Application of MLK3 gene as target spot in preparation of medicine for preventing or treating ischemic cerebrovascular disease

Abstract

The invention belongs to the field of medicines, and discloses application of an MLK3 gene as a target spot in preparation of a medicine for preventing or treating ischemic cerebrovascular diseases, and the medicine for preventing or treating ischemic cerebrovascular diseases contains a component for targeted interference of the MLK3 gene or expression thereof. The targeted interference mode of the MLK3 gene or the expression mode of the MLK3 gene comprises gene destruction, transcription inhibition, translation inhibition and post-translation protein modification inhibition. The oxidative stress, ferroptosis and phagocytosis level of microglial cells in ischemic cerebrovascular diseases can be relieved by knocking down the MLK3 gene, so that the MLK3 gene can be applied to preparation of medicines for treating ischemic cerebrovascular diseases and has good clinical application value.

Description

Technical Field

[0001] The invention belongs to the field of medicine, and in particular relates to the use of MLK3 gene as a target in the preparation of medicines for preventing or treating ischemic cerebrovascular disease. Background Art

[0002] Cerebrovascular disease is a general term for a class of diseases caused by cerebrovascular lesions that lead to brain dysfunction. It includes localized or diffuse brain dysfunction caused by various cerebrovascular lesions such as vascular occlusion or stenosis, vascular rupture, vascular malformation, vascular wall damage or permeability changes. Cerebrovascular diseases are mainly divided into ischemic cerebrovascular disease and hemorrhagic cerebrovascular disease, of which ischemic cerebrovascular disease accounts for about 85% of the total number of cerebrovascular diseases. Ischemic stroke caused by ischemic cerebrovascular disease is currently the second leading cause of death in humans. Ischemic cerebrovascular disease has a high incidence, high recurrence rate, high mortality and disability rate, and a heavy disease burden.

[0003] The damage caused by ischemic cerebrovascular disease can widely affect the entire brain tissue. Its pathogenic mechanism and different diseased blood vessels can cause damage to brain tissue in different areas, thus causing different symptoms. The brain is mainly composed of white matter and gray matter. Gray matter is mainly composed of the cell bodies of neurons, while white matter is mainly composed of myelin sheaths wrapped around the outer layer of nerve fibers. In the context of ischemic cerebrovascular disease, the clinical manifestations of white matter damage vary greatly: periventricular white matter damage is mostly cap-shaped, thin line-shaped or halo-shaped. Smaller cap-shaped or dot-shaped ones may be asymptomatic and progress slowly; deep white matter damage is mostly dot-shaped, sheet-shaped or large-scale fusion-shaped. The lesions progress rapidly and can produce multiple clinical manifestations such as cognitive dysfunction, abnormal emotional fluctuations, unstable gait, and urinary incontinence, which brings serious socioeconomic and family problems to daily life.

[0004] Mixed lineage protein kinase 3 (MLK3) is a member of the MLK family of serine / threonine kinases and a member of the mitogen-activated protein kinase kinase kinase (MAP3K). It mainly activates the JNK and p38 MAPK pathways by phosphorylating MAP2K MKK4 / 7 and MKK3 / 6, and also directly activates the ERK MAPK pathway. MLK3 plays an important role in the proliferation, migration and invasion of cancer cells. Studies have shown that MLK3 exhibits dual functions in breast cancer: promoting cell migration and spread in triple-negative breast cancer (TNBC), while promoting cell apoptosis in estrogen receptor (ER)-positive and HER2-positive breast cancer. In addition, MLK3-induced cell apoptosis and ferroptosis can lead to aggravation of myocardial hypertrophy and myocardial fibrosis, leading to the progression of chronic heart failure (CHF). However, the biological function and clinical significance of the MLK3 gene in ischemic cerebrovascular disease remain unknown.

[0005] Therefore, it is crucial to explore the application of MLK3 gene as a target in the preparation of drugs for preventing or treating ischemic cerebrovascular disease. Summary of the invention

[0006] The invention discloses the use of MLK3 gene as a target in the preparation of a medicine for preventing or treating ischemic cerebrovascular disease, which has good clinical application value.

[0007] In order to achieve the above purpose, this application adopts the following technical solutions:

[0008] In a first aspect, the present invention provides the use of MLK3 gene as a target in the preparation of a drug for preventing or treating ischemic cerebrovascular disease.

[0009] In the above technical solution, the ischemic cerebrovascular disease includes transient ischemic attack, different types of acute ischemic stroke, cerebral artery steal syndrome and chronic cerebral ischemia.

[0010] In the above technical solution, the drug for preventing or treating ischemic cerebrovascular disease contains a component that targets and interferes with the ML K3 gene or its expression.

[0011] In the above technical scheme, the targeted interference with MLK3 gene or its expression includes destroying the gene, inhibiting transcription, inhibiting translation and inhibiting post-translational protein modification.

[0012] In the above technical scheme, the gene is destroyed by knocking down the ML K3 gene using the recombinant adenovirus AAV-MLK3. The recombinant adenovirus AAV-MLK3 is constructed by inserting mir30 shRNA into the genome of the adenovirus AAV, wherein the nucleotide sequence of mir30 shRNA is as shown in SEQ ID No. 1, which is GC TGTAAACAAGTTAACGTTA.

[0013] In the above technical solution, the construction method of the recombinant adenovirus AAV-MLK3 comprises the following steps:

[0014] Step 1, interference target design and sequence synthesis: design the target and synthesize the sequence shown in SEQ ID No. 1: GCTGTAAACAAGTTAACGTTA;

[0015] Step 2, preparation of linearized expression vector: the expression vector pAAV-CBG-DIO-EGFP-miR30shRNA-WPRE was digested with restriction endonucleases EcoRⅠ and XhoⅠ, the digestion sites were 1596 (EcoRⅠ) to 1620 (XhoⅠ), and the digestion products were subjected to agarose gel electrophoresis to detect the digestion effect;

[0016] Step 3, the target fragment is connected to the expression vector and transformed into DH5α competent cells;

[0017] Step 4: Pick the transformants grown on the plate and resuspend them in LB culture medium for colony PCR identification;

[0018] Step 5: Sequencing and verifying the positive clones obtained by colony identification, verifying the correct positive clones, and performing high-purity plasmid extraction to obtain the recombinant adenovirus AAV-MLK3.

[0019] In the above technical scheme, knocking down the MLK3 gene can alleviate the oxidative stress of microglia in ischemic cerebrovascular disease.

[0020] In the above technical scheme, knocking down the MLK3 gene can alleviate the iron death of microglia in ischemic cerebrovascular disease.

[0021] In the above technical scheme, knocking down the MLK3 gene can alleviate the phagocytic level of microglia in ischemic cerebrovascular disease.

[0022] In a second aspect, the present invention provides a drug for preventing or treating ischemic cerebrovascular disease, which contains a component that targets and interferes with the MLK3 gene or its expression.

[0023] The beneficial effect of the present invention is that the present invention creatively discovers the application of MLK3 gene as a target in the preparation of drugs for preventing or treating ischemic cerebrovascular disease, and knocking down MLK3 gene alleviates the oxidative stress and ferroptosis and phagocytosis level of microglia in ischemic cerebrovascular disease, so that it can be applied to the preparation of ischemic cerebrovascular disease drugs, and has good clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 It is a statistical diagram of the positive area of ​​MLK3 expression in the BCAS model;

[0025] Figure 2 This is a statistical diagram of the area of ​​MLK3-positive cells in the BCAS model;

[0026] Figure 3 It is the expression statistics of MLK3 and pMLK3;

[0027] Figure 4 It is the fluorescence intensity statistical graph of mitoSOX, FerroOrgance and C11-BODIPY;

[0028] Figure 5 It is the fluorescence intensity statistical diagram of 8-OHdG;

[0029] Figure 6 The fluorescence intensity statistics of 4-HNE. DETAILED DESCRIPTION

[0030] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. The present invention can be implemented in many different forms and should not be construed as being limited to the embodiments set forth herein. On the contrary, these embodiments are provided so that this disclosure will be thorough and complete, and the concept of the present invention will be fully conveyed to those skilled in the art, and the present invention will only be limited by the claims.

[0031] The present invention provides the use of MLK3 gene as a target in the preparation of a drug for preventing or treating ischemic cerebrovascular disease. Specifically, the drug for preventing or treating ischemic cerebrovascular disease contains a component that targets and interferes with the MLK 3 gene or its expression.

[0032] Targeted interference with the MLK3 gene or its expression includes gene destruction, inhibition of transcription, inhibition of translation, and inhibition of post-translational protein modification.

[0033] The gene disruption method is to knock down the MLK3 gene using a recombinant adenovirus AAV-MLK3, wherein the recombinant adenovirus AAV-MLK3 is constructed by inserting mir30 shRNA into the genome of the adenovirus AAV, wherein the nucleotide sequence of mir30 shRNA is as shown in SEQ ID No. 1, which is GCTGTAAACAA GTTAACGTTA.

[0034] The construction method of recombinant adenovirus AAV-MLK3 comprises the following steps:

[0035] Step 1. Interference target design and sequence synthesis: According to the general principles of mir30 shRNA design and the transcript of MLK3 gene, the target was designed and the sequence shown in SEQ ID No. 1 was synthesized: GCTGT AAACAAGTTAACGTTA.

[0036] Step 2, preparation of linearized expression vector: The expression vector pAAV-CBG-DIO-EGFP-miR30shRNA-WPRE was digested with restriction endonucleases EcoRⅠ and XhoⅠ, with the digestion sites ranging from 1596 (EcoRⅠ) to 1620 (XhoⅠ), and the digestion products were subjected to agarose gel electrophoresis to detect the digestion effect.

[0037] Step 3: The target fragment is connected to the expression vector and transformed into DH5α competent cells.

[0038] The ligation reaction system for ligating the target fragment into the expression vector is shown in Table 1, and the ligation is carried out at 16°C overnight.

[0039] Table 1 Ligation reaction system

[0040] Reagents Positive control (ul) Self-linking control (ul) Connection Group (ul) Purpose fragment 1 - 1 Linearized vector 40ng / ul 3 3 3 10×T4 DNA ligase Buffer 2 2 2 T4 DNA ligase 1 1 1 <![CDATA[Dd H2O]]> Up to 20 Up to 20 Up to 20

[0041] Step 4: Pick the transformants grown on the plate and resuspend them in 10 μl LB culture medium, and take 1 μl as a template for colony PCR identification.

[0042] Among them, the reaction system and PCR cycle conditions are as follows:

[0043] PCR reaction solution composition:

[0044]

[0045] PCR reaction conditions:

[0046] 3Step PCR (30Cycles)

[0047] 94℃ 30sec

[0048] 55℃or 60℃ 30sec

[0049] 72℃ 1min / kb

[0050] 2-Step PCR (30 cycles)

[0051] 98℃ 10sec

[0052] 68℃ 1min / kb

[0053] Step 5: Sequencing and verifying the positive clones obtained by colony identification, verifying the correct positive clones, and performing high-purity plasmid extraction to obtain the recombinant adenovirus AAV-MLK3.

[0054] In addition, in the present invention, the inventors found that knocking down the MLK3 gene can alleviate the oxidative stress of microglia in ischemic cerebrovascular disease, alleviate the ferroptosis of microglia in ischemic cerebrovascular disease, and alleviate the phagocytic level of microglia in ischemic cerebrovascular disease.

[0055] In the present invention, ischemic cerebrovascular disease includes transient ischemic attack, different types of acute ischemic stroke, cerebral artery steal syndrome and chronic cerebral ischemia.

[0056] At the same time, the present invention also provides a drug for preventing or treating ischemic cerebrovascular disease, which contains a component that targets and interferes with the MLK3 gene or its expression.

[0057] Experimental procedures

[0058] Ischemic cerebrovascular disease mouse model: The present invention uses bilateral carotid artery stenosis surgery to establish an ischemic cerebrovascular disease mouse model. Specifically, after the mouse is anesthetized with isoflurane, the skin is incised along the midline of the neck, the thyroid gland is peeled off, and the mouse trachea and bilateral common carotid arteries are exposed. A micro spring with an inner diameter of 0.18 mm, a pitch of 0.50 mm, and a total length of 2.5 mm is wrapped around the bilateral common carotid arteries of the mouse, the incision is closed, the skin is sutured, and the cerebral blood flow is monitored to decrease by 40%, representing the successful establishment of the BCAS mouse model. January was selected as the observation time point for ischemic cerebrovascular disease.

[0059] Example 1 MLK3 expression is upregulated in the ischemic cerebrovascular disease injury area

[0060] Ischemic cerebrovascular disease is accompanied by significant white matter damage, which is mainly manifested by obvious demyelination. dMBP, the damaged myelin basic protein, is expressed in large quantities in the area of ​​white matter damage. Frozen sections of the brains of mice modeled with BCAS for 1 month were taken and immunofluorescence staining was performed using dMBP and MLK3 antibodies.

[0061] Specifically, the frozen sections were rewarmed at room temperature and washed with phosphate buffer for 5 minutes. Then, the membrane was permeated with Trit on X-100 immunofluorescence permeabilization solution at room temperature for 15 minutes. Subsequently, the specimen was blocked with immunofluorescence rapid blocking solution at room temperature for 15 minutes. After the antibody was diluted and mixed with the primary antibody diluent, 10 μL of diluent was added to each sample, incubated at 4°C for 12 hours, and then incubated with the secondary antibody for one hour at room temperature in the dark. Finally, the positive area of ​​MLK3 and dMBP was observed and counted.

[0062] Figure 1 The results showed that at 1 month after BCAS modeling, the positive area of ​​MLK3 in the demyelinated area of ​​ischemic cerebrovascular disease increased significantly. This indicates that MLK3 is upregulated in the damaged area of ​​ischemic cerebrovascular disease, suggesting that MLK3 may have a suggestive significance for ischemic cerebrovascular disease caused by BCAS.

[0063] Example 2 MLK3 is mainly expressed in microglia in the ischemic cerebrovascular disease injury area

[0064] Demyelination damage in ischemic cerebrovascular disease is closely related to glial cells. Microglia are immune active cells. They can be activated early to release inflammatory factors during ischemic damage, causing persistent neuroinflammatory reactions and causing damage to white matter neurons. Oligodendrocytes have the function of wrapping axons and forming myelin in the CNS. A large number of oligodendrocytes undergo apoptosis during ischemic damage and are easily damaged by inflammatory factors, causing demyelination damage to white matter. Astrocytes are closely related to the formation of the blood-brain barrier and the formation of neuronal synapses.

[0065] Specifically, mouse brain tissue sections were immunofluorescently stained with oligodendrocyte protein Olig2 (a marker for primary and mature oligodendrocytes), glial fibrillary acid protein GFAP (a marker for astrocytes), IBA1 (a marker for microglia), and MLK3 antibodies, respectively.

[0066] Figure 2 The results showed that compared with astrocytes and oligodendrocytes, the number of MLK3+IBA1+ microglia increased significantly, indicating that MLK3 is mainly expressed in microglia in the damaged area of ​​ischemic cerebrovascular disease.

[0067] Microglia were labeled by CD45-APC and CD11b-FITC double-labeled flow cytometry. Specifically, at 1 month after BCAS surgery, mice were anesthetized by inhalation of isoflurane. Brain tissues of mice were taken to separate brain cells. The brain cells were blocked with Fc-Block and double-labeled with CD45-APC / CD11b-FITC flow cytometry antibodies, incubated at 4°C for 30 minutes, and the resulting cell suspension was filtered into the flow tube through a 40um filter to prepare for loading. Then, the protein of microglia was extracted for Western Blotting detection. Specifically, the electrophoresis gel was placed in the electrophoresis tank, and the electrophoresis solution was added until the electrophoresis solution level was higher than the sample loading hole on the inner side of the two glass blocks. After loading, electrophoresis was performed. After the electrophoresis, an electrotransfer clamp was made according to the transfer structure of "sponge pad-filter paper-gel-PVDF membrane-filter paper-sponge pad". The electrotransfer was placed in the transfer tank filled with transfer solution, and the membrane was transferred in a foam box filled with ice water. After the transfer, take out the NC membrane, wash it in TBST, and then block it with a universal blocking solution for 15-30 minutes. After blocking, wash it with TBST 3 times, 5 minutes each time, then put it in the antibody incubation box containing the primary antibody, mark it, and place it steadily on a 4°C pendulum shaker overnight. After the incubation, wash it with TBST 3 times, 5 minutes each time, then put it in the antibody incubation box containing the secondary antibody, mark it, and react it at room temperature for 1 hour. After the incubation, wash it with TBST 3 times, 5 minutes each time, and add ECL exposure solution to develop color in the gel system after washing.

[0068] Figure 3 The results showed that MLK3 expression was increased on flow-sorted CD45+CD11b+ microglia, and the expression of the activated form of MLK3 (phosphorylated MLK3, pMLK3) was also significantly increased.

[0069] The above results indicate that MLK3 is highly expressed in microglia in the demyelinated area of ​​ischemic cerebrovascular disease. This suggests that MLK3 may be involved in the neural damage caused by microglia in ischemic cerebrovascular disease. Example 3 Knockdown of MLK3 alleviates oxidative stress and ferroptosis of microglia in ischemic cerebrovascular disease

[0070] Ischemic cerebrovascular disease causes damage to the white matter of the brain, and the distribution of white matter in the brain is different, and the clinical manifestations vary greatly. Based on this, an in vitro model of white matter damage was constructed. Specifically, the brain tissue of the newborn rat was peeled off, chopped and digested, and cultured in a 37°C incubator containing 5% CO2 for 14 days. After collecting primary microglia, they were stimulated with 10μg / ml of exogenous myelin to simulate the white matter damage environment in vitro.

[0071] Studies have shown that increased mitochondrial complex I activity in microglia is closely related to the occurrence and development of chronic neuroinflammation. Ferropoptosis stimulation can also trigger an inflammatory response in microglia, thereby participating in demyelinating lesions. Increased CI activity will increase the production of ROS in microglia, thereby aggravating neuroinflammation and related neurotoxic damage. mitoSOX is a commonly used cell fluorescent probe and a living cell permeable dye. It can be used to detect changes in intracellular reactive oxygen species (ROS) levels. FerroOrange is a ferrous ion probe that can be used to detect changes in intracellular divalent iron levels. C11-BODIPY is often used to study lipid peroxidation and antioxidant properties in living cells, or react with hydroxyl radicals to detect ferroptosis.

[0072] Small interfering RNA (siRNA) is a double-stranded RNA with a length of 20-25 nucleotides. It has many biological applications and is currently mainly used to interfere with RNA to achieve the purpose of regulating gene expression (knockdown). Its essence is that siRNA specifically binds to and degrades the corresponding mRNA, thereby blocking the continued translation of mRNA. Specifically,

[0073] Step 1. Prepare reagent 1: Prepare 3.75 μL of transfection reagent lipo3000 and 1.25 μL of culture medium opti-men12, mix well and incubate at room temperature for 5 minutes to obtain reagent 1 (volume 125 μL).

[0074] Step 2. Prepare reagent 2: Prepare 5 μL of si-MLK3 or si-NC (control RNA) and 120 μL of culture medium opti-men, mix well and incubate at room temperature for 5 minutes to obtain si-MLK3 reagent (volume 125 μL) or si-NC reagent (volume 125 μL), respectively.

[0075] Step 3. Prepare the transfection system (si-NC system or si-MLK3 system): Add reagent 2 to reagent 1, mix well, and incubate at 37° C. for 15 minutes to obtain the si-NC system and si-MLK3 system, respectively.

[0076] Step 4, transfection: myelin + si-NC group: take out the primary microglial cells (6-well plate) that have been stimulated with exogenous myelin, and add 250 μL of negative control si-NC system and 1750 μL of 10% FBS high glucose to each well. Myelin + si-MLK3 group: take out the primary microglial cells (6-well plate) that have been stimulated with exogenous myelin, and add 250 μL of si-RNA system and 1750 μL of 10% FBS high glucose solution to knock down the expression of MLK3.

[0077] Flow cytometry was used to detect the fluorescence intensity of mitoSOX, FerroOrgance and C11-BO DIPY in microglia of each group.

[0078] Figure 4 The results showed that compared with the myelin+si-NC group, the mean fluorescence intensity of mitoSOX, FerroOrgance and C11-BODIPY staining in the myelin+si-MLK3 group was significantly reduced, suggesting that knocking down MLK3 helps alleviate oxidative stress and ferroptosis of microglia in ischemic cerebrovascular disease.

[0079] Example 4 Knockdown of MLK3 gene alleviates oxidative stress in microglia in ischemic cerebrovascular disease

[0080] We further knocked down the MLK3 gene in vivo to observe the changes in microglia in ischemic cerebrovascular disease.

[0081] Specifically, 2 weeks before BCAS surgery, expression of Cx3cr1 CreER AAV 1 μl was injected into the bilateral corpus callosum of mice (coordinates: midline ± 1.0 mm; 1.0 mm in front of the bregma; 2.2 mm deep). The final injection volume of the virus was 1.0E+10 vg / mouse. Specifically:

[0082] BCAS-AAV-NC group: BCAS mice were injected with negative control AAV-NC;

[0083] BCAS-AAV-MLK3 group: BCAS mice were injected with AAV-MLK3 to knock down the MLK3 gene of mice.

[0084] 8-Hydroxydeoxyguanosine (8-OHdG) is a ROS-induced DNA purine residue modification, which is a sensitive indicator of oxidative DNA damage and a common biomarker of oxidative stress. Immunofluorescence staining of 8-OHdG and Iba-1 mouse brain tissue sections was performed to detect the oxidative stress level of microglia.

[0085] Figure 5 The results showed that compared with the BCAS-AAV-NC group, the fluorescence intensity of 8-OHdG in the BCAS-AAV-MLK3 group was significantly reduced, indicating that knocking down the MLK3 gene helps alleviate the oxidative stress of microglia in ischemic cerebrovascular disease.

[0086] Example 5 Knockdown of MLK3 gene alleviates ferroptosis of microglia in ischemic cerebrovascular disease

[0087] 4-Hydroxynonenal (4-HNE) is an important lipid peroxidation marker of ferroptosis and accumulates in large quantities during ferroptosis. Immunofluorescence staining of brain tissue sections of mice with 4-HNE and Iba-1 was performed to detect the level of ferroptosis in microglia.

[0088] Figure 6 The results showed that compared with the BCAS-AAV-NC group, the fluorescence intensity of the BCAS-AAV-MLK3 group was significantly reduced, indicating that knocking down the MLK3 gene helps alleviate the ferroptosis of microglia in ischemic cerebrovascular disease.

[0089] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. Application of MLK3 gene as a target in the preparation of drugs for preventing or treating ischemic cerebrovascular disease.

2. The application according to claim 1, characterized in that: The ischemic cerebrovascular disease includes transient ischemic attack, different types of acute ischemic stroke, cerebral artery steal syndrome and chronic cerebral ischemia.

3. The application according to claim 1, characterized in that: The drug for preventing or treating ischemic cerebrovascular disease contains a component that targets and interferes with the MLK3 gene or its expression.

4. The application according to claim 3, characterized in that: Targeted interference with the MLK3 gene or its expression includes gene destruction, inhibition of transcription, inhibition of translation, and inhibition of post-translational protein modification.

5. The application according to claim 4, characterized in that: The gene is destroyed by knocking down the MLK3 gene using a recombinant adenovirus AAV-MLK3, wherein the recombinant adenovirus AAV-MLK3 is constructed by inserting mir30 shRNA into the genome of the adenovirus AAV, wherein the nucleotide sequence of mir30 shRNA is shown in SEQ ID No. 1, which is GCTGTAAACAAGTTAACGTTA.

6. The application according to claim 5, characterized in that: The construction method of the recombinant adenovirus AAV-MLK3 comprises the following steps: Step 1, interference target design and sequence synthesis: design the target and synthesize the sequence shown in SEQ ID No. 1: GCTGTAAACAAGTTAACGTTA; Step 2, preparation of linearized expression vector: the expression vector pAAV-CBG-DIO-EGFP-miR30shRNA-WPRE was digested with restriction endonucleases EcoRⅠ and XhoⅠ, the digestion sites were 1596 (EcoRⅠ) to 1620 (XhoⅠ), and the digestion products were subjected to agarose gel electrophoresis to detect the digestion effect; Step 3, the target fragment is connected to the expression vector and transformed into DH5α competent cells; Step 4: Pick the transformants grown on the plate and resuspend them in LB culture medium for colony PCR identification; Step 5: Sequencing and verifying the positive clones obtained by colony identification, verifying the correct positive clones, and performing high-purity plasmid extraction to obtain the recombinant adenovirus AAV-MLK3.

7. The use according to claim 1, characterized in that: Knockdown of MLK3 gene can alleviate the oxidative stress of microglia in ischemic cerebrovascular disease.

8. The use according to claim 1, characterized in that: Knockdown of MLK3 gene can alleviate the ferroptosis of microglia in ischemic cerebrovascular disease.

9. The use according to claim 1, characterized in that: Knocking down the MLK3 gene can alleviate the phagocytic level of microglia in ischemic cerebrovascular disease.

10. A drug for preventing or treating ischemic cerebrovascular disease, characterized in that: It contains components that target and interfere with the MLK3 gene or its expression.

Images