Application of APK protein in regulation and control of phytophthora root rot resistance of alfalfa

Abstract

The invention discloses application of APK protein in regulation and control of phytophthora root rot resistance of alfalfa. The invention provides a protein which is named as an MtAPK mutant protein and is (a1) or (a2) as follows: (a1) a protein obtained by replacing a 20th amino acid residue in SEQ ID NO: 1 with an amino acid residue in a simulated non-phosphorylation form; and (a2) a fusion protein obtained by connecting a tag to the N terminal or / and C terminal of the protein (a1). The invention also provides a method for cultivating the transgenic plant with improved resistance to root rot, which comprises the following steps: mutating a gene for coding MtAPK protein in a receptor plant genome DNA into a gene for coding MtAPK mutant protein to obtain the transgenic plant with improved resistance to root rot, the MtAPK protein is a protein as shown in SEQ ID NO: 1 (Sequence Identity Number 1).

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to application of APK protein in regulating Phytophthora root rot of alfalfa. Background Art

[0002] Alfalfa is the earliest cultivated high-quality forage grass in the world with a large cultivated area. It is an important source of nutrition urgently needed by animal husbandry and dairy industry. When alfalfa is seriously infected by Phytophthora, a large number of alfalfa plants will die, directly affecting the planting density and yield of alfalfa. Even the plants that are not dead will be inhibited in growth, grow slowly, have fewer branches, and the overall yield of alfalfa will drop significantly. The nutrient content of alfalfa infected with Phytophthora changes, and the quality of alfalfa decreases, affecting its nutritional value and palatability as feed, thereby reducing the economic value of alfalfa.

[0003] Phytophthora is an oomycete that can produce oospores in infected plant tissues. These oospores can survive in the soil for many years even without a host plant, which is an important source of infection in field production systems. Once the environmental conditions are suitable, the spread and pathogenicity of Phytophthora infection are very fast, and the efficacy of conventional chemical pesticides is limited. Therefore, using genetic improvement and molecular breeding to cultivate new varieties to control the occurrence of diseases is the most economical and effective measure, and it is also the only way for the future development of the forage industry. Summary of the invention

[0004] The purpose of the present invention is to provide application of APK protein in regulating alfalfa resistance to Phytophthora root rot.

[0005] The present invention provides a protein, named as MtAPK mutant protein, which is as follows (a1) or (a2):

[0006] (a1) a protein obtained by replacing the amino acid residue at position 20 in SEQ ID NO: 1 with an amino acid residue that mimics the non-phosphorylated form;

[0007] (a2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1).

[0008] The amino acid mimicking the non-phosphorylated form is alanine (Ala), glycine (Gly), valine (Val) or leucine (Leu).

[0009] When the amino acid in the simulated non-phosphorylated form is alanine, the MtAPK mutant protein is shown in SEQ ID NO: 4. The protein shown in SEQ ID NO: 4 is named MtAPK S20A protein.

[0010] The labels may be specifically shown in Table 1.

[0011] Table 1 Tag sequences

[0012] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0013] The present invention also provides a protein-related biological material, which is any one of the following (b1) to (b4):

[0014] (b1) a nucleic acid molecule encoding the MtAPK mutant protein;

[0015] (b2) an expression cassette containing the nucleic acid molecule described in (b1);

[0016] (b3) a recombinant vector containing the nucleic acid molecule described in (b1) or a recombinant vector containing the expression cassette described in (b2);

[0017] (b4) A recombinant microorganism containing the nucleic acid molecule described in (b1), a recombinant microorganism containing the expression cassette described in (b2), or a recombinant microorganism containing the recombinant vector described in (b3).

[0018] The nucleic acid molecule encoding the MtAPK mutant protein may specifically be a gene encoding the MtAPK mutant protein.

[0019] Specifically, the gene encoding the MtAPK mutant protein is as follows (c1) or (c2) or (c3):

[0020] (c1) a DNA molecule obtained by mutating the codon encoding the 20th amino acid residue in the DNA molecule encoding the protein shown in SEQ ID NO: 1 from a codon encoding serine to a codon encoding an amino acid simulating a non-phosphorylated form;

[0021] (c2) a DNA molecule derived from alfalfa and having more than 95% identity with (c1) and encoding the MtAPK mutant protein;

[0022] (c3) A DNA molecule that hybridizes with the nucleotide sequence defined in (c1) under stringent conditions and encodes the MtAPK mutant protein.

[0023] The stringent conditions may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0024] The amino acid mimicking the non-phosphorylated form is alanine (Ala), glycine (Gly), valine (Val) or leucine (Leu).

[0025] The amino acid residue at position 20 in SEQ ID NO: 1 is serine.

[0026] As an example, the codon encoding serine is TCT.

[0027] As an example, the codon encoding alanine is GCT, GCC, GCA or GCG.

[0028] As an example, the codon encoding glycine is GGT, GGC, GGA or GGG.

[0029] As an example, the codon encoding valine is GTT, GTC, GTA or GTG.

[0030] As an example, the codon encoding leucine is TTA, TTG, CTT, CTC, CTA or CTG.

[0031] When the mutant protein is MtAPK S20A When the mutant protein is expressed, the gene encoding the mutant protein is named MtAPK S20A Gene.

[0032] For example, MtAPK S20A The gene is as follows (d1) or (d2) or (d3):

[0033] (d1) a DNA molecule whose coding sequence is shown in SEQ ID NO: 5;

[0034] (d2) is derived from alfalfa and has more than 95% identity with (d1) and encodes the MtAPK S20A DNA molecules of proteins;

[0035] (d3) hybridizes with the nucleotide sequence defined in (d1) under stringent conditions and encodes the MtAPK S20A Protein DNA molecule.

[0036] The stringent conditions may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0037] The present invention also provides the use of the MtAPK mutant protein or the gene encoding the MtAPK mutant protein in regulating the disease resistance of plants to root rot.

[0038] The regulation is positive regulation.

[0039] Replacing the MtAPK protein with a mutant MtAPK protein enhances the plant's resistance to root rot.

[0040] Replacing the gene encoding the MtAPK protein with a gene encoding a mutant MtAPK protein enhances the plant's resistance to root rot.

[0041] The present invention also provides the use of the MtAPK mutant protein or the gene encoding the MtAPK mutant protein in regulating the resistance of plants to Phytophthora.

[0042] The regulation is positive regulation.

[0043] Replacing the MtAPK protein with a mutant MtAPK protein enhances the plant's resistance to Phytophthora.

[0044] Replacing the gene encoding the MtAPK protein with a gene encoding a mutant MtAPK protein enhances the plant's resistance to Phytophthora.

[0045] The present invention also provides the use of the protein-related biological material in preparing transgenic plants with improved disease resistance to root rot.

[0046] The present invention also provides the use of the above protein-related biological material in preparing transgenic plants with improved resistance to Phytophthora.

[0047] The present invention also provides a method for cultivating transgenic plants with improved resistance to root rot, comprising the following steps: introducing a gene encoding a MtAPK mutant protein into a recipient plant to obtain a transgenic plant with improved resistance to root rot.

[0048] The present invention also provides a method for cultivating transgenic plants with improved resistance to Phytophthora, comprising the following steps: introducing a gene encoding a mutant protein of MtAPK into a recipient plant to obtain a transgenic plant with improved resistance to Phytophthora.

[0049] The present invention also provides a method for cultivating transgenic plants with improved resistance to root rot, comprising the following steps: mutating the gene encoding the MtAPK protein (i.e., the MtAPK gene) in the genomic DNA of the recipient plant into a gene encoding the MtAPK mutant protein, thereby obtaining a transgenic plant with improved resistance to root rot.

[0050] The present invention also provides a method for cultivating transgenic plants with improved resistance to Phytophthora, comprising the following steps: mutating the gene encoding MtAPK protein in the genomic DNA of the recipient plant into a gene encoding MtAPK mutant protein to obtain the transgenic plant with improved resistance to Phytophthora.

[0051] The MtAPK protein is the protein shown in SEQ ID NO:1.

[0052] Exemplarily, the MtAPK gene is as follows (e1) or (e2) or (e3) or (e4):

[0053] (e1) a DNA molecule whose coding sequence is shown in SEQ ID NO: 2;

[0054] (e2) the DNA molecule shown in SEQ ID NO: 3;

[0055] (e3) a DNA molecule derived from alfalfa and having more than 95% identity with (e1) or (e2) and encoding the MtAPK protein;

[0056] (e4) A DNA molecule that hybridizes with the nucleotide sequence defined in (e1) or (e2) under stringent conditions and encodes the MtAPK protein.

[0057] The stringent conditions may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0058] The introduction of the gene encoding the MtAPK mutant protein into the recipient plant is specifically achieved by introducing a recombinant vector.

[0059] The recombinant vector may specifically be a recombinant expression vector.

[0060] Exemplarily, the recombinant expression vector can be specifically the following recombinant plasmid: using pCAMBIA1381 vector as the starting vector, inserting the DNA molecule shown in SEQ ID NO: 8 between the EcoRI and SalI restriction sites, and inserting the gene encoding the MtAPK mutant protein between the SalI and BglII restriction sites to obtain a recombinant plasmid.

[0061] Any of the above described Phytophthora is Phytophthora alfalfa.

[0062] Any of the above described Phytophthora is Phytophthora alfalfa strain 44390.

[0063] Any of the above plants is a leguminous plant.

[0064] Any of the above plants is a plant of the genus Alfalfa.

[0065] Any of the above plants is Medicago truncatula.

[0066] Any of the above plants is of Medicago truncatula R108 ecotype.

[0067] Any of the above plants is Medicago truncatula Tnt1 insertion mutant NF7291, Medicago truncatula Tnt1 insertion mutant NF15395 or Medicago truncatula Tnt1 insertion mutant NF15906.

[0068] Any of the above plants is a homozygous Tnt1 insertion mutant in the self-pollinated offspring of Medicago truncatula Tnt1 insertion mutant NF7291, a homozygous Tnt1 insertion mutant in the self-pollinated offspring of Medicago truncatula Tnt1 insertion mutant NF15395, or a homozygous Tnt1 insertion mutant in the self-pollinated offspring of Medicago truncatula Tnt1 insertion mutant NF15906.

[0069] The inventors obtained Tnt1 insertion mutants of Medicago truncatula from the Medicago truncatula Mutant Database, and screened and identified Mtapk mutants (NF7291, NF15395, NF15906). Homozygous mutant plants showed curled leaves, short plants, shortened roots, and activated immune responses in the plants.

[0070] The 20th amino acid residue (serine) of the MtAPK protein of Medicago truncatula can be phosphorylated by the MtVIK protein kinase. The phosphorylation state of the MtAPK protein affects the resistance of the plant to pathogens. Compared with wild-type plants, the gene-complemented plants (ProMtAPK:MtAPK / Mtapk, ProMtAPK:MtAPK S20A / Mtapk and ProMtAPK:MtAPK S20D / Mtapk) showed no significant difference in growth and development, indicating that the simulated phosphorylated form and the simulated non-phosphorylated form of the 20th amino acid residue (serine) of the MtAPK protein did not affect growth and development. S20A / Mtapk plants showed significantly enhanced resistance to Phytophthora, while ProMtAPK:MtAPK / Mtapk plants showed no significant difference in resistance to Phytophthora. S20D / Mtapk plants have weaker resistance to Phytophthora. This indicates that the simulated non-phosphorylated form of MtAPK protein can improve the resistance of plants to Phytophthora alfalfa.

[0071] The invention provides valuable resources for cultivating new alfalfa germplasm resistant to alfalfa phytophthora root rot. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Figure 1 Schematic representation of the insertion positions of the three mutants in Example 1 and the phenotypic comparison between the homozygous mutants and the wild-type plants in the self-pollinated progenies of the three mutants.

[0073] Figure 2 This is a PCR identification diagram for identifying homozygous mutants from the self-pollinated offspring plants of the three mutants in Example 1.

[0074] Figure 3 This is the PCR identification and related sequencing results in Example 3.

[0075] Figure 4 This is a group photo showing the survival rate of the plants in Example 3.

[0076] Figure 5 The following are photos of individual plants and the test results of plant traits in Example 3.

[0077] Figure 6 This is a diagram of the relevant results in Example 4.

[0078] Figure 7 This is a diagram showing the relevant results in Example 5. DETAILED DESCRIPTION

[0079] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0080] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. Unless otherwise specified, the quantitative tests in the following examples are all set up for three repeated experiments, and the results are averaged. The examples use SPSS and GraphPad Prism for data analysis, and the experimental results are expressed as mean ± standard deviation. One-way analysis of variance (ANOVA), Kruskal-Wallis, and nonparametric test Tukey's test are used for pairwise comparison. Unless otherwise specified, the plant height in the examples refers to the length from the top of the plant to the root tip (i.e., plant height = height of the aboveground part + root length). Unless otherwise specified, the meaning of light and dark alternating cultivation in the examples is "16 hours of light / 8 hours of darkness". Flowerpot specifications: diameter 9cm, height 11cm. Culture matrix: mixed with 5 parts by volume of vermiculite and 2 parts by volume of perlite.

[0081] Medicago truncatula R108 (Medicago truncatula R108 ecotype), also known as wild-type plant or wild-type alfalfa, is represented by WT or wild type or R108. Medicago truncatula R108 and pCAMBIA1381 vector are both recorded in the following literature: Jinling Liu, Hong Chen, Li Liu, Xiangzhao Meng, Qianwen Liu, Qinyi Ye, Jiangqi Wen, Tao Wang, Jiangli Dong. A cargo sorting receptor mediates chloroplast protein trafficking through the secretory pathway. The Plant Cell. 2024 Sep3; 36 (9): 3770-3786. ", which can be obtained by the public from the applicant and can only be used to repeat the experiments of the present invention.

[0082] The Phytophthora medicaginis used in the examples is strain 44390, which is described in the following document: Zhang Zhengguang, Wang Yuanchao, Zheng Xiaobo. Analysis of rDNA ITS sequences of Phytophthora medicaginis and Phytophthora medicaginis. Fungal Systematics, 2003, 22(4): 542-548.

[0083] Solid SH3α medium (1L): SH macromolecular solution (10×) 100mL, SH micromolecular solution (1000×) 1mL, SH organic solution (1000×) 1mL, EDFS iron salt solution (50×) 20mL, inositol (Myo-inositol) 0.1g, 2,4-D stock solution (10mg / mL) 0.4mL, 6-BAP stock solution (1mg / mL) 0.5mL, sucrose 30g, agar 8g, the rest is water; pH value is 5.85. Compared with solid SH3α medium, the only difference of liquid SH3α medium is that it does not contain agar.

[0084] Solid SH9 culture medium (1L): SH macromolecular solution (10×) 100mL, SH micromolecular solution (1000×) 1mL, SH organicmolecular solution (1000×) 1mL, EDFS iron saltmolecular solution (50×) 20mL, inositol (Myo-inositol) 0.1g, sucrose 20g, agar 8g, and the balance is water; pH value is 5.85.

[0085] Solid 1 / 2MS culture medium (1L): MS macromolecular solution (20×) 25mL, MS micromolecular solution (200×) 5mL, MS organic solution (200×) 5mL, MS iron salt solution (200×) 5mL, sucrose 20g, agar 8g, and the balance is water; pH value is 5.85.

[0086] Solid V8 medium (1L): contains 100mL V8 juice (American Campbell V8 fruit and vegetable juice), 2.5g calcium carbonate and 15g agar, and the rest is water.

[0087] The formulas of the various mother solutions or commercial sources of the stock solutions used in preparing the culture media are shown in Tables 2 and 3.

[0088] Table 2

[0089]

[0090] Table 3

[0091]

[0092]

[0093] The nucleotide sequences of the primers involved in the examples are shown in Table 4.

[0094] Table 4

[0095] apk F' GGCTCTTTACGCAAAACTCTC apk R' AACAATGACAATGAAAGTGGGTA apk F ATTGTTTGATGCTTCTTGGTT apk R TGTTCACAAAGATTCCACCC Tnt1-F TACTCCAGACATTTTTATTTTTCAC APKpro-F GCAGGAATTCGACAGAGTTCATTTGTGCTTT APK-R TTTCCAAGGAAGTTTAAAAGC

[0096] Example 1. Acquisition and phenotypic detection of Medicago truncatula Mtapk mutants

[0097] Medicago truncatula Tnt1 insertion mutant NF7291 (referred to as mutant NF7291), Medicago truncatula Tnt1 insertion mutant NF15395 (referred to as mutant NF15395) and Medicago truncatula Tnt1 insertion mutant NF15906 (referred to as mutant NF15906) were all obtained by inserting the Tnt1 retrotransposon into the genomic DNA of wild-type alfalfa, and were obtained from the Medicago truncatulaMutant Database (https: / / medicago-mutant.dasnr.okstate.edu / mutant / database.php; contact email: jiangqi.wen@okstate.edu).

[0098] The insertion position of the Tnt1 retrotransposon in the genomic DNA of the mutant NF7291 is between the 104th and 105th nucleotides of the MtAPK gene (the genotype is heterozygous). The insertion position of the Tnt1 retrotransposon in the genomic DNA of the mutant NF15395 is between the 306th and 307th nucleotides of the MtAPK gene (the genotype is heterozygous). The insertion position of the Tnt1 retrotransposon in the genomic DNA of the mutant NF15906 is between the 1892th and 1893th nucleotides of the MtAPK gene (the genotype is heterozygous). See the schematic diagram of the insertion position. Figure 1 The above position intervals are all measured with A of the start codon ATG of the MtAPK gene as the first position.

[0099] The Tnt1 insertion mutant of Medicago truncatula (mutant NF7291 or mutant NF15395) was self-pollinated and seeds were harvested. The seeds were cultivated into plants, and then the leaves of the plants were taken and genomic DNA was extracted. Using the genomic DNA as a template, PCR identification was performed using primer pair 1 (consisting of Tnt1-F and apk R', with a target fragment size of 1319 bp or 1117 bp) and primer pair 2 (consisting of apk F' and apkR', with a target fragment size of 666 bp). If a plant shows the target amplification product using primer pair 1 and does not show the target amplification product using primer pair 2, the plant is a homozygous Tnt1 insertion mutant. The identification results of the self-pollinated offspring plants of NF7291 are shown in Figure 2 The identification results of the self-fertilized progeny plants of NF15395 are shown in Figure 2 B, the plants corresponding to the lanes marked with dashed boxes are homozygous Tnt1 insertion mutants.

[0100] The Medicago truncatula Tnt1 insertion mutant NF15906 was self-pollinated and seeds were harvested. The seeds were cultivated into plants, and then the plant leaves were taken and genomic DNA was extracted. Using the genomic DNA as a template, PCR identification was performed using primer pair 3 (consisting of Tnt1-F and apk R, with a target fragment size of 1078 bp) and primer pair 4 (consisting of apk F and apk R, with a target fragment size of 609 bp). If a plant shows the target amplification product using primer pair 3 and does not show the target amplification product using primer pair 4, the plant is a homozygous Tnt1 insertion mutant. The identification results of the self-pollinated offspring plants of NF15906 are shown in Figure 2 C, the plants corresponding to the lanes marked with dashed boxes are homozygous Tnt1 insertion mutants.

[0101] Compared with wild-type plants, the homozygous Tnt1 insertion mutant screened from self-pollinated progenies showed obvious growth and development defect phenotypes (see Figure 1B), specifically manifested as: short plants, curled leaves, shortened roots, and activated immune responses in plants. To further clarify the effects of MtAPK gene mutations on plant growth and development, a phenotypic statistical analysis was performed on the homozygous Tnt1 insertion mutants. The plant height, aboveground height, and root length of wild-type plants and homozygous Tnt1 insertion mutants grown under normal growth conditions for three weeks were statistically analyzed. The results are shown in Figure 1 C, D and E. The plant height, aboveground height and root length of the homozygous Tnt1 insertion mutant were significantly lower than those of the wild-type plants, indicating that the MtAPK gene mutation significantly inhibited the growth and development of the plant.

[0102] Example 2: Construction of recombinant expression vector

[0103] Using pCAMBIA1381 vector as the starting vector, insert the MtAPK gene promoter (as shown in SEQ ID NO: 8) between the EcoRI and SalI restriction sites, and insert the target gene between the SalI and BglII restriction sites to obtain a recombinant plasmid. The recombinant plasmids have been sequenced and verified. The 20th serine (Ser, S) of the MtAPK protein is mutated to alanine (Ala, A) to simulate the non-phosphorylated form. The 20th serine (Ser, S) of the MtAPK protein is mutated to aspartic acid (Asp, D) to simulate the continuous phosphorylation form.

[0104] When the target gene is the MtAPK gene (as shown in SEQ ID NO: 2), the obtained recombinant plasmid is named pCAMBIA1381-ProMtAPK:MtAPK plasmid.

[0105] The target gene is MtAPK S20A When the gene (as shown in SEQ ID NO: 5) was expressed, the resulting recombinant plasmid was named pCAMBIA1381-ProMtAPK S20A :MtAPK plasmid.

[0106] The target gene is MtAPK S20D When the gene (as shown in SEQ ID NO: 7) was cloned, the resulting recombinant plasmid was named pCAMBIA1381-ProMtAPK S20D :MtAPK plasmid.

[0107] Example 3: Acquisition and identification of transgenic Medicago truncatula materials

[0108] 1. Preparation of MtAPK gene transgenic materials

[0109] 1. Prepare recombinant Agrobacterium.

[0110] The pCAMBIA1381-ProMtAPK:MtAPK plasmid was introduced into EHA105 Agrobacterium to obtain recombinant Agrobacterium.

[0111] 2. Prepare infection solution

[0112] The recombinant Agrobacterium obtained in step 1 was inoculated into a liquid YEP medium containing 75 mg / L rifampicin and 50 mg / L kanamycin, and cultured at 28°C and 230 rpm until the OD 600nm Then, centrifuge at 5000 rpm for 6 min, collect the cells, and resuspend them in liquid SH3α medium containing 0.1 mM acetosyringone to a value of 0.6-0.8. 600nm The value is 0.6-0.8, which is the infection solution.

[0113] 3. Preparation of explants

[0114] The mutant NF15395 was self-pollinated and the seeds were harvested. The seeds were cultivated into plants. When the plants grew for 3 weeks, the leaves of the plants were taken and cut into 0.5 cm 2 Size, that is, the explant.

[0115] 4. Infection

[0116] Take the explant prepared in step 3, place it in a sealed container filled with infection solution, mix it, then evacuate it (-0.1pka, 30min), and then culture it at room temperature, away from light, and 80rpm for 1.5h. Then, take out the explant, remove the bacterial solution on the surface with sterile absorbent filter paper, and then spread it on a solid SH3α medium containing 0.1mM acetosyringone covered with a single layer of filter paper, and culture it in the dark at 22℃ for 3 days.

[0117] 5. Induced healing

[0118] After completing step 4, the explants were transferred to solid SH3α medium containing 10 mg / L hygromycin and 200 mg / L timentin and cultured in the dark at 25°C for 6 weeks (subcultured every 2 weeks).

[0119] 6. Induce bud differentiation

[0120] After completing step 5, the induced callus was transferred to a solid SH9 medium containing 5 mg / L hygromycin and 200 mg / L timentin, and cultured at 25°C with alternating light and dark for 9 weeks (subcultured every 3 weeks).

[0121] 7. Rooting

[0122] After completing step 6, the seedlings that have grown 2-3 leaves are transferred to solid 1 / 2MS medium (transferred to new solid 1 / 2MS medium every 3 weeks) and cultured at 25°C with alternating light and dark until the plants take root.

[0123] 8. After completing step 7, transfer the rooted plants to a greenhouse for cultivation (22°C light culture for 16 hours / 18°C dark culture for 8 hours, with a light intensity of 70-80 μmol·m -2 ·s -1 During the culture process, leaves were taken to extract genomic DNA and perform PCR identification.

[0124] The wild-type plants were used as negative controls for the test plants during PCR identification. PCR identification method: Using genomic DNA as a template, primer pair 3 (consisting of Tnt1-F and apk R, with a target fragment size of 1078 bp), primer pair 4 (consisting of apk F and apk R, with a target fragment size of 609 bp) and primer pair 5 (consisting of APKpro-F and APK-R, with a target fragment size of 3079 bp) were used for PCR identification. Plants that met the following criteria were PCR-positive plants: in PCR identification, primer pair 3 showed the target amplification product, primer pair 4 did not show the target amplification product, and primer pair 5 showed the target amplification product.

[0125] For plants that are positive in PCR identification, the target fragment obtained by using primer pair 5 in PCR identification is recovered and sequenced for verification. Plants that meet the following criteria are transgenic plants with the MtAPK gene: the sequencing results contain the segment shown in positions 1 to 1431 in SEQ ID NO: 2.

[0126] PCR identification and related sequencing results are shown in Figure 3 .

[0127] 9. The transgenic MtAPK plants selected in step 8 are self-pollinated and seeds are harvested, and the seeds are cultivated into plants (i.e., T1 generation plants). Homozygous transgenic MtAPK plants are selected from the T1 generation plants. Screening method: Take leaves, extract genomic DNA, use primer pair 5 (composed of APKpro-F and APK-R, target fragment size is 3079 bp) for PCR amplification, then recover the target amplification product and sequence it. If there is only one sequencing result and it contains the segment shown in positions 1 to 1431 in SEQ ID NO: 2, the T1 generation plant is a homozygous transgenic MtAPK plant.

[0128] 2. Preparation of transgenic MtAPK S20A Genetic material

[0129] 1. Prepare recombinant Agrobacterium.

[0130] pCAMBIA1381-ProMtAPK S20A :MtAPK plasmid was introduced into EHA105 Agrobacterium to obtain recombinant Agrobacterium.

[0131] 2. Prepare infection solution

[0132] Same as step 1, step 2.

[0133] 3. Preparation of explants

[0134] Same as step 1, step 3.

[0135] 4. Infection

[0136] Same as step 1, step 4.

[0137] 5. Induced healing

[0138] Same as step 1, step 5.

[0139] 6. Induce bud differentiation

[0140] Same as step 1, step 6.

[0141] 7. Rooting

[0142] Same as step 1, step 7.

[0143] 8. After completing step 7, transfer the rooted plants to a greenhouse for cultivation (22°C light culture for 16 hours / 18°C dark culture for 8 hours, with a light intensity of 70-80 μmol·m -2 ·s -1 During the culture process, leaves were taken to extract genomic DNA and perform PCR identification.

[0144] The wild-type plants were used as negative controls for the test plants during PCR identification. PCR identification method: Using genomic DNA as a template, primer pair 3 (consisting of Tnt1-F and apk R, with a target fragment size of 1078 bp), primer pair 4 (consisting of apk F and apk R, with a target fragment size of 609 bp) and primer pair 5 (consisting of APKpro-F and APK-R, with a target fragment size of 3079 bp) were used for PCR identification. Plants that met the following criteria were PCR-positive plants: in PCR identification, primer pair 3 showed the target amplification product, primer pair 4 did not show the target amplification product, and primer pair 5 showed the target amplification product.

[0145] For plants that were positive in PCR identification, the target fragment obtained by using primer pair 5 in PCR identification was recovered and sequenced for verification. Plants that met the following criteria were considered MtAPK transgenic plants. S20A Gene plant: The sequencing result shows the segment from position 1 to position 1431 in SEQ ID NO: 5.

[0146] PCR identification and related sequencing results are shown in Figure 3 .

[0147] 9. The MtAPK selected in step 8 S20A Genetic plants are self-pollinated and seeds are harvested, and the seeds are cultivated into plants (i.e., T1 generation plants). Homozygous transgenic MtAPK S20A Screening method: Take leaves, extract genomic DNA, use primer pair 5 (composed of APKpro-F and APK-R, target fragment size is 3079bp) for PCR amplification, then recover the target amplification product and sequence it. If there is only one sequencing result and it contains the segment shown in positions 1 to 1431 in SEQ ID NO: 5, the T1 generation plant is a homozygous transgenic MtAPK S20A Genetic plants.

[0148] 3. Preparation of transgenic MtAPK S20D Genetic material

[0149] 1. Prepare recombinant Agrobacterium.

[0150] pCAMBIA1381-ProMtAPK S20D :MtAPK plasmid was introduced into EHA105 Agrobacterium to obtain recombinant Agrobacterium.

[0151] 2. Prepare infection solution

[0152] Same as step 1, step 2.

[0153] 3. Preparation of explants

[0154] Same as step 1, step 3.

[0155] 4. Infection

[0156] Same as step 1, step 4.

[0157] 5. Induced healing

[0158] Same as step 1, step 5.

[0159] 6. Induce bud differentiation

[0160] Same as step 1, step 6.

[0161] 7. Rooting

[0162] Same as step 1, step 7.

[0163] 8. After completing step 7, transfer the rooted plants to a greenhouse for cultivation (22°C light culture for 16 hours / 18°C dark culture for 8 hours, with a light intensity of 70-80 μmol·m -2 ·s -1 During the culture process, leaves were taken to extract genomic DNA and perform PCR identification.

[0164] The wild-type plants were used as negative controls for the test plants during PCR identification. PCR identification method: Using genomic DNA as a template, primer pair 3 (consisting of Tnt1-F and apk R, with a target fragment size of 1078 bp), primer pair 4 (consisting of apk F and apk R, with a target fragment size of 609 bp) and primer pair 5 (consisting of APKpro-F and APK-R, with a target fragment size of 3079 bp) were used for PCR identification. Plants that met the following criteria were PCR-positive plants: in PCR identification, primer pair 3 showed the target amplification product, primer pair 4 did not show the target amplification product, and primer pair 5 showed the target amplification product.

[0165] For plants that were positive in PCR identification, the target fragment obtained by using primer pair 5 in PCR identification was recovered and sequenced for verification. Plants that met the following criteria were considered MtAPK transgenic plants. S20D Gene plant: The sequencing result shows the segment from position 1 to position 1431 in SEQ ID NO: 7.

[0166] PCR identification and related sequencing results are shown in Figure 3 .

[0167] 9. The MtAPK selected in step 8 S20D Genetic plants are self-pollinated and seeds are harvested, and the seeds are cultivated into plants (i.e., T1 generation plants). Homozygous transgenic MtAPK S20D Screening method: Take leaves, extract genomic DNA, use primer pair 5 (composed of APKpro-F and APK-R, target fragment size is 3079bp) for PCR amplification, then recover the target amplification product and sequence it. If there is only one sequencing result and it contains the segment shown in positions 1 to 1431 in SEQ ID NO: 7, the T1 generation plant is a homozygous transgenic MtAPK S20D Genetic plants.

[0168] 4. Phenotypic Identification

[0169] Test seeds: self-pollinated seeds of homozygous MtAPK transgenic plants obtained in step 1 (expressed as MtAPK / Mtapk), homozygous MtAPK transgenic plants obtained in step 2 S20A Self-pollinated seeds of gene plants (using MtAPK S20A / Mtapk), the homozygous transgenic MtAPK obtained in step 3 S20D Self-pollinated seeds of gene plants (using MtAPK S20D / Mtapk) or seeds of wild-type alfalfa (represented by R108).

[0170] 1. Place the test seeds in a 2mL centrifuge tube, add 1mL of 98% concentrated sulfuric acid and shake gently for 8min, then rinse with sterile water 8 times, then add 1mL of 5% sodium hypochlorite aqueous solution for 12min, then rinse with sterile water 10 times, then spread the seeds on a 0.8% water agar plate, invert and culture in the dark at 4℃ for 3 days, then invert and culture in the dark at room temperature for 12 hours (the seeds germinate at this time).

[0171] 2. Prepare the control group and test group flower pots

[0172] Control group flower pots: Take flower pots and fill them with culture matrix (700cm 3 Control dish: Add 15 mL of solid V8 medium that has not yet solidified to a 90 mm diameter dish, let it stand to solidify, and incubate it upside down at 28°C for 6 days.

[0173] Experimental group flower pots: Take flower pots and fill them with culture matrix (700cm 3 Test dish: Add 15 mL of solid V8 medium that has not yet solidified to a 90 mm diameter dish, let it stand to solidify, and then inoculate Phytophthora alfalfa (0.5 cm 3 Bacterial blocks / petri dish) and cultured inverted at 28°C for 6 days.

[0174] 3. Group processing

[0175] Control group (CK): Take the control group flower pots and sow the germinated seeds obtained in step 1 (5 seeds per flower pot).

[0176] Experimental group (Pm): Take the experimental group flower pots and sow the germinated seeds obtained in step 1 (5 seeds per pot).

[0177] Culture conditions: 28°C, alternating light and dark. Culture time: 3 weeks.

[0178] Each group of each test seed had 25 plants.

[0179] After the culture is completed, observe the morphology and take photos. Figure 4 .

[0180] After the cultivation is completed, the survival rate is counted. After the cultivation is completed, the whole plant (including the roots and the aboveground parts) is taken, washed, and then dried, and then photographed and the fresh weight, aboveground part height, root length and plant height are measured, and the leaves are taken to detect the relative conductivity. See the photos for details. Figure 5 The results of survival rate, fresh weight, aboveground height, root length, plant height and electrical conductivity are shown in Figure 5 B. Figure 5There are significant differences between the data marked with different letters, and there are no significant differences between the data marked with the same letters.

[0181] Control group: Compared with wild-type alfalfa, the complemented plants (MtAPK / Mtapk, MtAPK S20A / Mtapk, MtAPK S20D / Mtapk) had no significant difference in growth and development. S20A The survival rate of Mtapk plants was about 75%, that of R108 plants was about 50%, and that of MtAPK S20A / Mtapk plants had a significantly higher survival rate than R108 plants; S20A The fresh weight, aboveground height, root length, and plant height of the MtAPK / Mtapk plants were significantly higher than those of the R108 plants. S20A / Mtapk plants had significantly lower relative conductivity than R108 plants. The results showed that the mutation of serine 20 to alanine in MtAPK protein of Medicago truncatula significantly improved the resistance of plants to Phytophthora alfalfa.

[0182] Example 4. Acquisition and identification of transgenic Medicago truncatula materials

[0183] 1. Preparation of MtAPK gene transgenic materials

[0184] The method is the same as step 1 of Example 3.

[0185] PCR identification results are shown in Figure 6 B.

[0186] From homozygous MtAPK in T1 plants S20A Two plants were randomly selected from the gene plants and named MtAPK / Mtapk-2 plant and MtAPK / Mtapk-6 plant.

[0187] 2. Phenotypic Identification

[0188] Test plants: wild-type plants, homozygous Tnt1 insertion mutants (indicated by Mtapk) in the self-pollinated offspring of mutant NF15906 in Example 1, self-pollinated offspring of MtAPK / Mtapk-2 plants (indicated by MtAPK / Mtapk-2), and self-pollinated offspring of MtAPK / Mtapk-6 plants (indicated by MtAPK / Mtapk-6).

[0189] In a culture medium (700 cm 3 The test plants were cultured in pots containing 50% culture medium / pot, 5 plants / pot. Culture conditions: 28°C, alternating light and dark. The culture time was 3 weeks from seed germination.

[0190] For each test plant, 25 plants were set up as biological replicates.

[0191] After the culture is completed, observe the morphology and take photos. Figure 6 A.

[0192] After the cultivation is completed, the whole plant (including the roots and the aboveground parts) is taken, washed, and then wiped dry, and then the aboveground height, root length and plant height are measured. Figure 6 C, D and E. Figure 6 There are significant differences between the data marked with different letters, and there are no significant differences between the data marked with the same letters.

[0193] Example 5: Mechanism Study

[0194] Mechanism studies were conducted and the results are shown in Figure 7 .

[0195] Figure 7 A shows that MtVIK can phosphorylate the 20th serine of MtAPK protein through in vitro phosphorylation experiment. Figure 7 B is a Phos-tag experiment that proves that the MtAPK protein is phosphorylated after inoculation with Phytophthora alfalfa. As the inoculation time increases (6h-24h), the phosphorylation band gradually deepens. CIAP is an alkaline phosphatase, and its function is to remove the phosphate groups on the phosphorylated protein. Figure 7 C is the result of the Phos-tag experiment, which proved that the phosphorylation band of MtAPK protein in the Mtvik mutant was weak after inoculation with Phytophthora alfalfa; when the 20th serine (Ser, S) mutated to alanine (Ala, A), the MtAPK protein could not be phosphorylated. The results showed that the 20th serine of MtAPK protein was the key site for MtVIK to phosphorylate MtAPK.

[0196] Note: The conductivity is tested using a Mettler FE38-Standard conductivity meter. The operation method is as follows:

[0197] ① Take a 50mL centrifuge tube, add 20mL miliQ water, measure the conductivity of the liquid in the centrifuge tube, and record it as S0.

[0198] ②Take the centrifuge tube that has completed step ①, add the leaf to be tested, and then place the centrifuge tube in a vacuum pump to evacuate for 16 minutes (≤-0.089Mpa), then put the centrifuge tube in a shaker, incubate at 25℃ and 230rpm for 1 hour, measure the conductivity of the liquid in the centrifuge tube, and record it as S1.

[0199] ③Take the centrifuge tube that has completed step ③ and put it into boiling water for 35 minutes. Then put the centrifuge tube into a shaker and incubate it at 25℃ and 230rpm for 1 hour. Measure the conductivity of the liquid in the centrifuge tube and record it as S2.

[0200] Relative conductivity = (S1-S0) / (S2-S0).

[0201] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A protein, which is (a1) or (a2): (a1) a protein obtained by replacing the amino acid residue at position 20 in SEQ ID NO: 1 with an amino acid residue that mimics the non-phosphorylated form; (a2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1).

2. A protein-related biological material, which is any one of the following (b1) to (b4): (b1) a nucleic acid molecule encoding the protein of claim 1; (b2) an expression cassette containing the nucleic acid molecule described in (b1); (b3) a recombinant vector containing the nucleic acid molecule described in (b1) or a recombinant vector containing the expression cassette described in (b2); (b4) A recombinant microorganism containing the nucleic acid molecule described in (b1), a recombinant microorganism containing the expression cassette described in (b2), or a recombinant microorganism containing the recombinant vector described in (b3).

3. Use of the protein according to claim 1 or the gene encoding the protein according to claim 1 in regulating the disease resistance of plants to root rot.

4. Use of the protein according to claim 1 or the gene encoding the protein according to claim 1 in regulating plant resistance to Phytophthora.

5. Use of the protein-related biological material according to claim 2 in preparing transgenic plants with improved resistance to root rot.

6. Use of the protein-related biological material according to claim 2 in preparing transgenic plants with improved resistance to Phytophthora.

7. A method for cultivating transgenic plants with improved resistance to root rot, comprising the following steps: introducing a gene encoding the protein of claim 1 into a recipient plant to obtain a transgenic plant with improved resistance to root rot.

8. A method for cultivating a transgenic plant with improved resistance to Phytophthora, comprising the following steps: introducing a gene encoding the protein of claim 1 into a recipient plant to obtain a transgenic plant with improved resistance to Phytophthora.

9. A method for cultivating transgenic plants with improved resistance to root rot, comprising the following steps: mutating the gene encoding the MtAPK protein in the genomic DNA of the recipient plant into a gene encoding the protein of claim 1, thereby obtaining a transgenic plant with improved resistance to root rot; the MtAPK protein is the protein shown in SEQ ID NO:

1.

10. A method for cultivating transgenic plants with improved resistance to Phytophthora, comprising the following steps: mutating the gene encoding MtAPK protein in the genomic DNA of the recipient plant into a gene encoding the protein of claim 1, thereby obtaining a transgenic plant with improved resistance to Phytophthora; the MtAPK protein is the protein shown in SEQ ID NO: 1.

Images