefore, it can be understood that although pentose is generally a scaffold, a scaffold is not necessarily a pentose.

[0148] Base, sometimes referred to as a nuclear base, is typically adenine, cytosine, guanine, thymine or uracil or a derivative thereof. Cytosine, thymine and uracil are pyrimidine bases and are typically connected to a support via their 1-nitrogen. Adenine and guanine are purine bases and are typically connected to a support via their 9-nitrogen. The base present in an oligonucleotide is typically complementary to a target region. If such a base is a modified base or if a base analog is used, the modified base or base analog should maintain the same base pair specificity as the base it replaces. "Base pairing" refers to two bases (or nuclear bases) that are mutually bound by hydrogen bonds. In particular, a nucleobase analog replacing cytosine is capable of base pairing with guanine, a nucleobase analog replacing guanine is capable of base pairing with cytosine, a nucleobase analog replacing adenine is capable of base pairing with uracil, and a nucleobase replacing uracil is capable of base pairing with adenine.

[0149] Nucleotide is usually connected to adjacent nucleotides by the condensation of its 5'-phosphate part and the 3'-hydroxyl part of adjacent nucleotide monomer. Similarly, its 3'-hydroxyl part is usually connected to the 5'-phosphate of adjacent nucleotide monomer. This forms a phosphodiester bond. Phosphodiester and support form an alternating copolymer. Bases are grafted onto this copolymer, i.e., grafted onto the support part. Due to this feature, the alternating copolymer formed by the connection monomers of oligonucleotides is generally referred to as the backbone of oligonucleotides. Since phosphodiester bonds connect adjacent monomers together, they are generally referred to as backbone bonds. It should be understood that when the phosphate group is modified to make it a similar part (such as thiophosphate (PS)), such a part is still referred to as the backbone bond of monomers. This is referred to as backbone bond modification. Therefore, usually, the backbone of an oligonucleotide is composed of alternating supports and backbone bonds. In an embodiment, the backbone (central part and wing) of an oligonucleotide is fully modified, preferably a PS backbone.

[0150] In an embodiment, the antisense oligonucleotide comprises a modified RNA portion in a central portion and each wing containing a DNA nucleotide (or a DNA nucleotide analog). In a preferred embodiment, the antisense oligonucleotide comprising a modified RNA portion in a central portion and each wing containing a DNA nucleotide (or a DNA nucleotide analog) relates to the antisense oligonucleotide of a second aspect of the present invention. RNA or DNA nucleotide can be modified, and therefore can be considered as RNA or DNA nucleotide analog when it comprises modified bases and / or modified sugar. In addition, compared with the phosphodiester bond connecting two nucleosides, the internucleoside bond connecting two adjacent nucleosides can be modified. As explained earlier herein, the wording "backbone bond modification" can be substituted for "modified internucleoside bond".

[0151] In an embodiment, the antisense-oligonucleotide of the invention comprises a central portion (or region) of DNA flanked by a modified RNA portion (region) (wing) at each end. In another embodiment, the antisense-oligonucleotide of the invention comprises a central portion (or region) of modified DNA flanked by a modified RNA portion (region) (wing) at each end. In a preferred embodiment, the antisense-oligonucleotide of the invention (which comprises a central portion of modified DNA flanked by a modified RNA portion at each end) relates to the antisense-oligonucleotide of the second aspect of the invention.

[0152] In an embodiment, the oligonucleotide of the present invention composed of 5' wing, 3' wing and central part (gap) is single-stranded. This structure (5' wing, 3' wing and central part (gap)) can also be referred to as a spacer oligomer. In a preferred embodiment, the single-stranded antisense oligonucleotide composed of 5' wing, 3' wing and central part relates to the antisense oligonucleotide of the second aspect of the present invention. The structure is attractive because it allows the oligonucleotide to bind to the target mRNA and recruit RNase H. The RNase H raised has at least one of the following effects on the mutant allele of the target: silencing, inactivation, knocking down, decomposition, reducing or reducing its level. In contrast, double-stranded siRNA cannot recruit RNase H, but relies on Argonaute protein for silencing the target mRNA. Double-stranded siRNA is loaded into the silencing complex (RISC) induced by RNA. After RISC is loaded, the 5' end of the poor thermodynamic stability of siRNA is incorporated and RISC is guided to the complementary target mRNA. Following Argonaute-dependent cleavage, the mRNA target dissociates from the intact siRNA, freeing RISC to regenerate and cleave additional mRNA targets.

[0153] The presence of wings provides antisense oligonucleotide stability and resistance to degradation by exonucleases.Compared with oligonucleotides composed of unmodified DNA and / or unmodified RNA analogs, chemical modifications (including bases, support and / or key modifications) implemented in gaps and / or wings can improve the safety, biodistribution, stability, cellular uptake, intracellular transport, target binding affinity, duplex stability and efficiency of the oligonucleotides of the present invention.This effect may be at least due to the presence of modified RNA wings and / or modified DNA central parts.The fine-tuning (precision chemistry) of DNA and / or RNA bases, support and / or key modifications at specific positions in oligonucleotides can produce oligonucleotides with the most favorable features for clinical applications.

[0154] In an embodiment, the central part / district (gap) of the antisense oligonucleotide comprises DNA nucleotides or DNA nucleotide analogs. In a preferred embodiment, the bases and sugars of this part of the antisense oligonucleotide are not modified. However, in a more preferred embodiment, the internucleoside bond (or whole skeleton) in this central part is modified. In an embodiment, the modified internucleoside bond is a thiophosphate or phosphoramidate internucleoside bond. Compared with the antisense oligonucleotide with a fully unmodified DNA central part, the nucleotides in the central part / district of the antisense oligonucleotide can have at least one internucleoside bond modification and / or at least one base modification.

[0155] In an embodiment, the wing of the antisense oligonucleotide comprises modified RNA nucleotides and / or modified internucleoside bonds. In an embodiment, both wings of the antisense oligonucleotide comprise modified RNA nucleotides and / or modified internucleoside bonds. Compared with the antisense oligonucleotide based on unmodified RNA, the wing of the antisense oligonucleotide can have at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification. In an embodiment, the modified internucleoside bond is a phosphorothioate or phosphoramidate internucleoside bond.

[0156] Base modifications in the central portion and / or wings of the oligonucleotide include modified forms of natural purine and pyrimidine bases (e.g., adenine, uracil, guanine, cytosine and thymine), such as hypoxanthine (e.g., inosine), orotic acid, agmatidine, lysine, pseudouracil, 2-thiopyrimidines (e.g., 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5-substituted pyrimidines (e.g., 5-halouracil, 5- Propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, SuperT), 7-deazaguanine, 7-deazaadenine, 2,6-diaminopurine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A and N4-ethylcytosine or its derivatives; N2-cyclopentylguanine (cPent-G), N2-cyclopentyl-2-aminopurine (cPent-AP) and N2-propyl-2-aminopurine (Pr-AP) or their derivatives; and degenerate bases or universal bases (like 2,6-difluorotoluene) or the absence of bases (like abasic sites (e.g., 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose); or pyrrolidine derivatives in which the ring oxygen has been replaced by nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in U.S. Pat. No. 6,683,173 (Epoch Biosciences), which is incorporated herein by reference in its entirety. cPent-G, cPent-AP and Pr-AP have been shown to reduce immunostimulatory effects when incorporated into siRNA (Peacock H. et al.).

[0157] A preferred modified base is 5-methylcytosine.

[0158] Depending on the length of each wing, the antisense oligonucleotide of the invention may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 base modifications. The invention also encompasses the introduction of more than one different base modification in the wing of the antisense oligonucleotide.

[0159] According to the length of the central part, the antisense oligonucleotide of the present invention can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 base modifications. The present invention also encompasses the introduction of more than one different base modification in the central part of the antisense oligonucleotide.

[0160] According to the length of the antisense oligonucleotide, the antisense oligonucleotide of the present invention can comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more base modifications. The present invention also encompasses the introduction of more than one different base modification in the antisense oligonucleotide.

[0161] Modified sugars in the nucleotides of the wings and / or central portion of the antisense oligonucleotide are synonymous with scaffold modifications of the oligonucleotide.

[0162] Scaffold modifications may include modified forms of ribosyl moieties such as 2'-O-modified RNAs such as 2'-O-alkyl or 2'-O-(substituted)alkyl, e.g., 2'-O-methyl, 2'-O-(2-cyanoethyl), 2'-O-(2-methoxy)ethyl (2'-MOE), 2'-O-(2-thiomethyl)ethyl, 2'-O-butyryl, 2'-O-propargyl, 2'-O-acetal esters (e.g., as in Biscans et al. Bioorg. Med. Chem. 2015, 23, 5360), 2'-O-allyl, 2'-O- -(2S-methoxypropyl), 2'-O-(N-(aminoethyl)carbamoyl)methyl)(2'-AECM), 2'-O-(2-carboxyethyl) and carbamoyl derivatives (Yamada et al. Org. Biomol. Chem. 2014, 12, 6457), 2'-O-(2-amino)propyl, 2'-O-(2-(dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy (DNA); 2'-O-(haloalkoxy)methyl (Arai K. et al. Bioorg. Med. Chem. [Bioorg. Med. Chem.] 2011, 21, 6285), such as 2'-O-(2-chloroethoxy)methyl (MCEM), 2'-O-(2,2-dichloroethoxy)methyl (DCEM); 2'-O-alkoxycarbonyl, such as 2'-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), 2'-O-[2-(N,N-dimethylcarbamoyl)ethyl] (DCEM); ME), 2'-O-[2-(methylthio)ethyl] (2'-MTE), 2'-(ω-O-serinol); 2'-halo, such as 2'-F,FANA (2'-F arabino nucleic acid); 2',4'-difluoro-2'-deoxy; carbon sugar and azasugar modifications; 3'-O-substituted, such as 3'-O-methyl, 3'-O-butyryl, 3'-O-propargyl; 4'-substituted, such as 4'-aminomethyl-2'-O-methyl or 4'-aminomethyl-2'-fluoro; 5'-substituted, such as 5'-methyl or CNA ( et al. ACS Chem.Biol. [ACS Chemical Biology] 2014, 22, 6227); and its derivatives.

[0163] The scaffold modification may include a bicyclic nucleic acid monomer (BNA), which may be a bridged nucleic acid monomer. Each occurrence of the BNA may result in a monomer independently selected from the group consisting of: a conformationally restricted nucleotide (CRN) monomer, a locked nucleic acid (LNA) monomer, a wood-LNA monomer, an α-LNA monomer, an α-L-LNA monomer, a β-D-LNA monomer, a 2'-amino-LNA monomer, a 2'-(alkylamino)-LNA monomer, a 2'-(acylamino)-LNA monomer, a 2'-N-substituted-2'-amino-LNA monomer, a 2'-thio-LNA monomer, a (2'-O, 4'-C) constrained ethyl (cEt) BNA monomer, a (2'-O, 4'-C) constrained methoxyethyl (cMOE) BNA monomer, a 2',4'-BNA NC (NH) monomer, 2',4'-BNA NC (N-Me) monomer, 2',4'-BNA NC (N-Bn) monomers, ethylene-bridged nucleic acid (ENA) monomers, carba LNA (cLNA) monomers, 3,4-dihydro-2H-pyranose nucleic acid (DpNA) monomers, 2'-C-bridged bicyclic nucleotide (CBBN) monomers, heterocyclic bridged BNA monomers (such as triazole or tetrazolyl linked), amide-bridged BNA monomers, urea-bridged BNA monomers, sulfonamide-bridged BNA monomers, bicyclic carbocyclic nucleotide monomers, TriNA monomers, α-L-TriNA monomers, bicyclic DNA (bcDNA) monomers, abcDNA monomers, F-bcDNA monomers, tricyclic DNA (tcDNA) monomers, F-tcDNA monomers, oxetane nucleotide monomers, locked PMO monomers derived from 2'-amino-LNA, guanidine-bridged nucleic acid (GuNA) monomers, spirocyclopropene-bridged nucleic acid (scpBNA) monomers and their derivatives.

[0164] Preferred sugar modifications are selected from:

[0165] -2'-O-modified RNA, more preferably 2'-O-alkyl or 2'-O-(substituted)alkyl, even more preferably 2'-O-methyl (2'-OMe) or 2'-O-(2-methoxy)ethyl (2'-MOE)

[0166] - (BNA), more preferably (CRN) monomers or locked nucleic acid (LNA) monomers.

[0167] More preferred sugar modifications are 2'-OMe, 2'-MOE and locked nucleic acid (LNA).

[0168] Depending on the length of each wing, the antisense oligonucleotide of the invention may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 sugar modifications. The invention also encompasses the introduction of more than one different sugar modification in the wing of the antisense oligonucleotide.

[0169] Depending on the length of the central portion, the antisense oligonucleotide of the invention may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 sugar modifications. The invention also encompasses the introduction of more than one different sugar modification in the wings of the antisense oligonucleotide.

[0170] Depending on the length of the antisense oligonucleotide, the antisense oligonucleotide of the invention can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more sugar modifications. The present invention also encompasses the introduction of more than one different sugar modification in the antisense oligonucleotide.

[0171] The antisense oligonucleotide according to the present invention may comprise a backbone bond modification in its wings and / or in its central portion. The backbone bond modification may be, but is not limited to, a modified form of a phosphodiester present in RNA, such as phosphorothioate (PS), chiral pure phosphorothioate, (R)-phosphorothioate, (S)-phosphorothioate, phosphorodithioate (PS2), phosphonoacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate (thioPACE), thiophosphonoacetamide, phosphorothioate prodrugs, H-phosphonates, methyl phosphonates, methyl thiophosphonates, methyl phosphates, methyl thiophosphonates, ethyl phosphates, ethyl thiophosphonates, borophosphates, borothiophosphates, methyl borophosphates, methyl borothiophosphates, methyl borophosphonates, methyl borophosphonates, methyl borothiophosphonates, phosphoesters, phosphotriesters, aminoalkylphosphotriesters and derivatives thereof. Another modification includes phosphoguanidine, acylphosphoramidate, sulfonylphosphoramidate, phosphoramidite, phosphoramidate, N3'→P5'phosphoramidate, phosphordiamidate, thiophosphordiamidate, aminosulfonate, dimethylene sulfoxide, amide, sulfonate, siloxane, sulfide, sulfone, acetyl, thioacetyl, methyleneacetyl, alkenyl, methylenehydrazine, sulfonamide, amide, triazole, oxalyl, carbamate, methyleneimino (MMI) and thioacetamido nucleic acid (TANA); and derivatives thereof. Examples of chiral pure thiophosphate bonds are described in, for example, WO 2014 / 010250 or WO 2017 / 062862 (WaVe Life Sciences). Examples of phosphoguanidine bonds are described in WO 2016 / 028187 (Noogen). Various salts, mixed salts and free acid forms are also included, as well as 3'→3' and 2'→5' linkages.

[0172] Preferred backbone bond modifications are phosphorothioates and phosphoramidates.

[0173] More preferred backbone bond modifications are phosphorothioates and phosphoramidates (preferably methanesulfonyl-phosphoramidate).

[0174] According to its length, the antisense-oligonucleotide of the present invention can comprise 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30 or more backbone bond modifications.The present invention also contemplates that more than one different backbone modifications are introduced in the antisense-oligonucleotide.

[0175] In embodiments, the antisense oligonucleotide is such that the DNA nucleotides in its central portion are not modified.

[0176] In another embodiment, the antisense oligonucleotide is such that the DNA nucleotides in its central portion are modified and at least a portion of the backbone (i.e., the internucleoside linkages) in its central portion comprises phosphorothioate and / or phosphoramidate (preferably methylsulfonyl-phosphoramidate).

[0177] In an embodiment, the antisense oligonucleotide is such that the RNA nucleotide analog in each wing has been modified to contain a modified internucleoside linkage (preferably phosphorothioate and / or phosphoramidite (preferably methylsulfonyl-phosphoramidate)) and / or a modified sugar (preferably 2'-MOE, 2'-OMe and / or locked nucleic acid (LNA) monomer) and / or a modified base (preferably 5-methylcytosine).

[0178] In an embodiment, the antisense oligonucleotide is:

[0179] The DNA nucleotides in its central portion have not been modified, and

[0180] The RNA nucleotide analogues in each of its wings have been modified to contain a modified internucleoside linkage (preferably phosphorothioate or phosphoramidate (more preferably methylsulfonyl-phosphoramidate)) and / or a modified sugar (preferably 2'-MOE, 2'-OMe and / or locked nucleic acid (LNA) monomers) and / or a modified base (preferably 5-methylcytosine).

[0181] In an embodiment, the antisense oligonucleotide is:

[0182] the DNA nucleotides in its central portion have been modified and the backbone (i.e. at least one internucleoside bond) in its center comprises phosphorothioate or phosphoramidate (more preferably mesyl-phosphoramidate), and

[0183] The RNA nucleotide analogues in each of its wings have been modified to contain a modified internucleoside linkage (preferably phosphorothioate or phosphoramidate (more preferably methylsulfonyl-phosphoramidate)) and / or a modified sugar (preferably 2'-MOE, 2'-OMe and / or locked nucleic acid (LNA) monomers) and / or a modified base (preferably 5-methylcytosine).

[0184] In an embodiment, the antisense oligonucleotide comprises 15 to 30 or 20 to 30 nucleotides, which include a central region of 5 to 15 continuous DNA nucleotides, and the central region comprises a wing region of 1 to 5 RNA nucleotide analogs at each end side joint. Preferably, the backbone of the oligonucleotide is fully modified (central region and each wing). More preferably, the backbone is phosphorothioate and / or phosphoramidite (more preferably mesyl-phosphoramidate).

[0185] In an embodiment, the antisense oligonucleotide is as follows:

[0186] 1. The DNA nucleotides in its central portion have not been modified, and

[0187] The RNA nucleotide analogues in each of its wings have been modified to comprise a modified internucleoside linkage (preferably phosphorothioate or phosphoramidite (more preferably methylsulfonyl-phosphoramidate)) and / or a modified sugar (preferably 2'-MOE, 2'-OMe and / or locked nucleic acid (LNA) monomers) and / or a modified base (preferably 5-methylcytosine),

[0188] or

[0189] 1. The DNA nucleotides in its central portion have been modified and the backbone (i.e. at least one internucleoside bond) in its central portion comprises phosphorothioate and / or phosphoramidate (more preferably mesyl-phosphoramidate), and

[0190] The RNA nucleotide analogs in each of its wings have been modified to contain modified internucleoside linkages (preferably phosphorothioate or phosphoramidate (more preferably methylsulfonyl-phosphoramidate)) and / or modified sugars (preferably 2'-MOE, 2'-OMe and / or locked nucleic acid (LNA) monomers) and / or modified bases (preferably 5-methylcytosine).

[0191] In an embodiment, the antisense oligonucleotide is as follows:

[0192] 1. The DNA nucleotides in its central portion have not been modified, and

[0193] The RNA nucleotide analogues in each of its wings have been modified to contain a modified internucleoside linkage (preferably phosphorothioate and / or phosphoramidite (more preferably methylsulfonyl-phosphoramidate)) and / or a modified sugar (preferably 2'-MOE) and / or a modified base (preferably 5-methylcytosine),

[0194] or

[0195] 2. The DNA nucleotides in its central portion have been modified, and the backbone (i.e. at least one internucleoside bond) in its central portion has been modified to contain phosphorothioates and / or phosphoramidates (more preferably mesyl-phosphoramidates), and

[0196] The RNA nucleotide analogs in each of its wings have been modified to contain a modified internucleoside linkage (preferably phosphorothioate and / or phosphoramidite (more preferably mesyl-phosphoramidate)) and / or a modified sugar (preferably 2'-MOE) and / or a modified base (preferably 5-methylcytosine).

[0197] In a preferred embodiment, the antisense oligonucleotide is as follows:

[0198] The DNA nucleotides in its central portion have been modified and the backbone (i.e., at least one internucleoside bond) in its central portion contains phosphorothioate bonds, and

[0199] The RNA nucleotide analogues in each of its wings have been modified to contain a modified backbone (which is a phosphorothioate bond) and preferably at least one modified sugar (preferably 2'-MOE) and / or at least one modified base (preferably 5-methylcytosine).

[0200] In an embodiment, the present invention provides a human antisense oligonucleotide that preferentially targets a mutant allele of a human protein of the γ-secretase pathway, preferably a human protein of the γ-secretase pathway is PSEN1. In this embodiment, the antisense oligonucleotide targets, hybridizes, binds and / or reverse complements a mutant allele of a human protein of the γ-secretase pathway, preferably PSEN1.

[0201] In an embodiment, the base sequence of the oligonucleotide comprises any one of the following: SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145 74, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277. More preferred oligonucleotides comprising one of these base sequences are disclosed below.

[0202] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0203] TCTTTCTTGAAAATGGCAAG(AON1)(SEQ ID NO:1)

[0204] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence SEQ ID NO: 1. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0205] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0206] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 1 are 5-methylcytosine.

[0207] In an embodiment, the oligonucleotide comprising SEQ ID NO: 1 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 1 is fully modified with a PS backbone.

[0208] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 1 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 1 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0209] The most preferred oligonucleotide comprising SEQ ID NO: 1 is represented by SEQ ID NO: 2:

[0210] eT s eC* s eT s eT s eT s dC s dT s dT s dG s dA s dA s dA s dA s dT s dG s eGs eC* s eA s eA s eG (SEQ ID NO: 2)

[0211] wherein A means adenosine, G means guanine, T means thymine, C means cytosine, C* means 5-methylcytosine, U means uracil, e means 2'-MOE, d means DNA, subscript s means PS internucleoside bond, subscript o means PO bond, subscript PNms means PNms bond, and subscript PNdmi means PNdmi bond.

[0212] Unless otherwise indicated, this nomenclature is used for all oligonucleotides in this application.

[0213] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0214] ATTCTTTCTTGAAAATGGCA(AON2)(SEQ ID NO:3)

[0215] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence SEQ ID NO: 3. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0216] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0217] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 3 are 5-methylcytosine.

[0218] In an embodiment, the oligonucleotide comprising SEQ ID NO: 3 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 3 is fully modified with a PS backbone.

[0219] In an embodiment, compared to RNA-based antisense oligonucleotides, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 3 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO: 3 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0220] The most preferred oligonucleotide comprising SEQ ID NO:3 is represented by SEQ ID NO:4:

[0221] eA s eT s eT s eC* s eT s dT s dT s dC s dT s dT s dG s dA s dA s dA s dA s eT s eG s eG s eC* s eA (SEQ ID NO:4)

[0222] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0223] CAATTCTTTCTTGAAAATGG(AON3)(SEQ ID NO:5)

[0224] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence SEQ ID NO: 5. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0225] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0226] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 5 are 5-methylcytosine.

[0227] In an embodiment, the oligonucleotide comprising SEQ ID NO: 5 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 5 is fully modified with a PS backbone.

[0228] In an embodiment, compared to RNA-based antisense oligonucleotides, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:5 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:5 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0229] The most preferred oligonucleotide comprising SEQ ID NO:5 is represented by SEQ ID NO:6:

[0230] eC* s eA s eA s eT s eT s dC s dT s dT s dT s dC s dT s dT s dG s dA s dA s eA s eA s eT s eG s eG (SEQ ID NO:6)

[0231] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0232] (AON4)GCAATTCTTTCTTGAAAATG(SEQ ID NO:7)

[0233] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 7. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0234] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0235] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 7 are 5-methylcytosine.

[0236] In an embodiment, the oligonucleotide comprising SEQ ID NO: 7 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 7 is fully modified with a PS backbone.

[0237] In an embodiment, compared to RNA-based antisense oligonucleotides, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:7 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:7 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0238] The most preferred oligonucleotide comprising SEQ ID NO:7 is represented by SEQ ID NO:8:

[0239] eG s eC* s eA s eA s eT s dT s dC s dT s dT s dT s dC s dT s dT s dG s dA s eAs eA s eA s eT s eG (SEQ ID NO:8)

[0240] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0241] (AON5)GGCAATTCTTTCTTGAAAAT(SEQ ID NO:9)

[0242] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 9. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0243] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0244] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 9 are 5-methylcytosine.

[0245] In an embodiment, the oligonucleotide comprising SEQ ID NO: 9 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 9 is fully modified with a PS backbone.

[0246] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:9 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:9 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0247] The most preferred oligonucleotide comprising SEQ ID NO:9 is represented by SEQ ID NO:10:

[0248] eG s eG seC* s eA s eA s dT s dT s dC s dT s dT s dT s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO: 10)

[0249] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0250] (AON6)TGGCAATTCTTTCTTGAAAA(SEQ ID NO:11)

[0251] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 11. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0252] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0253] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 11 are 5-methylcytosine.

[0254] In an embodiment, the oligonucleotide comprising SEQ ID NO: 11 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 11 is fully modified with a PS backbone.

[0255] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 11 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 11 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0256] The most preferred oligonucleotide comprising SEQ ID NO: 11 is represented by SEQ ID NO: 12:

[0257] eT s eG s eG s eC* s eA s dA s dT s dT s dC s dT s dT s dT s dC s dT s dT s eG s eA s eA s eA s eA (SEQ ID NO: 12)

[0258] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0259] (AON7)CTGGCAATTCTTTCTTGAAA(SEQ ID NO:13)

[0260] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 13. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0261] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0262] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 13 are 5-methylcytosine.

[0263] In an embodiment, the oligonucleotide comprising SEQ ID NO: 13 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 13 is fully modified with a PS backbone.

[0264] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 13 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO: 13 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0265] The most preferred oligonucleotide comprising SEQ ID NO: 13 is represented by SEQ ID NO: 14:

[0266] eC* s eT s eG s eG s eC* s dA s dA s dT s dT s dC s dT s dT s dT s dC s dT s eT s eG s eA s eA s eA (SEQ ID NO: 14)

[0267] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0268] (AON8)AGCTGGCAATTCTTTCTTGA(SEQ ID NO:15)

[0269] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 15. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0270] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0271] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 15 are 5-methylcytosine.

[0272] In an embodiment, the oligonucleotide comprising SEQ ID NO: 15 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 15 is fully modified with a PS backbone.

[0273] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 15 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO: 15 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0274] The most preferred oligonucleotide comprising SEQ ID NO: 15 is represented by SEQ ID NO: 16:

[0275] eA s eG s eC* s eT s eG s dG s dC s dA s dA s dT s dT s dC s dT s dT s dT s eC*s eT s eT s eG s eA (SEQ ID NO: 16)

[0276] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0277] (AON9)AGAGCTGGCAATTCTTTCTT(SEQ ID NO:17)

[0278] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 17. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0279] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0280] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 17 are 5-methylcytosine.

[0281] In an embodiment, the oligonucleotide comprising SEQ ID NO: 17 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 17 is fully modified with a PS backbone.

[0282] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 17 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 17 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0283] The most preferred oligonucleotide comprising SEQ ID NO: 17 is represented by SEQ ID NO: 18:

[0284] eA s eGs eA s eG s eC* s dT s dG s dG s dC s dA s dA s dT s dT s dC s dT s eT s eT s eC* s eT s eT (SEQ ID NO: 18)

[0285] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0286] GAAGAGCTGGCAATTCTTTC(AON10)(SEQ ID NO:19)

[0287] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 19. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0288] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0289] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 19 are 5-methylcytosine.

[0290] In an embodiment, the oligonucleotide comprising SEQ ID NO: 19 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 19 is fully modified with a PS backbone.

[0291] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 19 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 19 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0292] The most preferred oligonucleotide comprising SEQ ID NO: 19 is represented by SEQ ID NO: 20:

[0293] eG s eA s eA s eG s eA s dG s dC s dT s dG s dG s dC s dA s dA s dT s dT s eC* s eT s eT s eT s eC*

[0294] (SEQ ID NO:20)

[0295] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0296] (AON11)TGGAAGAGCTGGCAATTCTT(SEQ ID NO:21)

[0297] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence SEQ ID NO: 21. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0298] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0299] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 21 are 5-methylcytosine.

[0300] In an embodiment, the oligonucleotide comprising SEQ ID NO: 21 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 21 is fully modified with a PS backbone.

[0301] In an embodiment, compared to RNA-based antisense oligonucleotides, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:21 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:21 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0302] The most preferred oligonucleotide comprising SEQ ID NO:21 is represented by SEQ ID NO:22:

[0303] eT s eG s eG s eA s eA s dG s dA s dG s dC s dT s dG s dG s dC s dA s dA s eT s eT s eC* s eT s eT

[0304] (SEQ ID NO:22)

[0305] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0306] ATTGGAAGAGCTGGCAATTC(AON12)(SEQ ID NO:23)

[0307] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 23. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0308] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0309] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 23 are 5-methylcytosine.

[0310] In an embodiment, the oligonucleotide comprising SEQ ID NO: 23 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 23 is fully modified with a PS backbone.

[0311] In an embodiment, compared to RNA-based antisense oligonucleotides, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:23 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:23 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0312] The most preferred oligonucleotide comprising SEQ ID NO:23 is represented by SEQ ID NO:24:

[0313] eA s eT s eT s eG s eG s dA s dA s dG s dA s dG s dC sdT s dG s dG s dC s eA s eA s eT s eT s eC* (SEQ ID NO: 24)

[0314] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0315] GCAATUCTTCTTGAAAATG(AON13)(SEQ ID NO:25)

[0316] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 25. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0317] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0318] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 25 are 5-methylcytosine.

[0319] In an embodiment, the oligonucleotide comprising SEQ ID NO: 25 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 25 is fully modified with a PS backbone.

[0320] In an embodiment, compared to RNA-based antisense oligonucleotides, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:25 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:25 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0321] The most preferred oligonucleotide comprising SEQ ID NO:25 is represented by SEQ ID NO:26:

[0322] eG s eC* s eA s eA s eT s Ud s dC s dT s dT s dT s dC s dT s dT s dG s dA s eA s eA s eA s eT s eG (SEQ ID NO: 26)

[0323] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0324] GGCAATUCTTTCTTGAAAAT(AON14)(SEQ ID NO:27)

[0325] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 27. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0326] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0327] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 27 are 5-methylcytosine.

[0328] In an embodiment, the oligonucleotide comprising SEQ ID NO: 27 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 27 is fully modified with a PS backbone.

[0329] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:27 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:27 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0330] The most preferred oligonucleotide comprising SEQ ID NO:27 is represented by SEQ ID NO:28:

[0331] eG s eG s eC* s eA s eA s dT s Ud s dC s dT s dT s dT s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO: 28)

[0332] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0333] TGGCAATUCTTCTTGAAAA(AON15)(SEQ ID NO:29)

[0334] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 29. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0335] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0336] In an embodiment, at least one C and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 29 are 5-methylcytosine.

[0337] In an embodiment, the oligonucleotide comprising SEQ ID NO: 29 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 29 is fully modified with a PS backbone.

[0338] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:29 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:29 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0339] The most preferred oligonucleotide comprising SEQ ID NO:29 is represented by SEQ ID NO:30:

[0340] eT s eG s eG s eC* s eA s dA s dT s Ud s dC s dT s dT s dT s dC s dT s dT s eG s eA s eA s eA s eA (SEQ ID NO: 30)

[0341] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0342] GGCAATUCTTTCTTGAAAAT(AON16)(SEQ ID NO:32)

[0343] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 32. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0344] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0345] In an embodiment, at least one C of the oligonucleotide comprising SEQ ID NO:32 is 5-methylcytosine. In another embodiment, the C present in the gap of the oligonucleotide comprising SEQ ID NO:32 (C at position 8 and position 12 of SEQ ID NO:32) is not methylated. In another embodiment, all C of the oligonucleotide comprising SEQ ID NO:32 are 5-methylcytosine.

[0346] In an embodiment, the oligonucleotide comprising SEQ ID NO:32 has at least one modified internucleoside bond thereof, preferably as a thiophosphate or a phosphoramidate (preferably a mesyl-phosphoramidate). In an embodiment, the oligonucleotide comprising SEQ ID NO:32 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In another embodiment, the oligonucleotide comprising SEQ ID NO:32 is fully modified with a PS backbone.

[0347] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and is therefore a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, compared with RNA-based antisense oligonucleotides, a wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:32 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification. In a preferred embodiment, a wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:32 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, a wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0348] The most preferred oligonucleotide comprising SEQ ID NO:32 is represented by SEQ ID NO:33:

[0349] eG s eG o eC* o eA o eA s dT s Ud s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO:33)

[0350] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0351] GGCAATUCTTTCTTGAAAAT(AON17)(SEQ ID NO:34)

[0352] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 34. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0353] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0354] In an embodiment, at least one C of the oligonucleotide comprising SEQ ID NO:34 is 5-methylcytosine. In another embodiment, the C present in the gap of the oligonucleotide comprising SEQ ID NO:32 (C at position 8 and position 12 of SEQ ID NO:34) is not methylated. In another embodiment, all Cs of the oligonucleotide comprising SEQ ID NO:34 are 5-methylcytosine.

[0355] In an embodiment, the oligonucleotide comprising SEQ ID NO:34 has at least one modified internucleoside bond, preferably as a thiophosphate or phosphoramidate (preferably mesyl-phosphoramidate). In an embodiment, the oligonucleotide comprising SEQ ID NO:34 has 1, 2 or 3 phosphodiester bonds in each wing, preferably 3 phosphodiester bonds in each wing. In another embodiment, the oligonucleotide comprising SEQ ID NO:34 is fully modified with a PS backbone.

[0356] In an embodiment, the oligonucleotide comprising SEQ ID NO: 34 has at least one of its internucleoside bonds (preferably at least two of its internucleoside bonds) modified, preferably as a PNms bond. In an embodiment, the PNms bond is present in the central region of the oligonucleotide and is not present in the wings of the oligonucleotide.

[0357] In an embodiment, compared to RNA-based antisense oligonucleotides, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 34 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO: 34 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0358] The most preferred oligonucleotide comprising SEQ ID NO:34 is represented by SEQ ID NO:35:

[0359] eG s eG s eC* s eA s eA s dT s Ud PNms dC PNms dT s dT s dT s dC s dT s dT s dG s eA s eA s eA s e A s eT (SEQ ID NO: 35)

[0360] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0361] GGCAATUCTTTCTTGAAAAT(AON18)(SEQ ID NO:36)

[0362] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 36. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0363] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0364] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO:36 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO:36 (the C at position 8 and position 12 of SEQ ID NO:36) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO:36 are 5-methylcytosine.

[0365] In an embodiment, the oligonucleotide comprising SEQ ID NO:36 has at least one modified internucleoside bond, preferably as a thiophosphate or phosphoramidate (preferably mesyl-phosphoramidate). In an embodiment, the oligonucleotide comprising SEQ ID NO:36 has 1, 2 or 3 phosphodiester bonds in each wing, preferably 3 phosphodiester bonds in each wing. In another embodiment, the oligonucleotide comprising SEQ ID NO:36 is fully modified with a PS backbone.

[0366] In an embodiment, the oligonucleotide comprising SEQ ID NO: 36 has at least one of its internucleoside bonds (preferably at least two of its internucleoside bonds) modified, preferably as a PNms bond. In an embodiment, the PNms bond is present in the central region of the oligonucleotide and is not present in the wings of the oligonucleotide.

[0367] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:36 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:36 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0368] The most preferred oligonucleotide comprising SEQ ID NO:36 is represented by SEQ ID NO:37:

[0369] eG s eG s eC* s eA s eA s dT s Ud s dC PNms dT PNms dT s dT s dC s dT s dT s dG s eA s eA s eA s e A s eT (SEQ ID NO: 37)

[0370] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0371] GGCAATUCTTTCTTGAAAAT(AON19)(SEQ ID NO:38)

[0372] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 38. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0373] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0374] In an embodiment, at least one C of the oligonucleotide comprising SEQ ID NO:38 is 5-methylcytosine. In another embodiment, the C present in the gap of the oligonucleotide comprising SEQ ID NO:38 (C at position 8 and position 12 of SEQ ID NO:38) is not methylated. In another embodiment, all C of the oligonucleotide comprising SEQ ID NO:38 are 5-methylcytosine.

[0375] In an embodiment, the oligonucleotide comprising SEQ ID NO: 38 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 38 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 38 is fully modified with a PS backbone.

[0376] In an embodiment, at least one internucleoside linkage in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside linkage.A preferred internucleoside linkage modification in one wing (or both wings) is phosphorothioate.

[0377] In an embodiment, the oligonucleotide comprising SEQ ID NO: 38 has at least one of its internucleoside bonds (preferably at least two of its internucleoside bonds) modified, preferably as a PNms bond. In an embodiment, the PNms bond is present in the central region of the oligonucleotide and is not present in the wings of the oligonucleotide.

[0378] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:38 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:38 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0379] The most preferred oligonucleotide comprising SEQ ID NO:38 is represented by SEQ ID NO:39:

[0380] eG s eG o eC* o eA o eA s dT s Uds dC PNms dT PNms dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 39)

[0381] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0382] GGCAAATCTTTCTTGAAAAT(AON22)(SEQ ID NO:40)

[0383] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence SEQ ID NO: 40. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0384] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0385] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO:40 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO:40 (the C at position 8 and position 12 of SEQ ID NO:40) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO:40 are 5-methylcytosine.

[0386] In an embodiment, the oligonucleotide comprising SEQ ID NO: 40 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 40 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 40 is fully modified with a PS backbone.

[0387] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:40 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO:40 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0388] The most preferred oligonucleotide comprising SEQ ID NO:40 is represented by SEQ ID NO:41: eG s eG s eC* s eA s eA s dA s dT s dC s dT s dT s dT s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO:41)

[0389] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0390] GGCAATTGTTTCTTGAAAAT(AON23)(SEQ ID NO:42)

[0391] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence SEQ ID NO: 42. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0392] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0393] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO:42 is a 5-methylcytosine. In another embodiment, a C present in the gap of an oligonucleotide comprising SEQ ID NO:42 (a C at position 12 of SEQ ID NO:42) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO:42 are 5-methylcytosine.

[0394] In an embodiment, the oligonucleotide comprising SEQ ID NO: 42 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 42 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 42 is fully modified with a PS backbone.

[0395] In an embodiment, compared to RNA-based antisense oligonucleotides, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:42 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:42 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0396] The most preferred oligonucleotide comprising SEQ ID NO:42 is represented by SEQ ID NO:43:

[0397] eG s eG s eC* s eA s eA s dT s dT s dG s dT s dT s dT s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO:43)

[0398] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0399] GGCAATTGATTCTTGAAAAT(AON24)(SEQ ID NO:44)

[0400] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence SEQ ID NO: 44. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0401] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0402] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 44 is a 5-methylcytosine. In another embodiment, a C present in the gap of an oligonucleotide comprising SEQ ID NO: 44 (a C at position 12 of SEQ ID NO: 44) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 44 are 5-methylcytosine.

[0403] In an embodiment, the oligonucleotide comprising SEQ ID NO: 44 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 44 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 44 is fully modified with a PS backbone.

[0404] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:44 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:44 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0405] The most preferred oligonucleotide comprising SEQ ID NO:44 is represented by SEQ ID NO:45:

[0406] eG s eG s eC* s eA s eA s dT s dT s dG s dA s dT s dT s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO:45)

[0407] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0408] GCAATUCTTCTTGAAAATG(AON25)(SEQ ID NO:46)

[0409] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 46. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0410] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0411] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 46 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 46 (the C at position 7 and the C at position 11 of SEQ ID NO: 46) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 46 are 5-methylcytosine.

[0412] In an embodiment, the oligonucleotide comprising SEQ ID NO: 46 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 46 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 46 is fully modified with a PS backbone.

[0413] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and is therefore a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, compared with RNA-based antisense oligonucleotides, a wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:46 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification. In a preferred embodiment, a wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:46 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, a wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0414] The most preferred oligonucleotide comprising SEQ ID NO:46 is represented by SEQ ID NO:47:

[0415] eG s eC* o eA o eA o eT s Ud s dC s dT s dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT s eG (SEQ ID NO:47)

[0416] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0417] GGCAATTCTAACTTGAAAAT(AON26)(SEQ ID NO:48)

[0418] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 48. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0419] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0420] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 48 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 48 (the C at position 8 and position 12 of SEQ ID NO: 48) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 48 are 5-methylcytosine.

[0421] In an embodiment, the oligonucleotide comprising SEQ ID NO: 48 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 48 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 48 is fully modified with a PS backbone.

[0422] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:48 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:48 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0423] The most preferred oligonucleotide comprising SEQ ID NO:48 is represented by SEQ ID NO:49:

[0424] eG s eG s eC* s eAs eA s dT s dT s dC s dT s dA s dA s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO:49)

[0425] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0426] GGCAATTCTTAGTTGAAAAT(AON27)(SEQ ID NO:50)

[0427] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence SEQ ID NO: 50. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0428] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0429] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO:50 is a 5-methylcytosine. In another embodiment, a C present in the gap of an oligonucleotide comprising SEQ ID NO:50 (a C at position 8 of SEQ ID NO:50) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO:50 are 5-methylcytosine.

[0430] In an embodiment, the oligonucleotide comprising SEQ ID NO: 50 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 50 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 50 is fully modified with a PS backbone.

[0431] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:50 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:50 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0432] The most preferred oligonucleotide comprising SEQ ID NO:50 is represented by SEQ ID NO:51:

[0433] eG s eG s eC* s eA s eA s dT s dT s dC s dT s dT s dA s dG s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO:51)

[0434] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0435] CAATTCTTTCTTGAAAAT(AON28)(SEQ ID NO:52)

[0436] In this embodiment, the antisense oligonucleotide is 18 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 52. The length can be 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0437] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0438] In an embodiment, at least one C of the oligonucleotide comprising SEQ ID NO:52 is 5-methylcytosine. In another embodiment, the C present in the gap of the oligonucleotide comprising SEQ ID NO:52 (C at position 6 and position 10 of SEQ ID NO:52) is not methylated. In another embodiment, and preferably all C of the oligonucleotide comprising SEQ ID NO:52 are 5-methylcytosine.

[0439] In an embodiment, the oligonucleotide comprising SEQ ID NO: 52 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 52 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 52 is fully modified with a PS backbone.

[0440] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:52 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:52 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 4 nucleotides. Most preferably, both wings comprise 4 nucleotides and are MOE.

[0441] The most preferred oligonucleotide comprising SEQ ID NO:52 is represented by SEQ ID NO:53:

[0442] eC* s eA s eA s eTs dT s dC s dT s dT s dT s dC s dT s dT s dG s dA s eA s eA s eA s eT (SEQ ID NO:53)

[0443] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0444] GCAATTCTTTTCTGAAAA(AON29)(SEQ ID NO:54)

[0445] In this embodiment, the antisense oligonucleotide is 18 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 54. The length can be 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0446] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0447] In an embodiment, at least one C of the oligonucleotide comprising SEQ ID NO:54 is 5-methylcytosine. In another embodiment, the C present in the gap of the oligonucleotide comprising SEQ ID NO:54 (C at position 7 and position 11 of SEQ ID NO:54) is not methylated. In another embodiment, and preferably all C of the oligonucleotide comprising SEQ ID NO:54 are 5-methylcytosine.

[0448] In an embodiment, the oligonucleotide comprising SEQ ID NO: 54 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 54 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 54 is fully modified with a PS backbone.

[0449] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:54 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO:54 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 4 nucleotides. Most preferably, both wings comprise 4 nucleotides and are MOE.

[0450] The most preferred oligonucleotide comprising SEQ ID NO:54 is represented by SEQ ID NO:55:

[0451] eG s eC* s eA s eA s dT s dT s dC s dT s dT s dT s dC s dT s dT s dG s eA s eA s eA s eA (SEQ ID NO:55)

[0452] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0453] GGCAATTCTTTCTTGAAA(AON30)(SEQ ID NO:56)

[0454] In this embodiment, the antisense oligonucleotide is 18 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 56. The length can be 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0455] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0456] In an embodiment, at least one C of the oligonucleotide comprising SEQ ID NO:56 is 5-methylcytosine. In another embodiment, the C present in the gap of the oligonucleotide comprising SEQ ID NO:56 (C at position 8 and position 12 of SEQ ID NO:56) is not methylated. In another embodiment, all C of the oligonucleotide comprising SEQ ID NO:56 are 5-methylcytosine.

[0457] In an embodiment, the oligonucleotide comprising SEQ ID NO: 56 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 56 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 56 is fully modified with a PS backbone.

[0458] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:56 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:56 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 4 nucleotides. Most preferably, both wings comprise 4 nucleotides and are MOE.

[0459] The most preferred oligonucleotide comprising SEQ ID NO:56 is represented by SEQ ID NO:57:

[0460] eG s eG s eC* s eAs dA s dT s dT s dC s dT s dT s dT s dC s dT s dT s eG s eA s eA s eA (SEQ ID NO:57)

[0461] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0462] AATTCTTCTTGAAAA(AON31)(SEQ ID NO:58)

[0463] In this embodiment, the antisense oligonucleotide is 16 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 58. The length can be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0464] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0465] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO:58 is a 5-methylcytosine. In another embodiment, the Cs present in the gaps of an oligonucleotide comprising SEQ ID NO:58 (Cs at positions 5 and 9 of SEQ ID NO:58) are not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO:58 are 5-methylcytosine.

[0466] In an embodiment, the oligonucleotide comprising SEQ ID NO: 58 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 58 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 58 is fully modified with a PS backbone.

[0467] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:58 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO:58 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0468] The most preferred oligonucleotide comprising SEQ ID NO:58 is represented by SEQ ID NO:59:

[0469] eA s eA s eT s dT s dC s dT s dT s dT s dC s dT s dT s dG s dA s eA s eA s eA (SEQ ID NO:59)

[0470] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0471] CAATTCTTTCTTGAAA(AON32)(SEQ ID NO:60)

[0472] In this embodiment, the antisense oligonucleotide is 16 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 60. The length can be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0473] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0474] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 60 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 60 (the C at position 6 and position 10 of SEQ ID NO: 60) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 60 are 5-methylcytosine.

[0475] In an embodiment, the oligonucleotide comprising SEQ ID NO: 60 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 60 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 60 is fully modified with a PS backbone.

[0476] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:60 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO:60 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 3 nucleotides. Most preferably, both wings comprise 3 nucleotides and are MOE.

[0477] The most preferred oligonucleotide comprising SEQ ID NO:60 is represented by SEQ ID NO:61:

[0478] eC* s eA s eA s dT s dT s dC s dT s dT s dT s dC s dT s dT s dG s eA s eA s eA (SEQ ID NO:61)

[0479] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0480] GCAATTCTTTCTTGAA(AON33)(SEQ ID NO:62)

[0481] In this embodiment, the antisense oligonucleotide is 16 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 62. The length can be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0482] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0483] In an embodiment, at least one C of the oligonucleotide comprising SEQ ID NO:62 is 5-methylcytosine. In another embodiment, the C present in the gap of the oligonucleotide comprising SEQ ID NO:62 (C at position 7 and position 11 of SEQ ID NO:62) is not methylated. In another embodiment, all C of the oligonucleotide comprising SEQ ID NO:62 are 5-methylcytosine.

[0484] In an embodiment, the oligonucleotide comprising SEQ ID NO: 62 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 62 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 62 is fully modified with a PS backbone.

[0485] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:62 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:62 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 3 nucleotides. Most preferably, both wings comprise 3 nucleotides and are MOE.

[0486] The most preferred oligonucleotide comprising SEQ ID NO:62 is represented by SEQ ID NO:63:

[0487] eG s eC* s eA s dA s dT s dT s dC s dT s dT s dT s dC s dT s dT s eG s eA s eA (SEQ ID NO:63)

[0488] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0489] ATTCTTTCTTGAAAATGGCA(AON34)(SEQ ID NO:64)

[0490] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 64. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0491] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0492] In an embodiment, at least one C of the oligonucleotide comprising SEQ ID NO:64 is 5-methylcytosine. In another embodiment, the C present in the gap of the oligonucleotide comprising SEQ ID NO:64 (the C at position 8 of SEQ ID NO:64) is not methylated. In another embodiment, and preferably all Cs of the oligonucleotide comprising SEQ ID NO:64 are 5-methylcytosine.

[0493] In an embodiment, the oligonucleotide comprising SEQ ID NO: 64 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 64 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 64 is fully modified with a PS backbone.

[0494] In an embodiment, at least one internucleoside linkage in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside linkage.A preferred internucleoside linkage modification in one wing (or both wings) is phosphorothioate.

[0495] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:64 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:64 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0496] The most preferred oligonucleotide comprising SEQ ID NO:64 is represented by SEQ ID NO:65:

[0497] eA s eT o eT o eC* o eT s dT s dT s dC s dT s dT s dG s dA s dA s dA s dA s eT o eG o eG o eC* s eA (SEQ ID NO:65)

[0498] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0499] ATTCTTTCTTGAAAATGGCA(AON35)(SEQ ID NO:66)

[0500] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 66. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0501] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0502] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO:66 is a 5-methylcytosine. In another embodiment, a C present in the gap of an oligonucleotide comprising SEQ ID NO:66 (a C at position 8 of SEQ ID NO:66) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO:66 are 5-methylcytosine.

[0503] In an embodiment, the oligonucleotide comprising SEQ ID NO: 66 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 66 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 66 is fully modified with a PS backbone.

[0504] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:66 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:66 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0505] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 66 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 66 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 3 PNdmi bonds.

[0506] In an embodiment, one wing or preferably each wing of the oligonucleotide comprising SEQ ID NO: 66 comprises two different modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0507] In an embodiment, the oligonucleotide has two different internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0508] The most preferred oligonucleotide comprising SEQ ID NO:66 is represented by SEQ ID NO:67:

[0509] eA s eT PNdmi eT PNdmi eC* PNdmi eT s dT s dT s dC s dT s dT s dG s dA s dA s dA s dA s eT PNdmi eG PNdmi eG PNdmi eC* s eA (SEQ ID NO:67)

[0510] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0511] GGCAATTCTTTCTTGAAAAT(AON36)(SEQ ID NO:68)

[0512] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 68. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0513] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0514] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO:68 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO:68 (the C at position 8 and position 12 of SEQ ID NO:68) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO:68 are 5-methylcytosine.

[0515] In an embodiment, the oligonucleotide comprising SEQ ID NO: 68 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 68 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 68 is fully modified with a PS backbone.

[0516] In an embodiment, at least one internucleoside linkage in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside linkage.A preferred internucleoside linkage modification in one wing (or both wings) is phosphorothioate.

[0517] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:68 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:68 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0518] The most preferred oligonucleotide comprising SEQ ID NO:68 is represented by SEQ ID NO:69:

[0519] eG s eG o eC* o eA o eA s dT s dT s dC s dT sdT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO:69)

[0520] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0521] GGCAATTCTTTCTTGAAAAT(AON37)(SEQ ID NO:70)

[0522] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 70. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0523] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0524] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 70 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 70 (the C at position 8 and position 12 of SEQ ID NO: 70) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 70 are 5-methylcytosine.

[0525] In an embodiment, the oligonucleotide comprising SEQ ID NO: 70 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 70 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 70 is fully modified with a PS backbone.

[0526] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 70 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 70 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 3 PNdmi bonds.

[0527] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 70 comprises two different modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0528] In an embodiment, the oligonucleotide has two different internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0529] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:70 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO:70 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0530] The most preferred oligonucleotide comprising SEQ ID NO:70 is represented by SEQ ID NO:71:

[0531] eG s eG PNdmi eC* PNdmi eA PNdmi eA s dT s dT s dC s dT s dT s dT s dC s dT s dT s dG s eA PNdm i eA PNdmi eA PNdmi eA s eT (SEQ ID NO:71)

[0532] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0533] GGCAATTCTTTCTTGAAAAT(AON38)(SEQ ID NO:72)

[0534] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 72. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0535] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0536] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 72 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 72 (the C at position 8 and position 12 of SEQ ID NO: 72) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 72 are 5-methylcytosine.

[0537] In an embodiment, the oligonucleotide comprising SEQ ID NO: 72 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 72 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 72 is fully modified with a PS backbone.

[0538] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:72 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:72 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0539] In an embodiment, at least one internucleoside linkage in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside linkage.A preferred internucleoside linkage modification in one wing (or both wings) is phosphorothioate.

[0540] The most preferred oligonucleotide comprising SEQ ID NO:72 is represented by SEQ ID NO:73:

[0541] eG s eG o eC* s eA o eA s dT s dT s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA s eA o eA s eT (SEQ ID NO:73)

[0542] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0543] AGCTGGCAATTCTTTCTTGA(AON39)(SEQ ID NO:74)

[0544] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 74. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0545] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0546] In an embodiment, at least one C of the oligonucleotide comprising SEQ ID NO:74 is 5-methylcytosine. In another embodiment, the C present in the gap of the oligonucleotide comprising SEQ ID NO:74 (C at position 7 and position 12 of SEQ ID NO:74) is not methylated. In another embodiment, and preferably all C of the oligonucleotide comprising SEQ ID NO:74 are 5-methylcytosine.

[0547] In an embodiment, the oligonucleotide comprising SEQ ID NO: 74 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 74 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 74 is fully modified with a PS backbone.

[0548] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:74 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:74 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0549] In an embodiment, at least one internucleoside linkage in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside linkage.A preferred internucleoside linkage modification in one wing (or both wings) is phosphorothioate.

[0550] The most preferred oligonucleotide comprising SEQ ID NO:74 is represented by SEQ ID NO:75:

[0551] eA s eG o eC* o eT o eG s dG s dC s dA s dA s dT s dT s dC s dT s dT s dT s eC*o eT o eT o eG s eA (SEQ ID NO:75)

[0552] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0553] AGCTGGCAATTCTTTCTTGA(AON40)(SEQ ID NO:76)

[0554] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 76. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0555] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0556] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 76 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 76 (the C at position 7 and position 12 of SEQ ID NO: 76) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 76 are 5-methylcytosine.

[0557] In an embodiment, the oligonucleotide comprising SEQ ID NO: 76 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 76 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 76 is fully modified with a PS backbone.

[0558] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 76 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 76 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 3 PNdmi bonds.

[0559] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 76 comprises two different modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0560] In an embodiment, the oligonucleotide has two different internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0561] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:76 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO:76 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0562] The most preferred oligonucleotide comprising SEQ ID NO:76 is represented by SEQ ID NO:77:

[0563] eA s eG PNdmi eC* PNdmi eT PNdmi eG s dG s dC s dA s dA s dT s dT s dC s dT s dT s dT s eC* PNd mi eT PNdmi eT PNdmi eG s eA (SEQ ID NO:77)

[0564] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0565] AGCTGGCAATTCTTTCTTGA(AON41)(SEQ ID NO:78)

[0566] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 78. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0567] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0568] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 78 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 78 (the C at position 7 and position 12 of SEQ ID NO: 78) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 78 are 5-methylcytosine.

[0569] In an embodiment, the oligonucleotide comprising SEQ ID NO: 78 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 78 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 78 is fully modified with a PS backbone.

[0570] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:78 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:78 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0571] In an embodiment, at least one internucleoside linkage in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside linkage.A preferred internucleoside linkage modification in one wing (or both wings) is phosphorothioate.

[0572] The most preferred oligonucleotide comprising SEQ ID NO:78 is represented by SEQ ID NO:79:

[0573] eA s eG o eC* s eT o eG s dG s dC s dA s dA s dT s dT s dC s dT s dT s dT s eC* o eT s eT o eG s eA (SEQ ID NO:79)

[0574] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0575] GAAGAGCTGGCAATTCTTTC(AON42)(SEQ ID NO:80)

[0576] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 80. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0577] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0578] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 80 is 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 80 (the C at position 7 and position 11 of SEQ ID NO: 80) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 80 are 5-methylcytosine.

[0579] In an embodiment, the oligonucleotide comprising SEQ ID NO: 80 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 80 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 80 is fully modified with a PS backbone.

[0580] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:80 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO:80 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0581] In an embodiment, at least one internucleoside linkage in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside linkage.A preferred internucleoside linkage modification in one wing (or both wings) is phosphorothioate.

[0582] The most preferred oligonucleotide comprising SEQ ID NO:80 is represented by SEQ ID NO:81:

[0583] eG s eA o eA o eG o eA s dG s dC s dT s dG s dG s dC s dA s dA s dT s dT s eC* o eT o eT o eT s eC* (SEQ ID NO:81)

[0584] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0585] GAAGAGCTGGCAATTCTTTC(AON43)(SEQ ID NO:82)

[0586] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 82. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0587] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0588] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO:82 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO:82 (the C at position 7 and position 11 of SEQ ID NO:82) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO:82 are 5-methylcytosine.

[0589] In an embodiment, the oligonucleotide comprising SEQ ID NO: 82 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 82 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 82 is fully modified with a PS backbone.

[0590] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 82 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 82 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 3 PNdmi bonds.

[0591] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 82 comprises two different modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0592] In an embodiment, the oligonucleotide has two different internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0593] In an embodiment, compared to RNA-based antisense oligonucleotides, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:82 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:82 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0594] The most preferred oligonucleotide comprising SEQ ID NO:82 is represented by SEQ ID NO:83:

[0595] eG s eA PNdmi eA PNdmi eG PNdmi eA s dG s dC s dT s dG s dG s dC s dA s dA s dT s dT s eC* PNd mi eT PNdmi eT PNdmi eT s eC* (SEQ ID NO:83)

[0596] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0597] TGGCAATUCTTCTTGAAAA(AON44)(SEQ ID NO:84)

[0598] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 84. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0599] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0600] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO:84 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO:84 (the C at position 9 and position 13 of SEQ ID NO:84) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO:84 are 5-methylcytosine.

[0601] In an embodiment, the oligonucleotide comprising SEQ ID NO: 84 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 84 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 84 is fully modified with a PS backbone.

[0602] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:84 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:84 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0603] In embodiments, at least one internucleoside bond in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside bond. Preferred internucleoside bond modifications in one wing (or both wings) are phosphorothioate.

[0604] The most preferred oligonucleotide comprising SEQ ID NO:84 is represented by SEQ ID NO:85:

[0605] eT s eG o eG o eC* o eA s dA s dT s Ud s dC s dT s dT s dT s dC s dT s dTs eG o eA o eA o eA s eA (SEQ ID NO:85)

[0606] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0607] GCAATUCTTCTTGAAAATG(AON45)(SEQ ID NO:86)

[0608] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 86. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0609] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0610] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO:86 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO:86 (the C at position 7 and position 11 of SEQ ID NO:86) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO:86 are 5-methylcytosine.

[0611] In an embodiment, the oligonucleotide comprising SEQ ID NO: 86 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 86 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 86 is fully modified with a PS backbone.

[0612] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 86 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 86 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 3 PNdmi bonds.

[0613] In an embodiment, one wing or preferably each wing of the oligonucleotide comprising SEQ ID NO: 86 comprises two different modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0614] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and therefore is a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, dmi-phosphoramidate and phosphorothioate.

[0615] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:86 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:86 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0616] The most preferred oligonucleotide comprising SEQ ID NO:86 is represented by SEQ ID NO:87:

[0617] eG s eC* PNdmi eA o eA PNdmi eT s Ud s dC s dT s dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT PNdmi eG (SEQ ID NO: 87)

[0618] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0619] GGCAATUCTTTCTTGAAAAT(AON46)(SEQ ID NO:88)

[0620] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 88. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0621] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0622] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO:88 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO:88 (the C at position 8 and position 12 of SEQ ID NO:88) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO:88 are 5-methylcytosine.

[0623] In an embodiment, the oligonucleotide comprising SEQ ID NO: 88 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 88 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 88 is fully modified with a PS backbone.

[0624] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 88 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 88 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 3 PNdmi bonds.

[0625] In embodiments, at least one internucleoside bond in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside bond. Preferred internucleoside bond modifications in one wing (or both wings) are phosphorothioate.

[0626] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 88 comprises two different modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0627] In an embodiment, the oligonucleotide has three different internucleoside linkages, preferably phosphodiester, dmi-phosphoramidate and phosphorothioate.

[0628] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:88 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:88 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0629] The most preferred oligonucleotide comprising SEQ ID NO:88 is represented by SEQ ID NO:89:

[0630] eG s eG PNdmi eC* o eA PNdmi eA s dT s Ud s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA PNdmi eT (SEQ ID NO: 89)

[0631] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0632] TGGCAATUCTTCTTGAAAA(AON47)(SEQ ID NO:90)

[0633] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 90. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0634] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0635] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 90 is a 5-methylcytosine. In another embodiment, the Cs present in the gaps of an oligonucleotide comprising SEQ ID NO: 90 (Cs at positions 9 and 13 of SEQ ID NO: 90) are not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 90 are 5-methylcytosine.

[0636] In an embodiment, the oligonucleotide comprising SEQ ID NO: 90 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 90 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 90 is fully modified with a PS backbone.

[0637] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 90 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 90 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 3 PNdmi bonds.

[0638] In embodiments, at least one internucleoside bond in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside bond. Preferred internucleoside bond modifications in one wing (or both wings) are phosphorothioate.

[0639] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 90 comprises two different modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0640] In an embodiment, the oligonucleotide has three different internucleoside linkages, preferably phosphodiester, dmi-phosphoramidate and phosphorothioate.

[0641] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:90 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO:90 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0642] The most preferred oligonucleotide comprising SEQ ID NO:90 is represented by SEQ ID NO:91:

[0643] eT s eG PNdmi eG o eC* PNdmi eA s dA s dT s Ud s dC s dT s dT s dT s dC s dT s dT s eG o eA o eA o eA PNdmi eA (SEQ ID NO:91)

[0644] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0645] GGCAATUCTTTCTTGAAA(AON48)(SEQ ID NO:92)

[0646] In this embodiment, the antisense oligonucleotide is 18 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 92. The length can be 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0647] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0648] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 92 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 92 (the C at position 8 and position 12 of SEQ ID NO: 92) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 92 are 5-methylcytosine.

[0649] In an embodiment, the oligonucleotide comprising SEQ ID NO: 92 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 92 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 92 is fully modified with a PS backbone.

[0650] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:92 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:92 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 4 nucleotides. Most preferably, both wings comprise 4 nucleotides and are MOE.

[0651] The most preferred oligonucleotide comprising SEQ ID NO:92 is represented by SEQ ID NO:93:

[0652] eG s eG s eC* s eA s dA s dT s Ud s dC s dT s dT s dT s dC s dT s dT s eG s eAs eA s eA (SEQ ID NO:93)

[0653] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0654] GGCAATUCTTTCTTGAAA(AON49)(SEQ ID NO:94)

[0655] In this embodiment, the antisense oligonucleotide is 18 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 94. The length can be 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0656] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0657] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 94 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 94 (the C at position 8 and position 12 of SEQ ID NO: 94) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 94 are 5-methylcytosine.

[0658] In an embodiment, the oligonucleotide comprising SEQ ID NO: 94 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 94 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 94 is fully modified with a PS backbone.

[0659] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 94 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 94 comprises 1 or 2 or 3 or 4 or 5, more preferably 1 or 2 or 3, most preferably 1 PNdmi bond.

[0660] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 94 comprises two different modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0661] In an embodiment, at least one internucleoside bond in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside bond. Preferred internucleoside bond modifications in one wing (or both wings) are phosphorothioates, in an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, dmi-phosphoramidate and phosphorothioate.

[0662] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:94 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO:94 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 4 nucleotides. Most preferably, both wings comprise 4 nucleotides and are MOE.

[0663] The most preferred oligonucleotide comprising SEQ ID NO:94 is represented by SEQ ID NO:95:

[0664] eG s eG PNdmi eC* o eA s dA s dT s Ud s dC s dT s dT s dT s dC s dT s dT s eG o eA o eA PNdmi eA (SEQ ID NO:95)

[0665] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0666] GCAATUCTTCTTGAAAATG(AON50)(SEQ ID NO:96)

[0667] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 96. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0668] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0669] In an embodiment, at least one C of the oligonucleotide comprising SEQ ID NO:96 is 5-methylcytosine. In another embodiment, the C present in the gap of the oligonucleotide comprising SEQ ID NO:96 (C at position 7 and position 11 of SEQ ID NO:96) is not methylated. In another embodiment, and preferably all C of the oligonucleotide comprising SEQ ID NO:96 are 5-methylcytosine.

[0670] In an embodiment, the oligonucleotide comprising SEQ ID NO: 96 has at least one of its internucleoside bonds (preferably at least two of its internucleoside bonds) modified, preferably as a PNms bond. In an embodiment, the PNms bond is present in the central region of the oligonucleotide and is not present in the wings of the oligonucleotide. In an embodiment, at least one internucleoside bond in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside bond. The preferred internucleoside bond modification in one wing (or both wings) is a phosphorothioate.

[0671] In an embodiment, the oligonucleotide has three different internucleoside linkages, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0672] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:96 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:96 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0673] The most preferred oligonucleotide comprising SEQ ID NO:96 is represented by SEQ ID NO:97:

[0674] eG s eC* o eA o eA o eT s Ud PNms dC PNms dT s dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT s eG (SEQ ID NO:97)

[0675] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0676] GCAATUCTTCTTGAAAATG(AON51)(SEQ ID NO:98)

[0677] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 98. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0678] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0679] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 98 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 98 (the C at position 7 and position 11 of SEQ ID NO: 98) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 98 are 5-methylcytosine.

[0680] In an embodiment, the oligonucleotide comprising SEQ ID NO: 98 has at least one of its internucleoside bonds (preferably at least two of its internucleoside bonds) modified, preferably as a PNms bond. In an embodiment, the PNms bond is present in the central region of the oligonucleotide and is not present in the wings of the oligonucleotide.

[0681] In an embodiment, at least one internucleoside linkage in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside linkage.A preferred internucleoside linkage modification in one wing (or both wings) is phosphorothioate.

[0682] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 98 comprises a modified internucleoside linkage, preferably phosphorothioate.

[0683] In an embodiment, the oligonucleotide has three different internucleoside linkages, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0684] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO:98 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO:98 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0685] The most preferred oligonucleotide comprising SEQ ID NO:98 is represented by SEQ ID NO:99:

[0686] eG s eC* o eA o eA o eT s Ud s dC PNms dT PNms dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT s eG (SEQ ID NO:99)

[0687] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0688] GCAATUCTTCTTGAAAATG(AON52)(SEQ ID NO:100)

[0689] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 100. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0690] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0691] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 100 is a 5-methylcytosine. In another embodiment, the Cs present in the gaps of an oligonucleotide comprising SEQ ID NO: 100 (Cs at positions 7 and 11 of SEQ ID NO: 100) are not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 100 are 5-methylcytosine.

[0692] In an embodiment, the oligonucleotide comprising SEQ ID NO: 100 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 100 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 100 is fully modified with a PS backbone.

[0693] In an embodiment, one wing or preferably one wing or central portion of an oligonucleotide comprising SEQ ID NO: 100 comprises a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 100 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds. Preferably, the central portion of an oligonucleotide comprising SEQ ID NO: 100 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds.

[0694] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 100 comprises two different modified internucleoside linkages, preferably mesyl-phosphoramidate and phosphorothioate.

[0695] In an embodiment, 1, 2, 3, 4, 5 PNms bonds are present in the central portion of the oligonucleotide comprising SEQ ID NO: 100, and no PNms bonds are present in the wings of the oligonucleotide. In this embodiment, the internucleoside bonds in the wings of the oligonucleotide are selected from phosphodiester bonds, mesyl-phosphoramidates, and thiophosphates.

[0696] In embodiments, at least one internucleoside bond in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside bond. Preferred internucleoside bond modifications in one wing (or both wings) are phosphorothioate.

[0697] In an embodiment, the oligonucleotide has three different internucleoside linkages, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0698] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 100 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 100 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0699] The most preferred oligonucleotide comprising SEQ ID NO: 100 is represented by SEQ ID NO: 101:

[0700] eG s eC* PNms eA PNms eA o eT s Ud s dC PNms dT PNms dT s dT s dC s dT s dT s dG s dA s eA o e A o eA o eT seG (SEQ ID NO: 101)

[0701] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0702] GCAATUCTTCTTGAAAATG(AON53)(SEQ ID NO:102)

[0703] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 102. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0704] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0705] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 102 is a 5-methylcytosine. In another embodiment, the Cs present in the gaps of an oligonucleotide comprising SEQ ID NO: 102 (Cs at positions 7 and 11 of SEQ ID NO: 102) are not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 102 are 5-methylcytosine.

[0706] In an embodiment, the oligonucleotide comprising SEQ ID NO: 102 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 102 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 102 is fully modified with a PS backbone.

[0707] In an embodiment, the oligonucleotide comprising SEQ ID NO: 102 has at least one of its internucleoside bonds (preferably at least two of its internucleoside bonds) modified, preferably as a PNms bond. In an embodiment, the PNms bond is present in the central region of the oligonucleotide and is not present in one wing (or two wings).

[0708] In an embodiment, at least one internucleoside bond of an oligonucleotide comprising SEQ ID NO: 102 in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside bond. A preferred internucleoside bond modification in one wing (or both wings) is phosphorothioate.

[0709] In an embodiment, the oligonucleotide has three different internucleoside linkages, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0710] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 102 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 102 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0711] The most preferred oligonucleotide comprising SEQ ID NO: 102 is represented by SEQ ID NO: 103:

[0712] eG s eC* o eA o eA o eT s Ud s dC PNms dT PNms dT s dT s dC s dT s dT s dG s dA s eA s eA s eA s e T s eG (SEQ ID NO: 103)

[0713] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0714] GCAATUCTTCTTGAAAATG(AON54)(SEQ ID NO:104)

[0715] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 104. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0716] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0717] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 104 is a 5-methylcytosine. In another embodiment, the Cs present in the gaps of an oligonucleotide comprising SEQ ID NO: 104 (Cs at positions 7 and 11 of SEQ ID NO: 104) are not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 104 are 5-methylcytosine.

[0718] In an embodiment, the oligonucleotide comprising SEQ ID NO: 104 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 104 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 104 is fully modified with a PS backbone.

[0719] In an embodiment, the oligonucleotide comprising SEQ ID NO: 104 has at least one modified internucleoside bond (preferably at least 2, 3, 4, 5 of its internucleoside bonds), preferably as a PNms bond. In an embodiment, the PNms bond is present in the central region of the oligonucleotide and is not present in the wings of the oligonucleotide.

[0720] In an embodiment, at least one internucleoside bond in one wing (or both wings) of the oligonucleotide comprising SEQ ID NO: 104 is unmodified and is therefore a phosphodiester internucleoside bond. A preferred internucleoside bond modification in one wing (or both wings) is phosphorothioate.

[0721] In an embodiment, the oligonucleotides have different internucleoside linkages, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0722] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 104 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 104 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0723] The most preferred oligonucleotide comprising SEQ ID NO: 104 is represented by SEQ ID NO: 105:

[0724] eG s eC* s eA s eA s eT s Ud s dC PNms dT PNms dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o e T s eG (SEQ ID NO: 105)

[0725] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0726] GGCAATUCTTTCTTGAAAAT(AON55)(SEQ ID NO:106)

[0727] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 106. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0728] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0729] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 106 is a 5-methylcytosine. In another embodiment, the Cs present in the gaps of an oligonucleotide comprising SEQ ID NO: 106 (Cs at positions 8 and 12 of SEQ ID NO: 106) are not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 106 are 5-methylcytosine.

[0730] In an embodiment, the oligonucleotide comprising SEQ ID NO: 106 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 106 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 106 is fully modified with a PS backbone.

[0731] In an embodiment, the oligonucleotide comprising SEQ ID NO: 106 has at least one of its internucleoside bonds (preferably at least 2, 3, 4, 5 of its internucleoside bonds) modified, preferably as a PNms bond. In an embodiment, the PNms bond is present in the central region of the oligonucleotide and is not present in one wing (or is not present in both wings).

[0732] In an embodiment, at least one internucleoside bond of an oligonucleotide comprising SEQ ID NO: 106 in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside bond. A preferred internucleoside bond modification in one wing (or both wings) is phosphorothioate.

[0733] In an embodiment, the oligonucleotide has three different internucleoside linkages, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0734] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 106 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 106 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0735] The most preferred oligonucleotide comprising SEQ ID NO: 106 is represented by SEQ ID NO: 107:

[0736] eG s eG o eC* o eA o eA s dT s Ud PNms dC PNms dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 107)

[0737] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0738] GGCAATUCTTTCTTGAAAAT(AON56)(SEQ ID NO:108)

[0739] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 108. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0740] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0741] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 108 is a 5-methylcytosine. In another embodiment, the Cs present in the gaps of an oligonucleotide comprising SEQ ID NO: 108 (Cs at positions 8 and 12 of SEQ ID NO: 108) are not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 108 are 5-methylcytosine.

[0742] In an embodiment, the oligonucleotide comprising SEQ ID NO: 108 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 108 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 108 is fully modified with a PS backbone.

[0743] In an embodiment, one wing or preferably one internucleoside bond modification in each wing or central portion of an oligonucleotide comprising SEQ ID NO: 108 is a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 108 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds. Preferably, the central portion of an oligonucleotide comprising SEQ ID NO: 108 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds. In an embodiment, one wing or preferably one wing of an oligonucleotide comprising SEQ ID NO: 108 comprises two different modified internucleoside bonds, preferably methylsulfonyl-phosphoramidate and thiophosphate.

[0744] In an embodiment, 1, 2, 3, 4, 5 PNms bonds are present in the central portion of the oligonucleotide comprising SEQ ID NO: 108, and no PNms bonds are present in the wings of the oligonucleotide. In this embodiment, the internucleoside bonds in the wings of the oligonucleotide are selected from phosphodiester bonds, mesyl-phosphoramidates, and thiophosphates.

[0745] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and therefore is a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0746] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 108 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 108 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0747] The most preferred oligonucleotide comprising SEQ ID NO: 108 is represented by SEQ ID NO: 109:

[0748] eG s eG PNms eC* PNms eA o eA s dT s Ud s dC PNms dT PNms dT s dT s dC s dT s dT s dG s eA o e A o eA o eA s eT (SEQ ID NO: 109)

[0749] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0750] GGCAATUCTTTCTTGAAAAT(AON57)(SEQ ID NO:110)

[0751] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 110. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0752] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0753] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 110 is 5-methylcytosine. In another embodiment, the Cs present in the gaps of an oligonucleotide comprising SEQ ID NO: 110 (Cs at positions 8 and 12 of SEQ ID NO: 110) are not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 110 are 5-methylcytosine.

[0754] In an embodiment, the oligonucleotide comprising SEQ ID NO: 110 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 110 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 110 is fully modified with a PS backbone.

[0755] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 110 is a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 110 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds.

[0756] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 110 comprises two different modified internucleoside linkages, preferably mesyl-phosphoramidate and phosphorothioate.

[0757] In an embodiment, 1, 2, 3, 4, 5 PNms bonds are present in the central portion of the oligonucleotide comprising SEQ ID NO: 110, and no PNms bonds are present in the wings of the oligonucleotide. In this embodiment, the internucleoside bonds in the wings of the oligonucleotide are selected from phosphodiester bonds, mesyl-phosphoramidates, and thiophosphates.

[0758] In embodiments, at least one internucleoside bond in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside bond. Preferred internucleoside bond modifications in one wing (or both wings) are phosphorothioate.

[0759] In an embodiment, the oligonucleotide has three different internucleoside linkages, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0760] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 110 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 110 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0761] The most preferred oligonucleotide comprising SEQ ID NO: 110 is represented by SEQ ID NO: 111:

[0762] eG s eG PNms eC* PNms eA o eA s dT s Ud s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 111)

[0763] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0764] GGCAATUCTTTCTTGAAAAT(AON58)(SEQ ID NO:112)

[0765] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 112. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0766] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0767] In an embodiment, at least one C of the oligonucleotide comprising SEQ ID NO: 112 is 5-methylcytosine. In another embodiment, the C present in the gap of the oligonucleotide comprising SEQ ID NO: 112 (C at position 8 and position 12 of SEQ ID NO: 112) is not methylated. In another embodiment, and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 112 are 5-methylcytosine.

[0768] In an embodiment, the oligonucleotide comprising SEQ ID NO: 112 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 112 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 112 is fully modified with a PS backbone.

[0769] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 112 is a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 112 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds.

[0770] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 112 comprises two different modified internucleoside linkages, preferably mesyl-phosphoramidate and phosphorothioate.

[0771] In an embodiment, 1, 2, 3, 4, 5 PNms bonds are present in the central portion of the oligonucleotide comprising SEQ ID NO: 112, and there are no PNms bonds in the wings of the oligonucleotide. In this embodiment, the internucleoside bonds in the wings of the oligonucleotide are selected from phosphodiester bonds, mesyl-phosphoramidates and thiophosphates.

[0772] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and therefore is a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0773] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 112 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO: 112 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0774] The most preferred oligonucleotide comprising SEQ ID NO: 112 is represented by SEQ ID NO: 113:

[0775] eG s eG o eC* PNms eA PNms eA s dT s Ud s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 113)

[0776] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0777] GGCAATUCTTTCTTGAAAAT(AON59)(SEQ ID NO:114)

[0778] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 114. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0779] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0780] In an embodiment, at least one C of the oligonucleotide comprising SEQ ID NO: 114 is 5-methylcytosine. In another embodiment, the C present in the gap of the oligonucleotide comprising SEQ ID NO: 114 (C at position 8 and position 12 of SEQ ID NO: 114) is not methylated. In another embodiment, and preferably all Cs of the oligonucleotide comprising SEQ ID NO: 114 are 5-methylcytosine.

[0781] In an embodiment, the oligonucleotide comprising SEQ ID NO: 114 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 114 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 114 is fully modified with a PS backbone.

[0782] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 114 is a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 114 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds.

[0783] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 114 comprises two different modified internucleoside linkages, preferably mesyl-phosphoramidate and phosphorothioate.

[0784] In an embodiment, 1, 2, 3, 4, 5 PNms bonds are present in the central portion of the oligonucleotide comprising SEQ ID NO: 114, and no PNms bonds are present in the wings of the oligonucleotide. In this embodiment, the internucleoside bonds in the wings of the oligonucleotide are selected from phosphodiester bonds, mesyl-phosphoramidates, and thiophosphates.

[0785] In embodiments, at least one internucleoside bond in one wing (or both wings) is unmodified and is therefore a phosphodiester internucleoside bond. Preferred internucleoside bond modifications in one wing (or both wings) are phosphorothioate.

[0786] In an embodiment, the oligonucleotide has three different internucleoside linkages, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0787] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 114 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 114 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0788] The most preferred oligonucleotide comprising SEQ ID NO: 114 is represented by SEQ ID NO: 115:

[0789] eG s eG o eC* o eA o eA s dT s Ud s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA PNms eA P Nms eT (SEQ ID NO: 115)

[0790] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0791] GGCAATUCTTTCTTGAAAAT(AON60)(SEQ ID NO:116)

[0792] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 116. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0793] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0794] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 116 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 116 (the C at position 8 and position 12 of SEQ ID NO: 116) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 116 are 5-methylcytosine.

[0795] In an embodiment, the oligonucleotide comprising SEQ ID NO: 116 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 116 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 116 is fully modified with a PS backbone.

[0796] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 116 is a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 116 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds.

[0797] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 116 comprises two different modified internucleoside linkages, preferably mesyl-phosphoramidate and phosphorothioate.

[0798] In an embodiment, 1, 2, 3, 4, 5 PNms bonds are present in the central portion of the oligonucleotide comprising SEQ ID NO: 116, and no PNms bonds are present in the wings of the oligonucleotide. In this embodiment, the internucleoside bonds in the wings of the oligonucleotide are selected from phosphodiester bonds, mesyl-phosphoramidates, and thiophosphates.

[0799] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and therefore is a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0800] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 116 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 116 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0801] The most preferred oligonucleotide comprising SEQ ID NO: 116 is represented by SEQ ID NO: 117:

[0802] eG s eG o eC* o eA o eA s dT s Ud s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA PNms eA PNms eA o eT (SEQ ID NO: 117).

[0803] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0804] GCAATUCTTCTTGAAAATG(AON61)(SEQ ID NO:121)

[0805] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 121. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0806] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0807] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 121 is 5-methylcytosine. In another embodiment, the Cs present in the gaps of an oligonucleotide comprising SEQ ID NO: 121 (Cs at positions 7 and 11 of SEQ ID NO: 121) are not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 121 are 5-methylcytosine.

[0808] In an embodiment, the oligonucleotide comprising SEQ ID NO: 121 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 121 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 121 is fully modified with a PS backbone.

[0809] In an embodiment, there is at least one sugar modification in the gap of an oligonucleotide comprising SEQ ID NO: 121, preferably at least one 2-O methyl sugar modification in the gap of the oligonucleotide. Most preferably, there is a 2-O methyl sugar modification at position 7 of SEQ ID NO: 121.

[0810] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 121 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 121 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0811] The most preferred oligonucleotide comprising SEQ ID NO: 121 is represented by SEQ ID NO: 122:

[0812] eG s eC* o eA o eA o eT s Ud s mxD s dT s dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT s eG (SEQ ID NO: 122)

[0813] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0814] GGCAATUCTTTCTTGAAAAT(AON62)(SEQ ID NO:123)

[0815] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 123. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0816] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0817] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 123 is 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 123 (C at position 8 and position 12 of SEQ ID NO: 123) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 123 are 5-methylcytosine.

[0818] In an embodiment, the oligonucleotide comprising SEQ ID NO: 123 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 123 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 123 is fully modified with a PS backbone.

[0819] In an embodiment, there is at least one sugar modification in the gap of an oligonucleotide comprising SEQ ID NO: 123, preferably at least one 2-O methyl sugar modification in the gap of the oligonucleotide. Most preferably, there is a 2-O methyl sugar modification at position 7 of SEQ ID NO: 123.

[0820] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 123 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 123 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0821] The most preferred oligonucleotide comprising SEQ ID NO: 123 is represented by SEQ ID NO: 124:

[0822] eG s eG o eC* o eA o eA s dT s mxD s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 124)

[0823] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0824] GCAATUCTTCTTGAAAATG(AON63)(SEQ ID NO:125)

[0825] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 125. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0826] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0827] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 125 is 5-methylcytosine. In another embodiment, the Cs present in the gaps of an oligonucleotide comprising SEQ ID NO: 125 (Cs at positions 7 and 11 of SEQ ID NO: 125) are not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 125 are 5-methylcytosine.

[0828] In an embodiment, the oligonucleotide comprising SEQ ID NO: 125 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 125 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 125 is fully modified with a PS backbone.

[0829] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 125 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 125 comprises 1 or 2 or 3 or 4 or 5, more preferably 1 or 2 or 3, most preferably 1 PNdmi bond.

[0830] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 125 comprises two different modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0831] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and therefore is a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, dmi-phosphoramidate and phosphorothioate.

[0832] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 125 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 125 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0833] The most preferred oligonucleotide comprising SEQ ID NO: 125 is represented by SEQ ID NO: 126:

[0834] eG s eC* o eA o eA o eT s Ud s dC s dT s dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT PNdmi eG (SEQ ID NO: 126)

[0835] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0836] GGCAATUCTTTCTTGAAAAT(AON64)(SEQ ID NO:127)

[0837] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 127. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0838] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0839] In an embodiment, at least one C present in the gap of the oligonucleotide comprising SEQ ID NO: 127 (C at position 8 and position 12 of SEQ ID NO: 127) is not methylated. In another embodiment, all Cs of the oligonucleotide comprising SEQ ID NO: 127 are 5-methylcytosine.

[0840] In an embodiment, the oligonucleotide comprising SEQ ID NO: 127 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 127 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 127 is fully modified with a PS backbone.

[0841] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 127 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 127 comprises 1 or 2 or 3 or 4 or 5, more preferably 1 or 2 or 3, most preferably 1 PNdmi bond.

[0842] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 127 comprises two different modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0843] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and therefore is a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, dmi-phosphoramidate and phosphorothioate.

[0844] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 127 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 127 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0845] The most preferred oligonucleotide comprising SEQ ID NO: 127 is represented by SEQ ID NO: 128:

[0846] eG s eG o eC* o eA o eA s dT s Ud s dC s dTs dT s dT s dC s dT s dT s dG s eA o eA o eA o eA PNdm i eT (SEQ ID NO: 128)

[0847] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0848] GCAATUCTTCTTGAAAATG(AON65)(SEQ ID NO:129)

[0849] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 129. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0850] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0851] In an embodiment, at least one C present in the gap of the oligonucleotide comprising SEQ ID NO: 129 (C at position 7 and position 11 of SEQ ID NO: 129) is not methylated. In another embodiment, all Cs of the oligonucleotide comprising SEQ ID NO: 129 are 5-methylcytosine.

[0852] In an embodiment, the oligonucleotide comprising SEQ ID NO: 129 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 129 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 129 is fully modified with a PS backbone.

[0853] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 129 is a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 129 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds.

[0854] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 129 comprises two different modified internucleoside linkages, preferably mesyl-phosphoramidate and phosphorothioate.

[0855] In an embodiment, 1, 2, 3, 4, 5 PNms bonds are present in the central portion of the oligonucleotide comprising SEQ ID NO: 129, and no PNms bonds are present in the wings of the oligonucleotide. In this embodiment, the internucleoside bonds in the wings of the oligonucleotide are selected from phosphodiester bonds, mesyl-phosphoramidates, and thiophosphates.

[0856] In an embodiment, there is at least one sugar modification in the gap of an oligonucleotide comprising SEQ ID NO: 129, preferably at least one 2-O methyl sugar modification in the gap of said oligonucleotide. Most preferably, there is a 2-O methyl sugar modification at position 7 of SEQ ID NO: 129.

[0857] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and therefore is a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0858] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 129 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 129 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0859] The most preferred oligonucleotide comprising SEQ ID NO: 129 is represented by SEQ ID NO: 130:

[0860] eG s eC* o eA oeA o eT s Ud PNms mxD PNms dT s dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT s eG (SEQ ID NO: 130)

[0861] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0862] GCAATUCTTCTTGAAAATG(AON66)(SEQ ID NO:131)

[0863] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 131. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0864] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0865] In an embodiment, at least one C present in the gap of the oligonucleotide comprising SEQ ID NO: 131 (C at position 7 and position 11 of SEQ ID NO: 131) is not methylated. In another embodiment, all Cs of the oligonucleotide comprising SEQ ID NO: 131 are 5-methylcytosine.

[0866] In an embodiment, the oligonucleotide comprising SEQ ID NO: 131 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 131 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 131 is fully modified with a PS backbone.

[0867] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 131 is a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 131 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds.

[0868] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 131 comprises two different modified internucleoside linkages, preferably mesyl-phosphoramidate and phosphorothioate.

[0869] In an embodiment, 1, 2, 3, 4, 5 PNms bonds are present in the central portion of the oligonucleotide comprising SEQ ID NO: 131, and no PNms bonds are present in the wings of the oligonucleotide. In this embodiment, the internucleoside bonds in the wings of the oligonucleotide are selected from phosphodiester bonds, mesyl-phosphoramidates, and thiophosphates.

[0870] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and therefore is a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0871] In an embodiment, there is at least one sugar modification in the gap of an oligonucleotide comprising SEQ ID NO: 131, preferably at least one 2-O methyl sugar modification in the gap of the oligonucleotide. Most preferably, there is a 2-O methyl sugar modification at position 7 of SEQ ID NO: 131.

[0872] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 131 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 131 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0873] The most preferred oligonucleotide comprising SEQ ID NO: 131 is represented by SEQ ID NO: 132:

[0874] eG s eC*o eA o eA o eT s Ud s mxD PNms dT PNms dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT s eG (SEQ ID NO: 132)

[0875] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0876] GGCAATUCTTTCTTGAAAAT(AON67)(SEQ ID NO:133)

[0877] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 133. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0878] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0879] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 133 is 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 133 (C at position 8 and position 12 of SEQ ID NO: 133) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 133 are 5-methylcytosine.

[0880] In an embodiment, the oligonucleotide comprising SEQ ID NO: 133 has at least one of its internucleoside bonds modified, preferably as phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 133 is fully modified with a PS backbone.

[0881] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 133 is a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 133 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds.

[0882] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 133 comprises two different modified internucleoside linkages, preferably mesyl-phosphoramidate and phosphorothioate.

[0883] In an embodiment, 1, 2, 3, 4, 5 PNms bonds are present in the central portion of the oligonucleotide comprising SEQ ID NO: 133, and there are no PNms bonds in the wings of the oligonucleotide. In this embodiment, the internucleoside bonds in the wings of the oligonucleotide are selected from phosphodiester bonds, mesyl-phosphoramidates and thiophosphates.

[0884] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and therefore is a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0885] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 133 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably two wings of an oligonucleotide comprising SEQ ID NO: 133 comprises 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably two wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0886] The most preferred oligonucleotide comprising SEQ ID NO: 133 is represented by SEQ ID NO: 134:

[0887] eG s eG o eC* o eA o eA s dT s mxD PNms dC PNms dT s dT s dTs dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 134)

[0888] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0889] GGCAATUCTTTCTTGAAAAT(AON68)(SEQ ID NO:135)

[0890] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 135. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0891] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0892] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 135 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 135 (the C at position 8 and position 12 of SEQ ID NO: 135) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 135 are 5-methylcytosine.

[0893] In an embodiment, the oligonucleotide comprising SEQ ID NO: 135 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 135 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 135 is fully modified with a PS backbone.

[0894] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 135 is a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 135 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds.

[0895] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 135 comprises two different modified internucleoside linkages, preferably mesyl-phosphoramidate and phosphorothioate.

[0896] In an embodiment, 1, 2, 3, 4, 5 PNms bonds are present in the central portion of the oligonucleotide comprising SEQ ID NO: 135, and no PNms bonds are present in the wings of the oligonucleotide. In this embodiment, the internucleoside bonds in the wings of the oligonucleotide are selected from phosphodiester bonds, mesyl-phosphoramidates, and thiophosphates.

[0897] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and therefore is a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0898] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 135 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 135 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0899] In an embodiment, there is at least one sugar modification in the gap of an oligonucleotide comprising SEQ ID NO: 135, preferably at least one 2-O methyl sugar modification in the gap of the oligonucleotide. Most preferably, there is a 2-O methyl sugar modification at position 7 of SEQ ID NO: 135.

[0900] The most preferred oligonucleotide comprising SEQ ID NO: 135 is represented by SEQ ID NO: 136:

[0901] eG s eG o eC* oeA o eA s dT s mxD s dC PNms dT PNms dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 136)

[0902] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0903] GCAATUCTTCTTGAAAATG(AON69)(SEQ ID NO:137)

[0904] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 137. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0905] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0906] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 137 is 5-methylcytosine. In another embodiment, the Cs present in the gaps of an oligonucleotide comprising SEQ ID NO: 137 (Cs at positions 7 and 11 of SEQ ID NO: 137) are not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 137 are 5-methylcytosine.

[0907] In an embodiment, the oligonucleotide comprising SEQ ID NO: 137 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 137 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 137 is fully modified with a PS backbone.

[0908] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 137 is a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 137 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds.

[0909] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 137 comprises two different modified internucleoside linkages, preferably mesyl-phosphoramidate and phosphorothioate.

[0910] In an embodiment, 1, 2, 3, 4, 5 PNms bonds are present in the central portion of the oligonucleotide comprising SEQ ID NO: 137, and no PNms bonds are present in the wings of the oligonucleotide. In this embodiment, the internucleoside bonds in the wings of the oligonucleotide are selected from phosphodiester bonds, mesyl-phosphoramidates, and thiophosphates.

[0911] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 137 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 137 comprises 1 or 2 or 3 or 4 or 5, more preferably 1 or 2 or 3, most preferably 1 PNdmi bond.

[0912] In an embodiment, one wing or preferably each wing of the oligonucleotide comprising SEQ ID NO: 137 comprises two different modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0913] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and therefore is a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0914] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 137 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 137 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0915] The most preferred oligonucleotide comprising SEQ ID NO: 137 is represented by SEQ ID NO: 138:

[0916] eG s eC* o eA o eA o eT s Ud PNms dC PNms dT s dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT PNdmi eG (SEQ ID NO: 138)

[0917] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0918] GCAATUCTTCTTGAAAATG(AON70)(SEQ ID NO:139)

[0919] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 139. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0920] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0921] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 139 is a 5-methylcytosine. In another embodiment, the Cs present in the gaps of an oligonucleotide comprising SEQ ID NO: 139 (Cs at positions 7 and 11 of SEQ ID NO: 139) are not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 139 are 5-methylcytosine.

[0922] In an embodiment, the oligonucleotide comprising SEQ ID NO: 139 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 139 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 139 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 139 is fully modified with a PS backbone.

[0923] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 139 is a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 139 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds.

[0924] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 139 comprises two different modified internucleoside linkages, preferably mesyl-phosphoramidate and phosphorothioate.

[0925] In an embodiment, 1, 2, 3, 4, 5 PNms bonds are present in the central portion of the oligonucleotide comprising SEQ ID NO: 139, and no PNms bonds are present in the wings of the oligonucleotide. In this embodiment, the internucleoside bonds in the wings of the oligonucleotide are selected from phosphodiester bonds, mesyl-phosphoramidates, and thiophosphates.

[0926] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and therefore is a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0927] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 139 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 139 comprises 1 or 2 or 3 or 4 or 5, more preferably 1 or 2 or 3, most preferably 1 PNdmi bond.

[0928] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 139 comprises two different modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0929] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 139 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 139 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0930] The most preferred oligonucleotide comprising SEQ ID NO: 139 is represented by SEQ ID NO: 140:

[0931] eG s eC* o eA o eA o eT s Ud s dC PNms dT PNms dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT PNdmi eG (SEQ ID NO: 140)

[0932] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0933] GGCAATUCTTTCTTGAAAAT(AON71)(SEQ ID NO:141)

[0934] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 141. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0935] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0936] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 141 is 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 141 (C at position 8 and position 12 of SEQ ID NO: 141) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 141 are 5-methylcytosine.

[0937] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 141 is a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 141 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 or 4, most preferably 2 PNms bonds.

[0938] In an embodiment, one wing, or preferably each wing, of the oligonucleotide comprising SEQ ID NO: 141 comprises two different modified internucleoside linkages, preferably mesyl-phosphoramidate and phosphorothioate.

[0939] In an embodiment, 1, 2, 3, 4, 5 PNms bonds are present in the central portion of the oligonucleotide comprising SEQ ID NO: 141, and no PNms bonds are present in the wings of the oligonucleotide. In this embodiment, the internucleoside bonds in the wings of the oligonucleotide are selected from phosphodiester bonds, mesyl-phosphoramidates, and thiophosphates.

[0940] In an embodiment, at least one internucleoside bond in a wing (or two wings) is unmodified and therefore is a phosphodiester internucleoside bond. The preferred internucleoside bond modification in a wing (or two wings) is phosphorothioate. In an embodiment, the oligonucleotide has three different internucleoside bonds, preferably phosphodiester, mesyl-phosphoramidate and phosphorothioate.

[0941] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 141 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 141 comprises 1 or 2 or 3 or 4 or 5, more preferably 1 or 2 or 3, most preferably 1 PNdmi bond.

[0942] In an embodiment, one wing or preferably each wing of the oligonucleotide comprising SEQ ID NO: 141 comprises two different modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.

[0943] In an embodiment, the oligonucleotide comprising SEQ ID NO: 141 has at least one of its internucleoside bonds modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl-phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 141 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 141 has 1, 2 or 3 phosphodiester bonds in each wing thereof, preferably 3 phosphodiester bonds in each wing thereof. In an embodiment, the oligonucleotide comprising SEQ ID NO: 141 is fully modified with a PS backbone.

[0944] In an embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 141 has at least one internucleoside bond modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing or more preferably both wings of an oligonucleotide comprising SEQ ID NO: 141 comprise 1, 2, 3, 4 or 5 nucleotides. In a more preferred embodiment, one wing or even more preferably both wings comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOE.

[0945] The most preferred oligonucleotide comprising SEQ ID NO: 141 is represented by SEQ ID NO: 142:

[0946] eG s eG o eC* o eA o eA s dT s Ud PNms dC PNms dT s dT s dT s dC s dT s dTs dG s eA o eA o eA o eA PNdmi eT (SEQ ID NO: 142)

[0947] In an embodiment, the antisense oligonucleotide comprises the following base sequence:

[0948] GGCAATUCTTTCTTGAAAAT(AON72)(SEQ ID NO:143)

[0949] In this embodiment, the antisense oligonucleotide is 20 to 50 nucleotides in length and comprises the base sequence of SEQ ID NO: 143. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0950] Each nucleotide may be a nucleotide analogue as identified earlier herein.If a base is modified or if a base analogue is used, the modified base or base analogue should retain the same base pair specificity as the base it replaces.

[0951] In an embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 143 is a 5-methylcytosine. In another embodiment, the C present in the gap of an oligonucleotide comprising SEQ ID NO: 143 (the C at position 8 and position 12 of SEQ ID NO: 143) is not methylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 143 are 5-methylcytosine.

[0952] In an embodiment, one wing or preferably one internucleoside bond modification of an oligonucleotide comprising SEQ ID NO: 143 is a methylsulfonyl-phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 143 comprises 1 or 2 or 3 or 4 or 5, more preferably 2 or 3 ...

Claims

1. An antisense oligonucleotide which, when present in a cell comprising and preferably expressing a mutant allele of a protein of the gamma-secretase complex, preferentially targets said mutant allele. 2 . The antisense oligonucleotide according to claim 1 , wherein the protein of the γ-secretase complex is PSEN1 or PSEN2, preferably PSEN1, and the allele of the protein of the γ-secretase complex is mutated.

3. The antisense oligonucleotide according to claim 1 or 2, wherein - the oligonucleotide is capable of preferentially silencing, inactivating, degrading, knocking down, reducing or decreasing a mutant PSEN1 or PSEN2 transcript, preferably a mutant PSEN1 transcript, and The oligonucleotide is not (or minimally) capable of silencing, inactivating, degrading, knocking down, decreasing or reducing a wild-type PSEN1 or PSEN2 transcript, preferably a wild-type PSEN1 transcript.

4. The antisense oligonucleotide according to any one of claims 1 to 3, wherein the oligonucleotide is capable of normalizing, reversing or correcting an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio, preferably an Aβ42 / 38 and / or Aβ43 / 40 ratio, more preferably an Aβ42 / 38 ratio. 5 . The antisense oligonucleotide according to claim 1 , wherein a protein of the γ-secretase complex is endogenously expressed by the cell.

6. The antisense oligonucleotide according to any one of the preceding claims, wherein the cell is a neuronal cell.

7. The antisense oligonucleotide according to any one of the preceding claims, wherein the mutation in human PSEN1 is selected from the group consisting of the following most common PSEN1 mutations: P117L, M139T, M139V, M146I, H163R, G206A, P264L, E280A, L392V, A431E and S121Y, more preferably E280A and A431E.

8. The antisense oligonucleotide according to any of the preceding claims, wherein the mutation in human PSEN1 is selected from the group consisting of mutations caused by substitution of guanine, thymine or cytosine by adenosine in the coding sequence, which substitution results in one of the following mutations in the PSEN1 protein: R35Q, V94M, F105I, R108Q, L113Q, T116N, P117T, P117Q, E120K, E123K, M139K, M139I, V142I, M146I, V151M, Y154N, L166H, L174M, I180N, G206S, G206D, G209R, G209E, S212Y, H214N, G217D, S230N, A231T, M233I, F237I, A246E, Y256N, V261I, G266S, R269H, V272D, T274K, R278K, E280K, R358Q, A360T, S365Y, G378E, F386I, F386L, S390N, A396T, A409T, C410Y, G417S, L424H, A431E, A434T, P436Q, preferably A431E.

9. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide is capable of recruiting RNase H to silence, inactivate, knock down, degrade, reduce or decrease the level or expression of the targeted mutant allele.

10. The antisense-oligonucleotide according to any one of the preceding claims, wherein the antisense-oligonucleotide comprises 15 to 30 or 20 to 30 nucleotides including a central region of 5 to 15 consecutive DNA nucleotides and / or DNA nucleotide analogs flanked at each end by wing regions comprising 1 to 5 RNA nucleotide analogs.

11. The antisense oligonucleotide of claim 10, wherein the mutation present in the mutant allele or transcript of PSEN1 or PSEN2 is targeted by the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh or twelfth nucleotide of the central region of the oligonucleotide.

12. The antisense oligonucleotide according to claim 10 or 11, wherein: 1) the DNA nucleotides in its central part have not been modified, and the RNA nucleotides in each wing have been modified, comprising modified internucleoside bonds, preferably phosphorothioate and / or phosphoramidate (more preferably methylsulfonylphosphoramidate), and / or modified sugars (preferably 2'-MOE, 2'-OMe and / or locked nucleic acid (LNA) monomers) and / or modified bases (preferably 5-methylcytosine), or 2) The DNA nucleotides in its central part have been modified and the backbone (i.e. at least one internucleoside bond) comprises phosphorothioate and / or phosphoramidate (preferably methylsulfonyl phosphoramidate), and the RNA nucleotides in each wing have been modified, comprising modified internucleoside bonds, preferably phosphorothioate and / or phosphoramidate (more preferably methylsulfonyl phosphoramidate), and / or modified sugars (preferably 2'-MOE, 2'-OMe and / or locked nucleic acid (LNA) monomers) and / or modified bases (preferably 5-methylcytosine).

13. The antisense oligonucleotide of any of the preceding claims, comprising SEQ ID NO: 2, 4, 6, 8, 7, 8, 9, 10, 11, 12, 14, 16, 18, 20, 22, 24, 25, 26, 27, 28, 29, 30, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 74, 75 5, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, preferably SEQ SEQ ID NO: 7, 8, 9, 10, 11, 12, 25, 26, 27, 28, 29, 30, 33, 34, 35, 36, 37, 38, 39, 47, 97, 99, 115, more preferably SEQ ID NO: 8, 10, 12, 26, 28, 30, 33, 35, 37, 39, 47, 97, 99, 115, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, and most preferably SEQ ID NO: NO:28,30,33,37,39,47,85,97,99,115,221 or 223.

14. A composition comprising the antisense oligonucleotide according to any one of claims 1 to 13, wherein the composition comprises a pharmaceutically acceptable excipient.

15. The antisense oligonucleotide according to any one of claims 1 to 13 or the composition according to claim 14 for use as a medicament.

16. The antisense oligonucleotide or composition according to claim 15, for use as a medicament for treating and / or delaying and / or curing and / or preventing and / or ameliorating a disease or disorder associated with abnormal processing of amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD).

17. The antisense oligonucleotide or composition for use according to claim 15 or 16, wherein the antisense oligonucleotide elicits at least one of: - the oligonucleotide is capable of preferentially silencing, inactivating, degrading, knocking down, reducing or decreasing a mutant PSEN1 or PSEN2 transcript (preferably a mutant PSEN1 transcript), and the oligonucleotide is not (or minimally) capable of silencing, inactivating, degrading, knocking down, reducing or decreasing a wild-type PSEN1 or PSEN2 transcript (preferably a wild-type PSEN1 transcript), - the oligonucleotide is capable of normalizing, reversing or correcting an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio, preferably an Aβ42 / 38 and / or Aβ43 / 40 ratio, more preferably an Aβ42 / 38 ratio, and - The oligonucleotide is capable of alleviating one or more symptoms and / or one or more characteristics of a disease or disorder associated with abnormal processing of amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD), and / or improving a parameter associated with or related to a disease or disorder associated with abnormal processing of amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD).

18. A method for treating and / or delaying a disease or disorder associated with abnormal processing of amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD), using the antisense oligonucleotide or composition according to any one of claims 1 to 17.

19. An antisense oligonucleotide comprising 15 to 30 or 20 to 30 nucleotides including a central region of 5 to 15 consecutive DNA nucleotides and / or DNA nucleotide analogs flanked at each end by wing regions comprising 1 to 5 RNA nucleotide analogs, which antisense oligonucleotide, when present in a cell comprising and preferably expressing a mutant allele of a protein of the gamma-secretase complex, preferentially targets said mutant allele, Wherein the mutation present in the mutant allele is targeted by the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh or twelfth nucleotide of the central region of the oligonucleotide.

20. An antisense oligonucleotide comprising 15 to 30 or 20 to 30 nucleotides including a central region of 5 to 15 consecutive DNA nucleotides and / or DNA nucleotide analogs flanked at each end by wing regions comprising 1 to 5 RNA nucleotide analogs, which antisense oligonucleotide, when present in a cell comprising and preferably expressing a mutant allele of a protein of the gamma-secretase complex, preferentially targets said mutant allele, wherein the mutation present in the mutant allele is targeted by the sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth or eighteenth nucleotide of the oligonucleotide sequence starting from 5' to 3'.

21. The antisense oligonucleotide of claim 10, wherein the mutation present in the mutant allele or transcript of PSEN1 or PSEN2 is targeted by the sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth or eighteenth nucleotide from 5' to 3' of the oligonucleotide sequence.

22. The antisense oligonucleotide according to any one of claims 1 to 12, comprising SEQ ID NO: 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, preferably SEQ ID NO: 178, 180, 182, 192, 194, 196, 198, more preferably SEQ ID NO: 192, 194, 196.

23. The antisense oligonucleotide of claim 10, wherein the mutation present in the mutant allele or transcript of PSEN1 or PSEN2 is targeted by the first, second, third, fourth or fifth nucleotide of the central region of the oligonucleotide.

24. The antisense oligonucleotide of claim 10, wherein the mutation present in the mutant allele or transcript of PSEN1 or PSEN2 is targeted by the sixth, seventh, eighth, ninth or tenth nucleotide from 5' to 3' of the oligonucleotide sequence.

Images