Application of TMEM171 protein in the preparation of antiviral drugs

Abstract

The present invention discloses the use of TMEM171 protein in the preparation of antiviral drugs, the use of a reagent for increasing the expression level of TMEM171 protein in the preparation of antiviral drugs, and the use of a reagent for detecting the expression level of TMEM171 protein or the mRNA level of TMEM171 protein in the preparation of a diagnostic kit for the degree of development of viral infectious diseases. The present invention reveals a new use of TMEM171 molecule in the judgment of the development of infectious diseases and the preparation of anti-infective drugs, provides new ideas and approaches for the research, development and utilization of pattern recognition receptors, and further provides a novel diagnostic agent and / or therapeutic agent for infectious diseases in this field, having certain clinical application prospects.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the application of TMEM171 protein in the preparation of antiviral drugs. Background Art

[0002] Innate immunity is the first line of defense of the body against pathogens. Through long-term evolution, the innate immune system recognizes pathogen-associated molecular patterns (PAMPs) with relatively conserved structures and damage-associated molecular patterns (DAMPs) derived from damaged cells in the body through a series of pattern recognition receptors (PRRs). Pattern recognition receptors (PRRs) mainly include Toll-like receptors (TLRs), RIG-I-like receptors (RLRs), NOD-like receptors (NLRs), cyclic GMP-AMP synthase (cGAS), etc. ([1] TAKEUCHI O, AKIRA S. Pattern recognition receptors and inflammation [J]. Cell, 2010, 140(6): 805-20. [2] WU J, CHEN Z J. Innate immune sensing and signaling of cytosolic nucleic acids [J]. Annu Rev Immunol, 2014, 32: 461-88.).

[0003] Viral nucleic acids (including RNA and DNA), as pathogen-associated molecular patterns (PAMPs) in viral infections, activate downstream signaling pathways, including the JAK-STAT signaling pathway and the TBK1-IRF3 signaling axis, when recognized by pattern recognition receptors. Ultimately, transcription factors such as NF-κB and IRF are activated to drive the transcriptional activation of inflammatory cytokines, interferons, etc., achieving the killing and clearance of viruses by the body, thereby protecting the health of the body ([1] TAN X, SUN L, CHEN J, et al. Detection of Microbial Infections Through Innate Immune Sensing of Nucleic Acids [J]. Annu Rev Microbiol, 2018, 72: 447-78. [2] CAO X. Self-regulation and cross-regulation of pattern-recognition receptor signalling in health and disease [J]. Nat Rev Immunol, 2016, 16(1): 35-50. [3] FERREIRA A R, MARQUES M, RIBEIRO D. Peroxisomes and Innate Immunity: Antiviral Response and Beyond [J]. Int J Mol Sci, 2019, 20(15).).

[0004] TMEM171 (Homo sapiens transmembrane protein 171, NCBI accession number: NM_001161342, Gene ID of the coding gene for TMEM171 protein: 134285; Mus musculus transmembrane protein 171, NCBI accession number: NM_001025606, Gene ID of the coding gene for TMEM171 protein: 380863), as a member of the TMEM family, its biological function has not been reported. The molecular structure of TMEM171 has many similarities with TMEM173 (also known as STING). TMEM171 and STING have similar molecular weights, and both TMEM171 and STING, as transmembrane proteins, cross the membrane four times. Therefore, it is of positive significance to explore whether TMEM171 has an antiviral function similar to that of STING. Summary of the Invention

[0005] In view of the above technical problems existing in the prior art, the present invention provides the use of TMEM171 protein in the preparation of antiviral drugs, providing a new target for the development of antiviral drugs.

[0006] The inventors have found through research that the TMEM171 molecule can significantly inhibit virus replication in vivo and in vitro, thereby playing an antiviral infection role. It can be speculated therefrom that the decrease in the level of the TMEM171 molecule is related to the occurrence and development of viral infectious diseases (and thus used to judge whether the risk of death is higher) and treatment (the molecular level of TMEM171 in patients can be specifically increased), so it can be used as a molecular indicator for judging the development of infectious diseases and the preparation of anti-infective drugs, and the present invention is completed.

[0007] The present invention first provides the use of TMEM171 protein in the preparation of antiviral drugs. Preferably, the type of virus targeted by the antiviral drug is an RNA virus. More preferably, the RNA virus is vesicular stomatitis virus (VSV).

[0008] The present invention also provides the use of a reagent for increasing the expression level of TMEM171 protein in the preparation of antiviral drugs, and the reagent for increasing the expression level of TMEM171 protein is an expression cassette, an expression plasmid or an artificial chromosome containing the coding gene of TMEM171 protein. By transferring the gene sequence capable of expressing TMEM171 protein into the body of the object to be treated, TMEM171 protein can be expressed, thereby also increasing the expression level of TMEM171 protein. Preferably, the type of virus targeted by the antiviral drug is an RNA virus. More preferably, the RNA virus is vesicular stomatitis virus (VSV).

[0009] The inventors found through experiments that the expression level of TMEM171 increases under virus stimulation and is positively correlated with IFN-β. Cell experiments and animal experiments showed that peritoneal macrophages and bone marrow-derived macrophages were infected with vesicular stomatitis virus conjugated with green fluorescent protein (VSV-eGFP), and flow cytometry was used to detect the virus replication. It was found that the virus replication level was higher in primary peritoneal macrophages and bone marrow-derived macrophages of TMEM171 gene-deficient mice. In primary peritoneal macrophages of TMEM171 gene-deficient mice, the production of vesicular stomatitis virus (VSV) and hpRNA-mediated type I interferon Ifnb1, interferon-stimulated gene Isg15, and pro-inflammatory cytokines Il6 and Tnf decreased. In the VSV-infected mouse model, compared with wild-type mice, the replication level of VSV was higher in the liver, spleen, and lung tissues of TMEM171 myeloid knockout gene-deficient mice, and the HE staining results showed that the pulmonary edema, alveolar hemorrhage, alveolar wall thickening, and neutrophil infiltration were much more severe.

[0010] It can be seen therefrom that increasing the content of TMEM171 in the body helps to alleviate the above situation. Therefore, the drug is a reagent for increasing the expression level of TMEM171 and is used to promote the production of type I interferon. When used to combat viral infections, it is preferably to inhibit viral replication and positively regulate the production of type I interferon.

[0011] Preferably, the TMEM171 protein or the coding gene of the TMEM171 protein is from: human, rat, mouse, dog, horse, cow, rabbit or monkey.

[0012] The present invention also provides the use of a reagent for detecting the expression level of TMEM171 protein or the mRNA level of TMEM171 protein in the preparation of a diagnostic kit for the degree of development of viral infectious diseases.

[0013] Preferably, the reagent for detecting the expression level of TMEM171 protein comprises a monoclonal antibody against TMEM171 protein;

[0014] The reagent for detecting the mRNA level of TMEM171 protein includes a specific primer pair for amplifying the mRNA of TMEM171 protein.

[0015] The diagnostic kit contains reagents for detecting the content of TMEM171 protein or mRNA in a biological sample, such as including a reverse transcription system, a primer system and an amplification system. Since the sequence of the TMEM171 molecule is known in the art, those of ordinary skill in the art can extract total RNA and perform reverse transcription through a commercial kit, prepare primers for amplifying TMEM171 cDNA based on conventional means or obtain them commercially and perform amplification.

[0016] Advantages of the present invention:

[0017] The present invention reveals a new use of the TMEM171 molecule in the judgment of the development of infectious diseases and the preparation of anti-infective drugs, provides new ideas and approaches for the research, development and utilization of pattern recognition receptors, and further provides a novel diagnostic agent and / or therapeutic agent for infectious diseases in this field, having certain clinical application prospects.

[0018] Technically speaking, the detection of TMEM171 is essentially a quantitative PCR detection of blood genome, which has the characteristics of simple operation, high detection sensitivity, good specificity, high repeatability, etc., and has been increasingly applied to clinical testing technologies nowadays.

[0019] In addition, the decrease in the molecular level of the index TMEM171 involved in the present invention in infectious disease tissues is closely related to the occurrence and development degree of infectious diseases. The occurrence and development degree of infectious diseases can be assisted in diagnosis by detecting the expression abundance of TMEM171 in the genomic RNA of the peripheral blood of patients, and the expression level of TMEM171 in patients can be specifically increased according to the detection results for anti-infection treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It shows that the expression level of TMEM171 increases under the stimulation of the virus and is positively correlated with IFN-β. Among them, Figure 1 a-c in [Figure] show THP-1 macrophages ( Figure 1 a in [Figure]), PM ( Figure 1 b in [Figure]), BMDM ( Figure 1 c in [Figure]) respectively stimulated by VSV virus for 0, 4, 8 hours, and the mRNA level of TMEM171 was detected by real-time fluorescence quantitative PCR. Figure 1 d in [Figure] shows the protein level of TMEM171 detected by Western Blot in HEK293T cells stimulated by VSV virus for 0, 4, 8 hours. Figure 1 e-g in [Figure] are peripheral blood samples of clinical influenza A patients. The mRNA levels of TMEM171 and IFN-β were detected by real-time fluorescence quantitative PCR, and correlation analysis was performed. It shows the mRNA level of TMEM171 ( Figure 1 e in [Figure]), the mRNA level of IFN-β ( Figure 1 f in [Figure]), and the correlation between TMEM171 and IFN-β ( Figure 1 g in [Figure]). The results show mean ± standard deviation (n = 3), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0021] Figure 2 It shows the correlation between the expression of TMEM171 and virus replication in peritoneal macrophages, bone marrow-derived macrophages and HEK293T cells. Among them, Figure 2 a-b in [Figure] show the replication of VSV-eGFP in PM cells detected by flow cytometry in primary peritoneal macrophages (PM) of normal and TMEM171 gene-deficient mice stimulated by VSV-eGFP virus for 0, 8 hours. Figure 2 c-d in [Figure] show the replication of VSV-eGFP in BMDM cells detected by flow cytometry in primary bone marrow-derived macrophages (BMDM) of normal and TMEM171 gene-deficient mice stimulated by VSV-eGFP virus for 0, 8 hours. Figure 2For e-f in [the text], after overexpressing TMEM171 in HEK293T cells and stimulating with VSV-eGFP for 0 and 8 hours, the replication of VSV-eGFP in HEK293T cells was detected by flow cytometry. The results are shown as mean ± standard deviation (n = 3), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0022] Figure 3 It shows the correlation between the expression of TMEM171 and the production of type I interferon, interferon-stimulated genes, and inflammatory cytokines induced by vesicular stomatitis virus (VSV) and hpRNA (0.3 μg / μL). Among them, Figure 3 For a-f in [the text], in normal and TMEM171-deficient primary mouse peritoneal macrophages, the expression levels of Tmem171, VSV, Ifnb1, Isg15, Il6, and Tnf were detected by real-time fluorescence quantitative PCR after infection with VSV (MOI = 1) for 0, 4, and 8 hours. Figure 3 For g-k in [the text], in normal and TMEM171-deficient primary mouse peritoneal macrophages, the expression levels of Tmem171, Ifnb1, Isg15, Il6, and Tnf were detected by real-time fluorescence quantitative PCR after infection with hpRNA (0.3 μg / μL) for 0 and 8 hours; the results are shown as mean ± standard deviation (n = 3), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. The p-values were calculated using unpaired Student's t-test and two-way ANOVA in GraphPad Prism.

[0023] Figure 4 It shows the correlation between the expression of TMEM171 and viral infection. Among them, Figure 4 For a-c in [the text], the RNA replication levels of VSV in the lungs ( Figure 4 a in [the text]), spleens ( Figure 4 b in [the text]), and livers ( Figure 4 c in [the text]) of two groups of mice were detected by real-time fluorescence quantitative PCR. Figure 4 For d in [the text], HE staining of mouse lung tissue showed that the pulmonary edema, alveolar hemorrhage, alveolar wall thickening, and neutrophil infiltration in TMEM171 gene-deficient mice were much more severe. The results are shown as mean ± standard deviation (n = 5); *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Specific embodiments

[0024] The reagents and raw materials used in the present invention are all commercially available or can be prepared according to the methods described in the literature. For the experimental methods without specific conditions noted in the following examples, they are usually carried out under conventional conditions such as those described in "Molecular Cloning: A Laboratory Manual" by Sambrook et al. (New York: Cold Spring Harbor Laboratory Press, 1989), or under conventional conditions, or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are calculated by volume.

[0025] Example 1

[0026] Verify that the expression level of the TMEM171 gene increases under virus stimulation and is positively correlated with IFN-β.

[0027] NCBI accession number of the mouse TMEM171 gene: NM_001025606, Gene ID of the coding gene of the mouse TMEM171 protein: 380863.

[0028] lysm + Tmem171 f / f Myeloid conditional knockout mice were purchased from Jiangsu Jicui Yakang Biotechnology Co., Ltd. In these mice, the Tmem171 gene was conditionally knocked out in myeloid cells using the Cas9 technology. The gene alterations were as follows: (1) Loxp was inserted at both ends of the exon of the Tmem171 gene; (2) The Cre enzyme gene driven by the myeloid cell-specific promoter Lysm was inserted into the mouse genome. lysm + Tmem171 f / f Myeloid conditional knockout mice were raised in an SPF-level environment. Littermate wild-type mice and TMEM171 gene-deficient mice at 6 - 8 weeks of age were obtained by hybridization.

[0029] I. Obtaining and culturing mouse peritoneal macrophages:

[0030] Intraperitoneally inject 3 ml of 3% (mass / volume ratio) thioglycolate solution (which has been autoclaved in advance). Three days later, euthanize the mice by cervical dislocation, soak them in 75% ethanol for 5 minutes, and transfer them to a sterile operating table. Expose the peritoneum, aspirate 10 ml of sterile PBS with a 10-ml syringe and rinse the peritoneal cavity 3 - 5 times. After aspiration, centrifuge at 1000 rpm for 5 min. Discard the supernatant, resuspend the cells with DMEM (Basal Media) containing 10% FBS (ExCellBio) and count. Inoculate peritoneal macrophages into a 24-well plate at a cell density of 1×10 6 / well, and place them in an incubator at 37°C and 5% CO2 for culture. Perform VSV infection the next day.

[0031] II. Acquisition and culture of mouse bone marrow-derived macrophages:

[0032] Euthanize 6-8-week-old mice by cervical dislocation, soak them in 75% ethanol for 5 min, and transfer them to a sterile operating table. Place the mice ventral side up, gently lift the skin at the root of the thigh, make a small cut with ophthalmic scissors, tear the skin from the root of the femur to the sole of the foot, cut between the humerus and the sole of the foot with ophthalmic scissors, isolate the bilateral humerus and femur and place them in a 6-cm culture dish, add 2 ml of sterile PBS, and blow out the bone marrow with a 1-ml syringe, repeatedly pipetting until the bones turn white. Transfer the bone marrow suspension to a centrifuge tube, centrifuge at 1000 rpm for 5 min at room temperature, discard the supernatant, add 1 ml of red blood cell lysate (Beyotime) to resuspend the cells, mix well and let stand at room temperature for 5 min. Centrifuge at 1000 rpm for 5 min at room temperature, remove the supernatant, and resuspend with BMDM induction medium (2% L929 cell culture supernatant + 98% DMEM complete medium). Seed the BMDM in a 24-well plate at a cell density of 1×10 6 / well, place it in an incubator at 37°C and 5% CO2 for culture. Supplement 100 μL of induction medium on the 3rd day after plating, change the induction medium on the 5th day, and VSV infection can be performed after the 7th day.

[0033] III. Culture and polarization of THP-1 cells:

[0034] Culture with RPMI-1640 (Basal Media) medium containing 10% FBS (ExCellBio) in an incubator at 37°C and 5% CO2. Transfer the cell suspension to a centrifuge tube, centrifuge at 1000 rpm for 5 min at room temperature, discard the supernatant, resuspend the cells for counting, and add PMA (MedChemExpress, final concentration 50 ng / mL) to the cell suspension to polarize the cells. Seed the THP-1 containing PMA in a 24-well plate at a cell density of 5×10 5 / well, change to fresh medium after polarization overnight, and subsequent VSV infection can be performed.

[0035] IV. Construction process of the full-length overexpression plasmid of TMEM171:

[0036] Log in to the NCBI website to query the human TMEM171 gene sequence (NCBI accession number: NM_001161342), and copy the CDS sequence in the mRNA sequence and the partial 5'-UTR sequence adjacent to the promoter. Use the NEB cutter online restriction site analysis tool to analyze the potential restriction sites in the target gene of the constructed plasmid, obtain the potential restriction sites already contained in the target gene, and compare with the restriction sites provided in the multiple cloning site of the plasmid expression vector used to eliminate the restriction sites existing in the target gene. The remaining vector restriction sites are the selectable restriction sites. Design cloning primers (the forward primer starts before the promoter, and the reverse primer is the reverse complementary sequence obtained by removing the last stop codon), calculate the annealing temperature of the forward sequence and the reverse complementary sequence. Generally, it is appropriate to control the temperature at 60 degrees, and the temperature difference should not be higher than 2 degrees. The lower the temperature difference, the better. The ending bases of the sequence are preferably C and G. The primer sequences are as follows:

[0037] Human TMEM171 upstream primer:

[0038] 5’-ATTA GCGGCCGC AATGTCTCCTGCAGCTG-3’,

[0039] Human TMEM171 downstream primer:

[0040] 5’-ATTA GCGATCG CCGGTGGGGAAGGC-3’,

[0041] Among them, ATTA is the protective base, the underlined part is the restriction site, and the bold base A in the forward primer is an additional base added by aligning the reading frame to ensure that the reading frame does not shift. Using the cDNA of human macrophage THP-1 as a template, amplify the target gene fragment according to the following reaction system and procedure.

[0042] The PCR amplification system is shown in Table 1 below.

[0043] Table 1

[0044]

[0045] The PCR amplification procedure is shown in Table 2 below.

[0046] Table 2

[0047]

[0048] After PCR, 5 μl of the PCR product was taken for agarose gel electrophoresis to determine whether the PCR amplification was successful based on the band size. If the amplification was successful and the product was single, the remaining PCR reaction solution could be directly recovered using a product purification kit, and the purified product and the empty vector plasmid were double digested. After agarose gel electrophoresis of the digested product, the corresponding target band was cut out for gel recovery. The concentrations of the target fragment and the vector were measured, and the reaction system was added according to the molar ratio of vector / fragment of 1:4 to 1:10. Among them, the ligation reagent buffer was 2 μl, the T4 DNA ligase was 1 μl, the vector DNA was 50 ng, and the volume of the required target fragment was calculated according to the molar ratio and made up to 20 μl system with sterilized ddH2O. Ligation was carried out overnight at 16 °C. The ligation product was mixed with 50 μl of DH5α competent cells, incubated on ice for 30 min, heat shocked at 42 °C for 90 s, then placed on ice for 5 min, added 900 μl of non-resistant LB medium, and cultured in a bacterial shaker at 37 °C and 220 rpm for 1 hour. Then, it was centrifuged at 5000 rpm for 5 min, and part of the supernatant was discarded, leaving 100 μl of the bacterial solution to be spread on a solid LB culture plate with the corresponding resistance of the plasmid. After culturing overnight at 37 °C in a bacterial incubator, single colonies were picked and cultured to extract plasmids. The extracted plasmids were identified by enzyme digestion and then sequenced. If the sequence was correct, the plasmids were transfected into HEK293T cells to verify whether the plasmids could be successfully expressed. After successful expression, the plasmids were amplified in large quantities, extracted, and stored at -20 °C for standby.

[0049] V. Cytokine detection:

[0050] (1)Detection of the expression of type I interferon and inflammatory factors by real-time fluorescence quantitative PCR: Total RNA was extracted using Trizol reagent (Aikrui Bioengineering Co., Ltd.) according to the steps in the product instruction manual.

[0051] Reverse transcription PCR was performed using the Takara reverse transcription kit, and the program was as follows: 42 °C, 60 min; 72 °C, 5 min; 25 °C, 5 min; 4 °C, 5 min.

[0052] Real-time fluorescence quantitative PCR: SYBR Green quantitative PCR reagent (Aikrui Bioengineering Co., Ltd.) was used.

[0053] All primers used were synthesized by Shanghai Jierui Bioengineering Co., Ltd., and the specific sequences were as follows:

[0054] Mouse β-actin:

[0055] Forward: 5'-ATGCTCCCCGGGCTGTAT-3',

[0056] Reverse: 5'-CATAGGAGTCCTTCTGACCCATTC-3'.

[0057] Mouse Tmem171:

[0058] Upstream: 5'-TCAGATTGGGCACAGGAACC-3',

[0059] Downstream: 5'-GGAGTTGGGGTCCCGTAGTT-3'.

[0060] Mouse Ifnb1:

[0061] Upstream: 5’-ATGAGTGGTGGTTGCAGGC-3’,

[0062] Downstream: 5’-TGACCTTTCAAATGCAGTAGATTCA-3’.

[0063] Mouse Isg15:

[0064] Upstream: 5’-AGAAGCAGATTGCCCAGAAG-3’,

[0065] Downstream: 5’-TGCGTCAGAAAGACCTCATAGA-3’.

[0066] Mouse Tnf:

[0067] Upstream: 5’-GCCACCACGTCTTCTGTCT-3’,

[0068] Downstream: 5’-TGAGGGTCTGGGCCATAGAAC-3’.

[0069] Mouse Il6:

[0070] Upstream: 5’-ACAACCACGGCCTTCCCTAC-3’,

[0071] Downstream: 5’-CATTTCCACGATTTCCCAGA-3’.

[0072] Human GAPDH:

[0073] Upstream: 5'-ACAGTCAGCCGCATCTTCTT-3',

[0074] Downstream: 5'-ACGACCAAATCCGTTGACTC-3'.

[0075] Human TMEM171:

[0076] Upstream: 5'-GGACAGACACGTCAGCAAACT-3',

[0077] Downstream: 5'-GGGAGGGGCTTATATTGGCAT-3'.

[0078] Human IFNB1:

[0079] Upstream: 5'-ATGACCAACAAGTGTCTCCTCC-3',

[0080] Downstream: 5'-GGAATCCAAGCAAGTTGTAGCTC-3'.

[0081] VSV:

[0082] Upstream: 5'-ACGGCGTACTTCCAGATGG-3',

[0083] Downstream: 5'-CTCGGTTCAAGATCCAGGT-3'.

[0084] The results are shown in Figure 1 a - c below. Macrophages THP-1 ( Figure 1 a in Figure 1 ), PM ( Figure 1 b in

[0085] ), and BMDM (

[0086] c in 4 ® ® 4

[0087] were stimulated with VSV virus for 0, 4, and 8 hours respectively. The mRNA level of TMEM171 was detected by real-time fluorescence quantitative PCR, and the mRNA level of TMEM171 increased with virus stimulation.

[0088] Result is shown in Figure 1 d below. VSV stimulation induced an increase in the protein expression level of TMEM171.

[0089] (3) Real-time fluorescence quantitative PCR (same method as above) was used to detect the expression of TMEM171 and IFN-β in the patient's peripheral blood (clinical samples were obtained from the Second Affiliated Hospital of Zhejiang University School of Medicine):

[0090] The results are as follows Figure 1 As shown in Figures e and f, for peripheral blood samples of clinical influenza A patients, the mRNA levels of TMEM171 and IFN-β were detected by real-time fluorescence quantitative PCR, showing that the mRNA level of TMEM171 ( Figure 1 e) and IFN-β mRNA levels ( Figure 1 f) in both increased with viral infection, and the expression levels were higher in critically ill patients; Figure 1 The g in Figure 2 shows that TMEM171 and IFN-β are positively correlated.

[0091] The above results show that the expression of TMEM171 is increased by virus stimulation and is positively correlated with IFN-β, suggesting that TMEM171 can positively regulate the virus-mediated innate immune response in macrophages.

[0092] Example 2

[0093] Verify that the TMEM171 gene inhibits the replication of VSV virus.

[0094] Flow cytometry detection of VSV-eGFP replication:

[0095] Peritoneal macrophages and bone marrow-derived macrophages were infected with vesicular stomatitis virus conjugated with green fluorescent protein (VSV-eGFP) 0 and 8 hours later, the supernatant was discarded, the cells were collected with PBS and centrifuged at 5000 rpm for 5 min, the supernatant was discarded, the cells were resuspended in PBS and filtered into a flow tube, and the FITC channel was detected by flow cytometry. The proportion of the positive group in the FITC channel reflected the replication of the VSV-eGFP virus.

[0096] The results are as follows Figure 2 As shown in af, TMEM171 gene deletion can promote VSV-eGFP expression in peritoneal macrophage PM ( Figure 2 a, b) and replication in bone marrow-derived macrophages BMDM ( Figure 2 c, d); TMEM171 gene overexpression can inhibit the replication of VSV-eGFP in HEK293T cells ( Figure 2 e, f).

[0097] The above results indicate that when there is a defect in TMEM171 expression, the expression levels of type I interferon and inflammatory factors induced by VSV infection are significantly lower than those of the control group, and the virus replication level is higher; at the same time, overexpression of TMEM171 can inhibit the replication of VSV-eGFP virus in HEK293T cells. Thus, it is suggested that TMEM171 can positively regulate the innate immune response induced by RNA viruses in cells.

[0098] Example 3

[0099] To further verify that TMEM171 promotes the inflammatory response induced by VSV stimulation in vitro.

[0100] lysm + Tmem171 f / f Myeloid conditional knockout mice were purchased from Jiangsu Jicui Yakang Biotechnology Co., Ltd. and were raised in an SPF-level environment. Littermate wild-type mice and TMEM171 gene-deficient mice at 6-8 weeks of age were obtained by hybridization.

[0101] The hpRNA sequence is: 5’-pppGGAGCAAAAGCAGGGUGACAAAGACAUAAUGGAUCCAAACACUGUGUCAAGCUUUCAGGUAGAUUGCUUUCUUUGGCAUGUCCGCAAAC-3’. hpRNA is hairpin RNA, purchased from InvivoGen, and is a transcript of the influenza A H1N1 virus sequence and belongs to a RIG-I agonist. RIG-I can activate type I interferon to trigger an antiviral immune response.

[0102] After obtaining mouse peritoneal macrophages according to the method of Example 1 (including the detection primers for the corresponding genes), PM cells were stimulated with VSV (MOI = 1) for 0, 4, and 8 hours, and the mRNA expression levels of type I interferon and inflammatory factors were detected by real-time fluorescence quantitative PCR ( Figure 3 a-f in); PM cells were stimulated with hpRNA (0.3 μg / μL) for 0 and 8 hours, and the mRNA expression levels of type I interferon and inflammatory factors were detected by real-time fluorescence quantitative PCR ( Figure 3 g-k in); the cytokine detection method was the same as that in Example 1.

[0103] The results are as shown in Figure 3 g-k in. The deletion of the TMEM171 gene can inhibit the mRNA expression levels of type I interferon Ifnb1, interferon-stimulated gene Isg15, pro-inflammatory cytokine Il6, and Tnf induced by VSV and hpRNA infections.

[0104] The results showed that in primary peritoneal macrophages of TMEM171 gene-deficient mice, the production of vesicular stomatitis virus (VSV) and hpRNA-mediated type I interferon Ifnb1, interferon-stimulated gene Isg15, as well as pro-inflammatory cytokines Il6 and Tnf was significantly inhibited, and the viral replication rate was promoted.

[0105] Example 4

[0106] TMEM171 inhibits viral replication in vivo.

[0107] lysm + Tmem171 f / f Myeloid conditional knockout mice were purchased from Jiangsu Jicui Yakang Biotechnology Co., Ltd. and raised in an SPF-level environment. 6-8-week-old littermate wild-type mice and TMEM171 gene-deficient mice were obtained by hybridization. VSV virus (5×10 7 pfu / g) was injected intraperitoneally. After 18 hours, the mice were sacrificed by cervical dislocation, soaked in 75% ethanol for 5 minutes, and the livers, spleens, and lungs of the mice were taken out in a biosafety cabinet. Total RNA was extracted using Trizol (Aikery Biotechnology Co., Ltd.) according to the steps in the product manual.

[0108] Reverse transcription and real-time fluorescence quantitative PCR were detected as described above. The primer sequences of VSV were: upstream: ACGGCGTACTTCCAGATGG; downstream: CTCGGTTCAAGATCCAGGT. The mRNA levels of VSV in liver, spleen, and lung tissues were detected by real-time fluorescence quantitative PCR to reflect the viral proliferation rate.

[0109] The results were as Figure 4 shown in a-c. Compared with wild-type mice, the VSV viral replication levels in the livers, spleens, and lungs of TMEM171 conditional knockout-deficient mice were all increased.

[0110] The lung tissues were fixed and sent to Hangzhou Hulk Biotechnology Co., Ltd. for HE section staining.

[0111] The results were as Figure 4 shown in d. Compared with wild-type mice, the edema, alveolar hemorrhage, alveolar wall thickening, and neutrophil infiltration in the lungs of TMEM171 gene-deficient mice were much more severe.

[0112] The results are shown as mean ± standard deviation (n = 5), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0113] The p-values were calculated using unpaired Student’s t-test and two-way ANOVA in GraphPad Prism.

[0114] The results showed that the deletion of TMEM171 gene significantly promoted the viral replication rate and the lung tissue injury.

[0115] From the above experiments, it can be seen that as pathogen-associated molecular patterns (PAMPs) recognized by the body, the viruses VSV, hpRNA and influenza A virus can all induce the innate immune response in the biological body, which is a common response when the body is infected by viruses. Therefore, it can be clearly inferred that when the body is infected by viruses, increasing the expression level of TMEM171 in the body can effectively resist virus infection, inhibit virus replication, and thus protect the body.

[0116] In summary, the decrease in the molecular level of the index TMEM171 involved in the present invention in infectious disease tissues is closely related to the occurrence and development of infectious diseases. The occurrence and development degree of infectious diseases can be assisted in diagnosis by detecting the expression abundance of TMEM171 in the genomic RNA of the patient's peripheral blood, and the expression level of TMEM171 in the patient can be specifically increased according to the detection results for anti-infection treatment.

[0117] Therefore, the present invention reveals the use of TMEM171 molecule in the judgment of the development of infectious diseases and the preparation of anti-infective drugs, provides new ideas and approaches for the research, development and utilization of pattern recognition receptors, and further provides a novel diagnostic agent and / or therapeutic agent for infectious diseases in this field, having certain clinical application prospects.

Claims

1. Application of TMEM171 protein in the preparation of antiviral drugs, wherein the antiviral drugs target RNA viruses, and the RNA viruses are vesicular stomatitis viruses.

2. Use of a reagent for increasing the expression of TMEM171 protein in the preparation of an antiviral drug, characterized in that: The reagent for increasing the expression of TMEM171 protein is an expression plasmid containing a gene encoding the TMEM171 protein; The virus type targeted by the antiviral drug is RNA virus, and the RNA virus is vesicular stomatitis virus.

3. Use of a reagent for detecting the expression of TMEM171 protein or the mRNA level of TMEM171 protein in the preparation of a diagnostic kit for the development of viral infectious diseases, in, The reagent for detecting the expression amount of TMEM171 protein includes a monoclonal antibody against TMEM171 protein; The reagents for detecting the mRNA level of the TMEM171 protein include a specific primer pair for amplifying the mRNA of the TMEM171 protein; The virus of the viral infectious disease is vesicular stomatitis virus.

Images