Application of rice gene in regulation and control of phosphorus homeostasis

Abstract

According to the application of the rice gene in regulation and control of the phosphorus homeostasis, the nucleotide sequence of the rice OsSPL17 gene is as shown in SEQ ID NO.1, and the amino acid sequence of the encoding protein of the rice OsSPL17 gene is as shown in SEQ ID NO.2. The rice gene OsSPL17 is cloned, a transgenic vector is constructed, and OsSPL17 gene overexpressed rice and OsSPL17 gene deleted rice are obtained. The phenotypic characters of the transgenic rice are measured, and compared with wild rice, the phosphorus content of the transgenic rice is changed, the phosphorus absorption rate of overexpressed rice in a high-phosphorus environment is relatively low, and the high-phosphorus toxicity degree of plants is reduced; and the phosphorus absorption rate of the deleted rice is increased in a low-phosphorus environment, so that the phosphorus utilization rate of the rice is improved. It is shown that the OsSPL17 gene plays an important regulation and control function in rice phosphorus utilization, the phosphorus steady state of rice is maintained, and the utilization rate of phosphate fertilizer is increased.

Description

Technical Field

[0001] The invention relates to the technical field of biological gene engineering, and in particular to an application of rice genes in regulating phosphorus homeostasis. Background Art

[0002] Phosphorus is one of the macronutrients necessary for plant growth. It is an important component of proteins, nucleic acids, some enzyme activity regulators, cell structures, etc. It affects the energy exchange process of plants and runs through the entire process of plant growth and development. It plays an indispensable role in plant physiological development and reproductive growth. Phosphorus deficiency in plants will manifest as a significant slowing of growth rate, short and thin plants, few branches or tillers, dull and gray leaves, and poor root development. Therefore, in agricultural production, the application of phosphorus fertilizer is one of the necessary measures to ensure crop yields. Reasonable supplementation of phosphorus fertilizer can promote plant growth, enhance plant resistance, and achieve an increase in production.

[0003] However, there has been a long-term problem of abuse of phosphate fertilizer use in my country, which has caused ecological pollution such as eutrophication of water bodies, increasing environmental and food safety pressures. At present, the phosphate fertilizer use efficiency (PUE) of my country's grain crops is generally low. The phosphate fertilizer applied during the cultivation process cannot be effectively absorbed and utilized by crops. In addition to wasting costs, the residual phosphate fertilizer also causes ecological pollution. my country faces the dual challenges of alleviating phosphate fertilizer pollution and increasing demand for crop yields. As one of the world's most important food crops, rice is widely planted, but phosphorus deficiency and excessive application of phosphate fertilizer are common in rice field soil. Therefore, discovering phosphorus regulatory genes is of great significance to promoting the efficiency of rice phosphorus absorption and improving PUE.

[0004] Studies have shown that SPL (Squamosa Promoter-Binding Protein-Like) proteins are a class of multifunctional transcription factors unique to plants. There are 19 OsSPL genes in rice. The proteins encoded by these OsSPL genes all contain a highly conserved SBP domain, which is responsible for binding to the core motif GTAC of downstream target genes and regulating the expression of target genes. It has been found that OsSPL genes play an important role in many biological processes such as rice root development, ligule and ear development, plant and panicle type formation, grain development and stress response, but there are no reports on this type of gene in regulating rice phosphorus absorption and utilization. Summary of the invention

[0005] In view of the above problems, the present invention provides an application of the rice OsSPL17 gene in regulating phosphorus absorption. The present invention experimentally confirms that the OsSPL17 gene plays an important regulatory function in rice phosphorus utilization, can maintain the phosphorus homeostasis of rice, and helps to improve the utilization rate of phosphorus fertilizer. At the same time, two phenotypes of transgenic rice are provided. Compared with wild-type rice, rice overexpressing the OsSPL17 gene has a lower phosphorus absorption rate in a high-phosphorus environment, which reduces the degree of high-phosphorus toxicity of the plant; while the phosphorus absorption rate of rice with a deletion of the OsSPL17 gene increases in a low-phosphorus environment, which improves the phosphorus utilization rate of rice. To achieve the above purpose, the present invention adopts the following technical solutions:

[0006] A use of a rice OsSPL17 gene in regulating phosphorus absorption, wherein the nucleotide sequence of the rice OsSPL17 gene is shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by the rice OsSPL17 gene is shown as SEQ ID NO.2.

[0007] Preferably, the method comprises overexpressing the OsSPL17 gene in rice, comprising the following steps:

[0008] An expression vector containing the OsSPL17 gene is constructed, and the expression vector is transformed into an intermediate bacterium to obtain a positive transformant, and the transformant is used to infect rice, and phosphorus-inefficient rice is obtained through screening and hybridization.

[0009] Preferably, the method for constructing an expression vector containing the OsSPL17 gene comprises:

[0010] The complete OsSPL17 open reading frame was cloned from the total cDNA of rice using the primer pair OsSPL17-F / R. The OsSPL17 open reading frame was ligated with the P-easy blunt plasmid. After screening and sequencing verification, a vector containing the OsSPL17 open reading frame was obtained and named pOsSPL17inP.

[0011] The complete OsSPL17 gene reading frame carrying restriction enzyme cutting sites was amplified from the pOsSPL17inP plasmid using the primer pair overOsSPL17-F / R. The OsSPL17 gene reading frame was ligated to the pTCK303 plasmid after restriction enzyme cutting. After screening and sequencing verification, an overexpression vector containing the gene reading frame of OsSPL17 was obtained and named OsSPL17-OE.

[0012] Preferably, the phosphorus-inefficient rice is obtained by an Agrobacterium-mediated method, the OsSPL17-OE vector is transferred into Agrobacterium, and positive bacteria are obtained through screening and sequencing verification, and rice callus is infected with the positive bacteria. After co-cultivation, sterile water washing, selective culture, differentiation, rooting, seedling hardening, and propagation, transgenic phosphorus-inefficient rice with stable genetic traits is obtained.

[0013] Preferably, the method comprises inhibiting the expression of the OsSPL17 gene in rice, comprising the following steps:

[0014] A knockout vector of the OsSPL17 gene was constructed, and the knockout vector was transformed into an intermediate bacterium to obtain a positive transformant, and the transformant was used to infect rice, and phosphorus-efficient rice was obtained after screening and propagation.

[0015] Preferably, the knockout vector is constructed based on the target site of the rice OsSPL17 gene, and the nucleotide sequence of the target site is shown in SEQ ID NO.3.

[0016] Preferably, the method for constructing a knockout vector for the OsSPL17 gene comprises:

[0017] Based on the target site of rice OsSPL17 gene, primer pair Cas9-OsSPL17-F / R was designed. The primer pair Cas9-OsSPL17-F / R was denatured and annealed by PCR to obtain OsSPL17 gDNA intermediate vector, which was then connected with AarI-Cas9-PC1300 vector after restriction digestion. After screening and sequencing verification, the knockout vector of OsSPL17 gene was obtained and named Cas9-OsSPL17.

[0018] Preferably, the phosphorus-efficient rice is obtained by an Agrobacterium-mediated method, wherein the Cas9-OsSPL17 vector is transferred into Agrobacterium, and positive bacteria are obtained through screening and sequencing verification, and rice callus is infected with the positive bacteria. After co-cultivation, sterile water washing, selective culture, differentiation, rooting, seedling hardening, and propagation, transgenic phosphorus-efficient rice with stable genetic traits is obtained.

[0019] Preferably, the primer pair sequence is:

[0020] OsSPL17-F:5'-ATGGCGACCGGCGGCAG-3';

[0021] OsSPL17-R:5'-CTACAGAGACCAGTTCATGGCATTG-3';

[0022] overOsSPL17-F:5'-CGGGGTACCATGGCGACCGGCGGCAG-3';

[0023] overOsSPL17-R:5'-GGACTAGTCTACAGAGACCAGTTCATGG-3';

[0024] Cas9-OsSPL17-F:5'-GGCATTGCAGGTCACAATGAACGC-3';

[0025] Cas9-OsSPL17-R:5'-AAACGCGTTCATTGTGACCTGCAA-3';

[0026] Preferably, the number of propagation is no less than two. Propagation of transgenic materials twice or more can increase the probability of obtaining homozygotes and ensure stable inheritance of plant traits.

[0027] Preferably, the knockout vector is constructed based on the target site of the rice OsSPL17 gene, and the nucleotide sequence of the target site is shown in SEQ ID NO.3.

[0028] Preferably, the method comprises use of the OsSPL17 gene and its encoded protein in promoting or inhibiting phosphorus absorption by rice.

[0029] Preferably, the method comprises the use of the OsSPL17 gene and its encoded protein in maintaining phosphorus homeostasis in rice.

[0030] Compared with the prior art, the beneficial effect of the present invention is that the present invention confirms for the first time the role of rice SPL protein in regulating phosphorus absorption, and provides the application of OsSPL17 gene in promoting or inhibiting rice phosphorus absorption. The present invention obtains transgenic rice material of OsSPL17 gene, measures the phenotypic traits of transgenic rice, and finds that compared with wild-type rice, rice overexpressing OsSPL17 gene has lower phosphorus absorption rate in high-phosphorus environment, which reduces the high-phosphorus toxicity of plants; while rice with OsSPL17 gene deletion has increased phosphorus absorption rate in low-phosphorus environment, which improves rice phosphorus utilization. It shows that OsSPL17 gene plays an important regulatory function in rice phosphorus utilization, maintains phosphorus homeostasis of rice, and helps to improve phosphorus fertilizer utilization. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0033] In the attached figure:

[0034] Figure 1 : The molecular identification results of the OsSPL17 gene overexpressing rice materials obtained in Example 1, wherein ZH11 is the wild-type rice Zhonghua 11, and OE-1 and OE-2 are OsSPL17 gene overexpressing rice materials.

[0035] Figure 2 : The molecular identification results of the OsSPL17 gene-deficient expression rice materials obtained in Example 2, wherein ZH11 is the wild-type rice Zhonghua 11, and spl17-1 and spl17-2 are OsSPL17 gene-deficient expression vector fragments.

[0036] Figure 3 : Symptoms of phosphorus toxicity at the leaf tips of the OsSPL17 overexpressing rice materials (OE-1, OE-2) obtained in Example 1 and the OsSPL17 gene deletion expressing rice materials (spl17-1, spl17-2) obtained in Example 2 under high phosphorus (HP).

[0037] Figure 4 : Total phosphorus concentration in the OsSPL17 overexpressing rice materials (OE-1, OE-2) obtained in Example 1 and the OsSPL17 gene deletion expressing rice materials (spl17-1, spl17-2) obtained in Example 2 under high phosphorus (HP) and low phosphorus (LP) treatments. DETAILED DESCRIPTION

[0038] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and essence of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention all belong to the scope of protection of the present invention. Unless otherwise specified, the experimental materials, reagents, instruments, etc. used in the examples of the present invention are all commercially available; unless otherwise specified, all technical means in the examples of the present invention are conventional means well known to those skilled in the art.

[0039] A use of a rice OsSPL17 gene in regulating phosphorus absorption, wherein the nucleotide sequence of the rice OsSPL17 gene is shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by the rice OsSPL17 gene is shown as SEQ ID NO.2.

[0040] The application includes overexpression of the OsSPL17 gene in rice, comprising the following steps:

[0041] An expression vector containing the OsSPL17 gene is constructed, and the expression vector is transformed into an intermediate bacterium to obtain a positive transformant, and the transformant is used to infect rice, and phosphorus-inefficient rice is obtained through screening and hybridization.

[0042] The application includes expressing the OsSPL17 gene in rice, comprising the following steps:

[0043] A knockout vector of the OsSPL17 gene was constructed, and the knockout vector was transformed into an intermediate bacterium to obtain a positive transformant, and the transformant was used to infect rice, and phosphorus-efficient rice was obtained through screening and hybridization.

[0044] Example 1 Obtaining transgenic phosphorus-inefficient rice material

[0045] (1) Total RNA extraction and cDNA synthesis

[0046] The seeds of rice Zhonghua 11 were disinfected with NaClO at a mass concentration of 30%, and germinated with warm water. When the rice plants had two leaves and one heart, the rice plants of uniform size were selected, the endosperm was removed and the plants were transplanted into 50% IRRI nutrient solution with a pH of 5.5. When the rice plants had four leaves and one heart, the culture medium was replaced with IRRI complete nutrient solution.

[0047] After one week of cultivation, root and leaf samples of rice were taken and quickly frozen in liquid nitrogen. About 0.1 g of the sample was weighed and the total DNA of rice was obtained using the Trizol extraction method. The RNA quality was detected by agarose gel electrophoresis with a mass ratio of 1.0%, and the concentration and purity of the total RNA were detected by a spectrophotometer.

[0048] The qualified total RNA was used for reverse transcription and the cDNA was synthesized using the reverse transcription kit of Fermentas.

[0049] (2) Construction of pOsSPL17inP vector

[0050] Using the cDNA obtained in step (1) as a template, the primer pair OsSPL17-F / R was designed, and the complete OsSPL17 open reading frame was amplified from the total cDNA of rice by PCR. The PCR product was separated by agarose electrophoresis and then cut and recovered to obtain the OsSPL17 open reading frame fragment. The fragment was ligated with the P-easy blunt plasmid vector after restriction digestion at 16°C overnight by T4 ligase, and transformed into Escherichia coli DH5a competent cells. After enrichment of the cells, the cells were coated on a plate containing 100 μg·mL kanamycin. -1 After growing on LB solid medium for 12 h, positive colonies were picked and plasmids were extracted. After screening and sequencing verification, a vector containing the open reading frame of OsSPL17 was obtained and named pOsSPL17inP.

[0051] (3) Construction of OsSPL17-OE overexpression vector

[0052] Using the cDNA obtained in step (1) as a template, a primer pair overOsSPL17-F / R was designed, and the complete OsSPL17 gene reading frame was amplified from the pOsSPL17inP plasmid obtained in step (2) by PCR. The PCR product was separated by agarose electrophoresis and then cut and recovered to obtain a fragment of the OsSPL17 gene reading frame carrying restriction endonuclease sites KpnI and SpeI. The linearized pTCK303 plasmid vector obtained by double digestion of the fragment with KpnI and SpeI was connected with the digested PCR fragment at 16°C overnight, and transformed into Escherichia coli DH5a competent cells. After enrichment of the cells, the cells were coated on a plate containing 50 μg·mL kanamycin. -1 After growing on LB solid medium for 12 h, the plasmid was extracted and screened and sequenced to obtain an overexpression vector containing the gene reading frame of OsSPL17, which was named OsSPL17-OE.

[0053] (4) Preparation of transgenic rice materials

[0054] The OsSPL17-OE plasmid was transformed into competent cells of Agrobacterium tumefaciens EHA105 by electroporation and then plated on a plate containing 50 μg mL-1 of kanamycin and 50 μg mL-1 of streptomycin. -1 The agrobacterium was grown on YEP solid medium for 48 h, positive colonies were picked, plasmids were extracted, and double enzyme digestion with KpnI and SpeI was used to verify that the agrobacterium was correct, thus obtaining the Agrobacterium liquid containing the OsSPL17-OE plasmid.

[0055] After the peeled rice seeds were disinfected with ethanol and sodium hypochlorite, they were placed on an induction medium for 5 days to induce callus tissue. The Agrobacterium culture containing the OsSPL17-OE plasmid was first streaked on an alkaline bile salt agar medium and cultured in the dark at 28°C for 3 days. After obtaining a single colony, the single colony was transferred to an AAM culture medium containing acetosyringone and suspended to a bacterial concentration of about 0.1 at OD600. The suspended bacterial solution was centrifuged, the culture medium was discarded, and the culture medium was added with 200 μmol·L -1 The transformation enhancer of acetosyringone collects the bacterial cells and prepares a suspension. The callus tissue is mixed with the suspension for 5 minutes to allow Agrobacterium to infect the callus tissue, then the callus tissue is taken out, and after draining the suspension, the callus tissue is placed on the co-cultivation medium for dark culture for 3 days. After the culture is completed, the callus tissue is washed with sterile water and transferred to a selection medium containing different concentrations of carbenicillin and hygromycin for two screenings. The resistant callus tissue obtained by screening is moved into a differentiation medium for differentiation into seedlings, and then moved into a rooting medium for seedling strengthening. The seedlings that are more well differentiated are hardened for 3-7 days, transplanted to a greenhouse for growth, and transgenic seedlings are obtained.

[0056] Rapid detection of transgenic seedlings with hygromycin: Cut fresh green leaves of about 1 cm long from the seedlings to be tested (with cuts at both ends), place them flat on a culture medium containing hygromycin, and culture at 30°C for 48 hours. Plants with leaves that remain bright green are positive (successful transgenic), and plants with necrosis are negative (failed transgenic). Hygromycin is used to screen positive T0 plants, which are then planted to obtain T0 seeds. After the T0 seeds germinate, T1 transgenic seedlings are obtained, and T1 seeds are obtained. The T1 seeds are planted on a culture medium containing hygromycin, and homozygous T2 transgenic seedlings are screened, i.e., transgenic phosphorus-inefficient rice materials.

[0057] (5) Molecular identification of OsSPL17 overexpression lines

[0058] The transgenic phosphorus-inefficient rice material obtained in step (4) was subjected to RNA extraction and cDNA synthesis, and then quantitatively identified by qPCR. It was determined that the expression level of the OsSPL17 gene in rice was much higher than that in wild-type rice Zhonghua 11 ( Figure 1 ), indicating that the T2 transgenic seedlings obtained in step (4) are the OsSPL17 overexpression strain.

[0059] Example 2 Obtaining transgenic phosphorus-efficient rice material

[0060] (1) Construction of OsSPL17 gene knockout vector

[0061] According to the sequence of OsSPL17 gene, the target was selected in the third exon of OsSPL17 gene: TTGCAGGTCACAATGAACGC ( Figure 2 ) for gene knockout. According to the target sequence, the primer pair Cas9-OsSPL17-F / R was designed, and the primer pair was denatured and annealed by PCR to obtain the OsSPL17 gDNA fragment. AarI enzyme was used to cut AarI-Cas9-PC1300 and the vector fragment after enzyme cutting was recovered. The OsSPL17 gDNA fragment was connected to the AarI-Cas9-PC1300 vector after AarⅠ enzyme cutting, and the connection product was recovered. The connection product was transformed into Escherichia coli DH5α competent cells, positive colonies were picked, and the plasmid was extracted for DNA sequencing. After screening and sequencing verification, the Cas9-OsSPL17 plasmid, i.e., the OsSPL17 gene knockout vector, was obtained. Among them, the connection, recovery, screening and verification steps are the same as those in Example 1.

[0062] (2) Preparation of transgenic rice materials

[0063] The OsSPL17 gene knockout vector was transformed into competent cells of Agrobacterium tumefaciens EHA105 by electroporation. The OsSPL17 gene knockout material was obtained by infecting rice callus with positive Agrobacterium and then spread on a plate containing 50 μg mL-1 of kanamycin and streptomycin.-1 The culture medium was grown on YEP solid medium for 48 h, positive colonies were picked, plasmids were extracted, and double enzyme digestion with KpnI and SpeI was used to verify that the plasmids were correct, thus obtaining Agrobacterium liquid containing Cas9-OsSPL17 plasmid.

[0064] After the peeled rice seeds were disinfected with ethanol and sodium hypochlorite, they were placed on an induction medium and cultured for 5 days to induce callus tissue. The Agrobacterium culture containing the Cas9-OsSPL17 plasmid was first streaked on an alkaline bile salt agar medium and cultured in the dark at 28°C for 3 days. After obtaining a single colony, the single colony was transferred to an AAM culture medium containing acetosyringone and suspended to a bacterial concentration of about 0.1 at OD600. The suspended bacterial solution was centrifuged, the culture medium was discarded, and the culture medium was washed with 200 μmol·L -1 The transformation enhancer of acetosyringone collects the bacterial cells and prepares a suspension. The callus tissue is mixed with the suspension for 5 minutes to allow Agrobacterium to infect the callus tissue, then the callus tissue is taken out, and after draining the suspension, the callus tissue is placed on the co-cultivation medium for dark culture for 3 days. After the culture is completed, the callus tissue is washed with sterile water and transferred to a selection medium containing different concentrations of carbenicillin and hygromycin for two screenings. The resistant callus tissue obtained by screening is moved into a differentiation medium for differentiation into seedlings, and then moved into a rooting medium for seedling strengthening. The seedlings that are more well differentiated are hardened for 3-7 days, transplanted to a greenhouse for growth, and transgenic seedlings are obtained.

[0065] Rapid detection of transgenic seedlings with hygromycin: Cut fresh green leaves of about 1 cm long from the leaves of the seedlings to be tested (with cuts at both ends), lay them flat on a culture medium containing hygromycin, and culture them at 30°C for 48 hours. Plants with leaves that remain bright green are positive (successful transgenic), and plants with necrosis are negative (failed transgenic). Hygromycin is used to screen positive T0 plants, which are then planted to obtain T0 generation seeds. After the T0 generation seeds germinate, T1 generation transgenic seedlings are obtained, and T1 generation seeds are obtained. The T1 generation seeds are planted on a culture medium containing hygromycin, and homozygous T2 generation transgenic seedlings are screened, i.e., transgenic phosphorus-efficient rice materials.

[0066] (3) Molecular identification of OsSPL17 gene deletion strains

[0067] Take the OsSPL17 gene knockout rice material obtained in step (2) and the wild-type Zhonghua 11 seedling leaves, extract DNA respectively, use the primer pair Cas9-OsSPL17'-F / R to perform PCR amplification on the extracted DNA, perform Sanger first-generation sequencing on the obtained amplification product, and compare the sequencing results with the Zhonghua 11 amplification product sequencing results. The comparison results are as follows Figure 2As shown, compared with the wild-type rice Zhonghua 11, the OsSPL17 gene knockout rice materials (spl17-1, spl17-2) have successfully inserted bases into the target, interrupting the coding of the OsSPL17 gene and inhibiting the expression of the OsSPL17 gene, confirming that the gene knockout was successful.

[0068] The primer sequences involved in Example 1 and Example 2 are shown in Table 1 below:

[0069] Table 1 Primer sequences

[0070]

[0071] Experimental Example Phenotypic Identification of Transgenic Rice

[0072] (1) Transgenic rice cultivation

[0073] The T2 generation OsSPL17 overexpressing rice transgenic materials (OE-1, OE-2) obtained in Experimental Example 1, the T2 generation OsSPL17 deletion expressing rice transgenic materials (spl17-1, spl17-2) obtained in Experimental Example 2, and the wild type rice Zhonghua 11 (ZH11) were cultured in high phosphorus medium and low phosphorus medium for 7 days, respectively, to obtain the plant materials to be tested.

[0074] (2) Observation of rice symptoms

[0075] Take the plant material obtained from the high phosphorus medium and observe the symptoms on the rice leaves. The results are as follows: Figure 3 As shown. The wild type has slightly yellowed leaf tips. Compared with the wild type rice Zhonghua 11 (ZH11), the OsSPL17 overexpression rice (OE-1, OE-2) obtained in Experimental Example 1 did not show any phosphorus toxicity symptoms such as yellowing and drying of leaf tips, while the OsSPL17 deletion expression rice (spl17-1, spl17-2) obtained in Experimental Example 2 showed obvious phosphorus toxicity symptoms of yellowing and drying of leaf tips. This shows that OsSPL17 can maintain the homeostasis of phosphorus in rice. When the gene is missing, the absorption of phosphorus by rice is excessive and toxic symptoms appear.

[0076] (3) Determination of phosphorus content in rice

[0077] The phosphorus content of rice was determined by colorimetry. The specific steps include: taking leaves of the plant to be tested, grinding them after washing and drying, taking an appropriate amount of plant tissue sample powder, adding a digesting agent to heat and digest, and filtering after cooling to obtain a digesting solution. Aspirate the digesting solution, add a dinitrophenol indicator after quantitative dilution, and neutralize with sodium hydroxide solution until the digesting solution just turns slightly yellow. Titrate with molybdenum antimony solution until the digesting solution just turns blue, and measure the absorbance after sufficient reaction. Calculate the phosphorus concentration according to the standard curve, and the total phosphorus content is obtained by combining the sample amount and the volume of the digesting solution.

[0078] The results are as follows Figure 4 As shown, different letters indicate significant differences among different treatments within the group (p<0.05). Under high-phosphorus or low-phosphorus conditions, the phosphorus content of the OsSPL17 overexpression rice (OE-2) obtained in Experimental Example 1 was significantly lower than that of the wild-type rice control (ZH11), indicating that excessive expression of OsSPL17 would reduce the phosphorus absorption efficiency of rice. Under high-phosphorus or low-phosphorus conditions, compared with the wild-type rice Zhonghua 11 (ZH11), the OsSPL17 deletion expression rice (spl17-1, spl17-2) obtained in Experimental Example 2 showed higher phosphorus content, indicating that the deletion expression of OsSPL17 would promote the absorption of phosphorus by rice.

[0079] Based on the above experimental results, compared with wild-type rice, rice overexpressing the OsSPL17 gene has a lower phosphorus absorption rate in a high-phosphorus environment, which reduces the degree of high-phosphorus toxicity of the plant; while the phosphorus absorption rate of rice lacking the OsSPL17 gene increases in a low-phosphorus environment, improving the phosphorus utilization rate of rice. This shows that the OsSPL17 gene plays an important regulatory function in rice phosphorus utilization, maintains phosphorus homeostasis in rice, and helps to improve the utilization rate of phosphorus fertilizer.

[0080] It can be understood that the above embodiments only express the preferred implementation modes of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the patent scope of the present invention. It should be pointed out that, for ordinary technicians in this field, the above technical features can be freely combined without departing from the concept of the present invention, and several deformations and improvements can be made, which all belong to the protection scope of the present invention. Therefore, all equivalent changes and modifications made to the scope of the claims of the present invention should belong to the coverage of the claims of the present invention.

Claims

1. An application of a rice gene in regulating phosphorus homeostasis, characterized in that: The rice OsSPL17 The nucleotide sequence of the gene is shown in SEQ ID NO.1, rice OsSPL17 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: Make the OsSPL17 Gene overexpression in rice includes the following steps: Build contains OsSPL17 The expression vector of the gene is transformed into an intermediate bacterium to obtain a positive transformant, and the positive transformant is used to infect rice. After screening and two or more times of propagation, phosphorus-low-efficiency rice is obtained.

3. The use according to claim 2, characterized in that: The construct contains OsSPL17 The gene expression vector comprises the following steps: Cloning rice OsSPL17 Gene open reading frame OsSPL17 The open reading frame was connected to the plasmid and the obtained plasmid was screened and sequenced. OsSPL17 Vectors of gene open reading frames; Amplification contains OsSPL17 The vector containing the gene open reading frame was obtained by carrying the restriction site OsSPL17 Gene reading frame OsSPL17 The gene reading frame was connected to the plasmid after enzyme digestion, and the plasmid containing OsSPL17 Gene expression vector.

4. The use according to claim 2, characterized in that: The screening includes the following steps: After the positive transformant and the rice callus are co-cultured, the rice callus is washed with sterile water, and then the rice callus is transferred to a medium containing antibiotics for selective culture, followed by differentiation, rooting, and seedling hardening.

5. The use according to claim 1, characterized in that: Suppress the OsSPL17 Gene expression in rice includes the following steps: Build OsSPL17 A knockout vector of a gene is used, and the knockout vector is transformed into an intermediate bacterium to obtain a positive transformant, and the positive transformant is used to infect rice. After screening and two or more propagation, phosphorus-efficient rice is obtained.

6. The use according to claim 5, characterized in that: The knockout vector is based on rice OsSPL17 The target site of the gene is constructed, and the nucleotide sequence of the target site is shown in SEQ ID NO.

3.

7. The use according to claim 5, characterized in that: The construction OsSPL17 The gene knockout vector comprises the following steps: Primers are designed based on the target site of claim 6, and the primers are denatured and annealed to obtain an intermediate vector, and the intermediate vector is connected to the vector after enzyme digestion, and the vector is obtained through screening and sequencing verification. OsSPL17 Gene knockout vector.

8. The use according to claim 5, characterized in that: The screening includes the following steps: After the positive transformant and the rice callus are co-cultured, the rice callus is washed with sterile water, and then the rice callus is transferred to a medium containing antibiotics for selective culture, followed by differentiation, rooting, and seedling hardening.

9. The use according to claim 1, characterized in that: Said OsSPL17 The expression levels of the gene and its encoded protein in rice are negatively correlated with rice phosphorus accumulation.

10. The use according to claim 1, characterized in that: Including the OsSPL17 The application of genes and their encoded proteins in promoting or inhibiting phosphorus absorption in rice.

11. The use according to claim 1, characterized in that: Including the OsSPL17 Application of genes and their encoded proteins in maintaining phosphorus homeostasis in rice.

Images