Application of rice OsGH3.4 protein and coding gene thereof in regulation and control of plant growth and development

Abstract

The invention discloses application of a rice OsGH3.4 protein and a coding gene thereof in regulation and control of plant growth and development. The invention provides an application of an OsGH3.4 protein or an OsGH3.4 gene in regulating and controlling the fertility and / or the tillering number and / or the plant height of a plant. The invention also provides a method for cultivating the plant with reduced fertility and / or reduced tillering number and / or increased plant height, and the method comprises the following steps: inhibiting the expression of the OsGH3.4 gene in the receptor plant to obtain the plant with reduced fertility and / or reduced tillering number and / or increased plant height relative to the receptor plant. The invention provides a new thought and a potential target for rice molecular breeding and yield improvement.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the application of rice OsGH3.4 protein and its encoding gene in regulating plant growth and development. Background Art

[0002] Rice (Oryza sativa L.) is the main food source for more than half of the world's population, and its yield improvement is of great significance to global food security. Rice yield is affected by many factors, including plant architecture and floral organ development. Plant architecture is an important agronomic trait of rice and is closely related to yield, quality and stress resistance. Rice tillering is an important indicator of plant architecture research. It is formed at the unelongated basal internodes and grows independently from the mother stem (culm) through its own adventitious roots. Although the morphology and histology of rice tillers and some rice tillering mutants have been well described, the molecular mechanism of rice tillering remains to be elucidated. Tillering is the ability of rice plants to produce new branches from the base of the main stem, which can form additional panicles and thus increase yield. Tillering not only increases the number of leaves in rice plants, thereby expanding the area for photosynthesis, but also more leaves mean more photosynthetic products, which helps to increase biomass and ultimately yield. In addition, the development of floral organs directly affects the reproductive efficiency of rice. Normal floral organ development ensures effective pollination and fertilization, which are essential for seed formation and yield. Summary of the invention

[0003] The purpose of the present invention is to provide application of rice OsGH3.4 protein and its encoding gene in regulating plant growth and development.

[0004] The present invention provides an OsGH3.4 protein or OsGH3.4 The application of genes in regulating plant fertility and / or tillering number and / or plant height.

[0005] For fertility, the regulation is positive regulation.

[0006] Increased OsGH3.4 protein content increases plant fertility.

[0007] Reduced OsGH3.4 protein content reduces plant fertility.

[0008] OsGH3.4 Increased gene abundance leads to increased plant fertility.

[0009] OsGH3.4 Reduced gene abundance reduces plant fertility.

[0010] For the tillering number, the regulation is positive regulation.

[0011] The increase of OsGH3.4 protein content increased the number of plant tillers.

[0012] The reduction of OsGH3.4 protein content reduced the number of plant tillers.

[0013] OsGH3.4 Increased gene abundance leads to a higher number of tillers in plants.

[0014] OsGH3.4 Reduced gene abundance resulted in a decrease in tiller number.

[0015] For plant height, the regulation is negative regulation.

[0016] Increased OsGH3.4 protein content reduced plant height.

[0017] Reducing the OsGH3.4 protein content increases plant height.

[0018] OsGH3.4 Increased gene abundance reduced plant height.

[0019] OsGH3.4 Decreased gene abundance resulted in increased plant height.

[0020] The present invention also provides OsGH3.4 protein or OsGH3.4 The invention relates to the use of a gene as an inhibition target in plant breeding; the goal of the plant breeding is to cultivate plants with reduced fertility and / or reduced tillering number and / or increased plant height. The plant is a plant having OsGH3.4 Genetic plants.

[0021] The present invention also provides a substance or a substance that inhibits OsGH3.4 protein. OsGH3.4 The application of genetic material in plant breeding; the goal of plant breeding is to cultivate plants with reduced fertility and / or reduced tillering number and / or increased plant height. OsGH3.4 Genes can be specifically inhibited OsGH3.4 Gene expression. Inhibition OsGH3.4 The gene expression substance can be specifically: OsGH3.4 A gene editing vector with a gene as a target. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located at OsGH3.4 Specifically, the target of the sgRNA is: GGCGCAGTACATCCCGACAC. The plant has OsGH3.4 Genetic plants.

[0022] The present invention also provides a method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the following steps: homozygous mutation of a plant genomic DNA OsGH3.4The segment "ATGGCGCAGTACATCCCGACACTGGAGTTCTACGGC" in the gene is mutated into "ATGGCGCAGTACATCCCGATCACTGGAGTTCTACGGC". The plant has OsGH3.4 Plants with the same gene. Homozygous mutation means that the same mutation occurs on a pair of homologous chromosomes.

[0023] The present invention also provides a method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the following steps: OsGH3.4 Genes are edited to obtain gene-edited plants, and plants with reduced fertility and / or reduced tillering number and / or increased plant height compared to the recipient plant are screened from the gene-edited plants. The recipient plant is a plant having OsGH3.4 The gene editing is achieved by introducing a gene editing vector. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located at OsGH3.4 Specifically, the target of the sgRNA is: GGCGCAGTACATCCCGACAC.

[0024] The present invention also provides a method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the following steps: inhibiting OsGH3.4 Gene expression is inhibited to obtain plants with reduced fertility and / or reduced tillering number and / or increased plant height relative to the recipient plants. OsGH3.4 Gene expression can be specifically inhibited by introducing into the recipient plant OsGH3.4 Substances that inhibit gene expression. OsGH3.4 The gene expression substance can be specifically: OsGH3.4 A gene editing vector with a gene as a target. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located at OsGH3.4 In the gene. Specifically, the target of the sgRNA is: GGCGCAGTACATCCCGACAC. OsGH3.4 Gene expression is specifically achieved by introducing a gene editing vector. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located at OsGH3.4 In the gene. Specifically, the target of the sgRNA is: GGCGCAGTACATCCCGACAC. The recipient plant has OsGH3.4 Genetic plants.

[0025] The present invention also provides a method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the following steps: reducing the content of OsGH3.4 protein in the plant, thereby reducing the fertility of the plant and / or reducing the tillering number and / or increasing the plant height. The plant is OsGH3.4 Genetic plants.

[0026] Reducing rice fertility has important practical value in specific scenarios, especially in the fields of weed control, prevention of gene drift, hybrid seed production optimization and basic scientific research.

[0027] The present invention also provides the use of OsGH3.4 protein-related biological materials in cultivating transgenic plants with increased fertility and / or increased tillering number and / or reduced plant height. OsGH3.4 Genetic plants.

[0028] The present invention also provides a method for cultivating plants with increased fertility and / or increased tillering number and / or reduced plant height, comprising the following steps: introducing into a recipient plant OsGH3.4 Gene, resulting in a plant with increased fertility and / or increased tillering number and / or reduced plant height relative to the recipient plant. OsGH3.4 Genetic plants.

[0029] Any of the above OsGH3.4 proteins is as follows (a1) or (a2) or (a3) ​​or (a4): (a1) the protein shown in SEQ ID NO: 1; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) a protein related to plant fertility and / or tillering number and / or plant height obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1); (a4) A protein derived from rice that has 98% or more identity with (a1) and is related to plant fertility and / or tillering number and / or plant height.

[0030] The labels may be specifically shown in Table 1.

[0031] Table 1 Tag sequences

[0032] Any of the above OsGH3.4 The gene is a gene encoding the OsGH3.4 protein.

[0033] Said OsGH3.4 The gene is as follows (b1) or (b2) or (b3) or (b4) or (b5): (b1) a DNA molecule having a coding region as shown in SEQ ID NO: 2; (b2) the DNA molecule shown at positions 254 to 2233 of SEQ ID NO: 3; (b3) a DNA molecule represented by SEQ ID NO: 3; (b4) a DNA molecule derived from rice and having 95% or more identity with (b1) or (b2) or (b3) and encoding the protein; (b5) A DNA molecule that hybridizes to the nucleotide sequence defined in (b1) or (b2) or (b3) under stringent conditions and encodes the protein.

[0034] The stringent conditions mentioned above may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0035] The OsGH3.4 protein-related biological material is any one of the following (c1) to (c4): (c1) a nucleic acid molecule encoding an OsGH3.4 protein; (c2) an expression cassette containing the nucleic acid molecule described in (c1); (c3) a recombinant vector containing the nucleic acid molecule described in (c1) or a recombinant vector containing the expression cassette described in (c2); (c4) A recombinant microorganism containing the nucleic acid molecule described in (c1), a recombinant microorganism containing the expression cassette described in (c2), or a recombinant microorganism containing the recombinant vector described in (c3).

[0036] The nucleic acid molecule encoding the OsGH3.4 protein may specifically be OsGH3.4 Gene.

[0037] The recombinant vector may specifically be a recombinant expression vector.

[0038] Any of the above recombinant expression vectors can be specifically obtained by inserting the double-stranded DNA shown in SEQ ID NO: 4 into the multiple cloning site (e.g. Kpn I and XB I restriction site) to obtain the recombinant plasmid.

[0039] Any of the above mentioned fertility is manifested as fruit setting rate.

[0040] Any of the above-mentioned reductions in fertility are manifested as a reduction in the fruit set rate.

[0041] Any of the above-mentioned increased fertility is manifested as an increase in fruit set rate.

[0042] Any of the above plants may be monocots or dicots.

[0043] Any of the above plants may be a plant of the Poaceae family.

[0044] Any of the above plants may be a rice plant.

[0045] Specifically, any of the above plants can be rice.

[0046] Specifically, any one of the above plants can be rice Zhonghua No. 11.

[0047] The inventors of the present invention found that OsGH3.4 is not only involved in stamen development, but may also have a wide range of effects on the overall growth and development of rice, especially in the formation of tiller buds at the elongated nodes of rice, suggesting that OsGH3.4 may affect the growth and development of lateral buds by regulating auxin signals. This discovery provides new ideas and potential targets for rice molecular breeding and yield improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 Schematic diagram of the elements of the pCBSG032 vector.

[0049] Figure 2 for osgh3.4 Figure 2. Sequencing results of mutant strains.

[0050] Figure 3 Schematic diagram of the elements of the pCAMBIA2300 vector.

[0051] Figure 4 It is the floral organ and the floral organ anatomical diagram in Example 4.

[0052] Figure 5 This is a scanning electron microscope image of the stamen in Example 4.

[0053] Figure 6 This is a photograph of pollen stained with the I2-KI solution in Example 4.

[0054] Figure 7 For Example 4 OsGH3.4 Relative gene expression results.

[0055] Figure 8 These are photos of plants, spikelets, and tillering nodes at the heading stage in Example 5.

[0056] Fig. 9 These are the results of the fruit set rate, plant height, tiller number and ear number in Example 5. DETAILED DESCRIPTION

[0057] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0058] The experimental methods in the following examples are conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified. Unless otherwise specified, the quantitative tests in the following examples are repeated three times, and the results are averaged. Fruiting rate = number of full seeds ÷ (number of full seeds + number of empty seeds) × 100%.

[0059] pCBSG032 vector (elements schematic see Figure 1 ): Weimi Biotechnology Co., Ltd. The pCBSG032 vector is described in the following literature: Tian Y, Zhong D, Li X, Shen R, Han H, Dai Y, Yao Q, Zhang X, Deng Q, Cao X, Zhu JK, Lu Y. High-throughput genome editing in rice with avirus-based surrogate system. J Integr Plant Biol. 2022 Oct 11. doi: 10.1111 / jipb.13381. Epub ahead of print. PMID: 36218268.

[0060] Zhonghua No. 11 was cultivated by the Crop Research Institute of the Chinese Academy of Agricultural Sciences in 1979 using Jingfeng No. 5 / Tetepu / Fujin. Zhonghua No. 11 is recorded in the following document: Ni Pichong. New Rice Variety Cultivated by Flower Culture—Zhonghua No. 11. Crop Variety Resources, Issue 04, 1989. Rice Zhonghua No. 11 plants are also called wild-type plants, denoted by WT.

[0061] The formula of N6 basic medium is shown in Table 2.

[0062] Table 2

[0063] Callus induction medium (pH 5.8): On the basis of N6 basic medium, inositol (to make its concentration in the medium 100 mg / L), 2,4-D (to make its concentration in the medium 2 mg / L), proline (to make its concentration in the medium 2.878 g / L), enzymatic hydrolyzed casein (to make its concentration in the medium 300 mg / L), sucrose (to make its concentration in the medium 30 g / L) and phytogel (to make its concentration in the medium 2.6 g / L) were added.

[0064] Co-culture medium (pH 5.2): On the basis of N6 basic medium, acetosyringone (to make its concentration in the medium 100µM), glucose (to make its concentration in the medium 10g / L) and phytagel (to make its concentration in the medium 2.6g / L) were added.

[0065] Screening medium (pH 5.8): On the basis of N6 basic medium, hydrolyzed casein (to make its concentration in the medium 500 mg / L), 2,4-D (to make its concentration in the medium 2 mg / L), proline (to make its concentration in the medium 2.8 g / L), sucrose (to make its concentration in the medium 30 g / L), G418 (to make its concentration in the medium 150 mg / L), cephalosporin (to make its concentration in the medium 500 mg / L) and plant gel (to make its concentration in the medium 2.6 g / L) were added.

[0066] Differentiation medium (pH 5.8): On the basis of N6 basic medium, add kinetin (to make its concentration in the medium 2 mg / L), NAA (to make its concentration in the medium 0.02 mg / L), sucrose (to make its concentration in the medium 30 g / L), sorbitol (to make its concentration in the medium 30 g / L), acid hydrolyzed casein (to make its concentration in the medium 2 g / L) and phytagel (to make its concentration in the medium 2.6 g / L).

[0067] Rooting medium (pH 5.8): contains 1 / 4 concentration of MS inorganic salt, 1× concentration of MS vitamin, 0.5 mg / L NAA, 1 mg / L paclobutrazol, 2.6 g / L plant gel, and the rest is water.

[0068] The formula of AAM infection solution (pH 5.2) is shown in Table 3.

[0069] Table 3

[0070] Example 1. Discovery of proteins and genes In previous experiments, it was found that OsGH3.4 protein was specifically and highly expressed in rice stamens, indicating its potential role in the development of floral organs.

[0071] Sequencing confirmed that the genomic DNA of rice Zhonghua No. 11 contained the DNA segment shown in SEQ ID NO: 3, and the cDNA of rice Zhonghua No. 11 contained the DNA segment shown in SEQ ID NO: 2, encoding the OsGH3.4 protein shown in SEQ ID NO: 1.

[0072] Example 2: Preparation of mutant plants In this example, rice Zhonghua No. 11 was used as the starting plant to prepare CRISPR / Cas9-mediated OsGH3.4 Site-directed gene editing plants with target genes.

[0073] 1. Preparation of recombinant plasmid The target sequence selected was: GGCGCAGTACATCCCGACAC.

[0074] 1. Prepare single-stranded DNA molecules F and R, and then anneal them to obtain double-stranded DNA molecules with sticky ends.

[0075] F: ggcaGGCGCAGTACATCCCGACAC; R:aaacGTGTCGGGATGTACTGCGCC.

[0076] 2. Take the pCBSG032 vector and use restriction endonuclease Bsa I was used for enzyme digestion to recover the vector backbone (i.e., a large linear fragment of about 1.6 kb).

[0077] 3. The double-stranded DNA molecule with sticky ends obtained in step 1 is connected to the vector backbone obtained in step 2 to obtain a recombinant plasmid, which is the gene editing vector. The gene editing vector has been sequenced and verified.

[0078] 2. Preparation of mutant plants using CRSPR / Cas9 technology 1. Callus induction and subculture Take mature seeds of rice Zhonghua No. 11, peel off the husks, disinfect with 75% ethanol solution for 1 minute, then rinse with sterile water, then disinfect with 30% sodium hypochlorite solution for 20 minutes, then wash with sterile water, use sterile filter paper to absorb the moisture on the surface of the seeds, and then transfer the seeds to callus induction medium for culture to obtain callus tissue for Agrobacterium infection.

[0079] 2. Preparation of Agrobacterium suspension The gene editing vector prepared in step 1 was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium. The recombinant Agrobacterium was cultured and the cells were collected and suspended with AAM infection solution to obtain OD 600nm The value is 0.3-0.5 for Agrobacterium suspension.

[0080] 3. Agrobacterium infection Take the callus obtained in step 1, immerse it in the Agrobacterium suspension prepared in step 2, and infect it at room temperature for 20 minutes (shake it from time to time), then take out the callus, absorb the excess bacterial solution with sterile filter paper, and then transfer it to the co-cultivation medium covered with a layer of sterile filter paper, and culture it in the dark at 26°C for 3 days.

[0081] 4. Screening and cultivation After completing step 3, take the callus tissue, rinse it twice with sterile water, then rinse it once with carbenicillin solution, remove excess water with a pipette, transfer it to sterile filter paper, air-dry the surface moisture on a clean bench, and then transfer it to a screening medium containing hygromycin. Culture it in the dark at 28-30℃ for 3-4 weeks. At this time, positive calli with bright yellow color and 1-2 mm diameter can be observed.

[0082] 5. Differentiation and regeneration Take the positive callus obtained in step 4, transfer it to the differentiation medium, and culture it at 28-30℃ with alternating light and dark conditions (16h light / 8h dark). After about 10 days of culture, green spots can be observed on the callus, and seedlings will differentiate after another 10 days of culture. Culture until the differentiated seedlings are 2-3cm tall.

[0083] 6. Rooting Take the seedlings obtained in step 5, transfer them to the rooting medium, and culture them at 28-30°C with alternating light and dark conditions (16h light / 8h dark). The rooted seedlings are the T0 generation plants.

[0084] 3. Identification of Mutation Forms The T0 generation plants obtained in step 2 are self-pollinated and seeds are harvested, and the seeds are cultivated into plants, namely the T1 generation plants.

[0085] The leaves of T1 plants were taken to extract genomic DNA, and PCR amplification was performed using the primer pair consisting of GP4137-3347-F and GP4137-3347-R, and then the amplified products were recovered and sequenced. Mutants were screened based on the sequencing results.

[0086] GP4137-3347-F: GGGAGGAACTCGAAGTAGCAC; GP4137-3347-R:CATGTACGCGCAGCTCATC.

[0087] A homozygous mutant strain was screened from the T1 generation plants and named osgh3.4 Mutant strain.

[0088] Compared with the genomic DNA of wild-type plants, osgh3.4 The genomic DNA of the mutant OsGH3.4 A nucleotide T was inserted into the coding region of the gene (i.e., the following mutation occurred in both homologous chromosomes: from "ATGGCGCAGTACATCCCGACACTGGAGTTCTACGGC" to "ATGGCGCAGTACATCCCGATCACTGGAGTTCTACGGC"), causing a frame shift and failure to translate normal protein. Sequencing results are shown in Figure 2 .

[0089] Example 3: Preparation of complementary plants 1. Preparation of recombinant plasmid The double-stranded DNA shown in SEQ ID NO: 4 was inserted into the pCAMBIA2300 vector (see the schematic diagram of the elements of the pCAMBIA2300 vector for details). Figure 3 )of Kpn I and XB I restriction enzyme cutting site to obtain a recombinant plasmid. The recombinant plasmid has been sequenced and verified.

[0090] 2. Preparation of complementary plants The obtained osgh3.4 The mature seeds obtained by self-pollination of the mutant strain replaced the mature seeds of rice Zhonghua No. 11, the recombinant plasmid prepared in step 1 replaced the gene editing vector, and the screening medium containing kanamycin replaced the screening medium containing hygromycin. The rest was the same as step 2 of Example 2.

[0091] 3. Screening of homozygous transgenic plants The T0 generation plants obtained in step 2 are self-pollinated and seeds are harvested, and the seeds are cultivated into plants, namely the T1 generation plants.

[0092] Transgenic plants are selected from the T1 generation plants, namely the T1 generation transgenic plants.

[0093] The T1 generation transgenic plants are self-pollinated and seeds are harvested, and the seeds are cultivated into plants, namely the T2 generation plants.

[0094] For a certain T1 generation transgenic plant, if all T2 generation plants obtained by self-pollination are transgenic plants, the T1 generation transgenic plant is a homozygous transgenic plant, and all self-pollinated offspring of the plant are homozygous transgenic plants.

[0095] Method for screening or identifying transgenic plants: Take leaves of the plant, extract genomic DNA, and use a primer pair consisting of GP2300KanF and GP2300KanR (primers target the kanamycin resistance gene on the vector, and the target fragment is 328bp) for PCR amplification. If an amplification product of the expected size is obtained, the plant is a transgenic plant.

[0096] GP2300KanF: TGTCATACCACTTGTCCGCC; GP2300KanR: ATCGAGCTGTATGCGGAGTG.

[0097] Example 4, wild-type plants and osgh3.4 Comparison of traits of offspring plants of mutant strains Seeds for testing: wild-type plant seeds, seeds obtained in Example 2 osgh3.4 Seeds obtained from self-pollination of mutant strains.

[0098] The test seeds were sown and cultured until they emerged, and then transferred to the fields in the suburbs of Beijing for normal cultivation and management.

[0099] During the flowering period, the floral organs were dissected and the stamens were observed using a scanning electron microscope. The floral organs and floral organ dissection diagrams are shown in Figure 4 . SEM images of stamens are shown in Figure 5 . Figure 4 and Figure 5 In the table, WT represents wild-type plants. osgh3.4 represent osgh3.4 Descendant plants of the mutant strain. osgh3.4 In the offspring plants of the mutant strain, some floral organs developed abnormally, and 34% of the florets had an organ similar to a lemma in addition to the inner and outer palea. osgh3.4 The stamens of the mutant offspring plants developed abnormally, especially the adaxial anther cells were obviously collapsed.

[0100] During the flowering period, small flowers in the pollen stage were taken and dissected under a stereoscope to obtain anthers. I2-KI solution (I2-KI dye solution: 0.5g KI was dissolved in 1.25mL deionized water, 0.25g iodine tablets were added, and then diluted to 75mL, and stored in the dark) was added. The anthers were quickly crushed to release pollen, and the pollen was observed under a microscope and photographed. See photos for details. Figure 6 (WT represents wild-type plants, osgh3.4 represent osgh3.4 The wild-type plants have normal pollen fertility. osgh3.4 The mutant's offspring plants had only a small amount of fertile pollen.

[0101] During the culture process, different parts were taken and tested. OsGH3.4 The relative expression of genes. Figure 7(Orange represents wild-type plants, and blue represents mutant offspring plants). Figure 7 Middle: R7 represents the young root 7 days after germination; L8 represents the 8th leaf (reproductive leaf), L3 represents the 3rd leaf (vegetative leaf), S represents the stem, P1-2 represents 1-2 cm spikelets, P3-4 represents 3-4 cm spikelets, and P5-6 represents 5-6 cm spikelets. osgh3.4 The leaves and spikelets of the mutant offspring plants OsGH3.4 Gene expression is severely suppressed.

[0102] Example 5, wild-type plants and osgh3.4 Comparison of the characteristics of the offspring plants of the mutant strain and the complement plants Seeds for testing: wild-type plant seeds, seeds obtained in Example 2 osgh3.4 Seeds obtained by self-pollination of the mutant strain, and seeds obtained by self-pollination of the T1 generation homozygous transgenic plants obtained in Example 3.

[0103] The test seeds were sown and cultured until they emerged, and then transferred to the fields in the suburbs of Beijing for normal cultivation and management.

[0104] Phenotypic photos of plants at heading stage are shown in Figure 8 The phenotypic photos of spikelets are shown in Figure 8 The phenotypic photos of tillering nodes are shown in Figure 8 Right picture. Figure 8 In the table, WT represents the wild-type plant. osgh3.4 express osgh3.4 The offspring plants of the mutant OsGH3.4oE / osgh3.4 It represents the offspring plants of the T1 generation homozygous transgenic plants.

[0105] At maturity, the fruit setting rate, plant height, tillering number and number of grains per ear were detected and counted. Fig. 9 (Sample size N=10). Fig. 9 In the table, WT represents the wild-type plant. osgh3.4 express osgh3.4 The offspring plants of the mutant OsGH3.4oE It represents the offspring plants of the T1 generation homozygous transgenic plants (the offspring plants of the complemented plants).

[0106] In the seedling stage, there is no obvious difference in the morphology of each plant. osgh3.4 The growth rate of the offspring plants of the mutant strain was significantly higher than that of the wild-type plants. osgh3.4 The height of the offspring of the mutant strain increased by 25.4%. At maturity, the wild-type plants hardly produced tillers at the elongation nodes, while osgh3.4 The offspring of the mutant continued to produce new tillers at each elongation node ( Figure 8 Compared with the wild-type plants, osgh3.4 The mutant offspring produced fewer tillers, with the number of tillers reduced by 35% compared to wild-type plants. osgh3.4 The fruiting rate of the mutant offspring plants was significantly reduced to only 22.51%. There was no significant difference in the above phenotypes between the offspring plants of the complemented plants and the wild-type plants. This indicates that the phenotypic differences of the mutant plants relative to the wild-type plants are due to OsGH3.4 Caused by inactivation of gene function.

[0107] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. OsGH3.4 protein or OsGH3.4 Application of genes in regulating plant fertility and / or tillering number and / or plant height; The OsGH3.4 protein is as follows (a1) or (a2) or (a3) ​​or (a4): (a1) the protein shown in SEQ ID NO: 1; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) a protein related to plant fertility and / or tillering number and / or plant height obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1); (a4) a protein derived from rice that has more than 98% identity with (a1) and is associated with plant fertility and / or tillering number and / or plant height; Said OsGH3.4 The gene is a gene encoding the OsGH3.4 protein.

2. The use according to claim 1, characterized in that: Said OsGH3.4 The gene is as follows (b1) or (b2) or (b3) or (b4) or (b5): (b1) a DNA molecule having a coding region as shown in SEQ ID NO: 2; (b2) the DNA molecule shown at positions 254 to 2233 of SEQ ID NO: 3; (b3) a DNA molecule represented by SEQ ID NO: 3; (b4) a DNA molecule derived from rice and having 95% or more identity with (b1) or (b2) or (b3) and encoding the protein; (b5) A DNA molecule that hybridizes to the nucleotide sequence defined in (b1) or (b2) or (b3) under stringent conditions and encodes the protein.

3. OsGH3.4 protein or OsGH3.4 The invention relates to an application of a gene as an inhibition target in plant breeding; the goal of the plant breeding is to cultivate plants with reduced fertility and / or reduced tillering number and / or increased plant height; the OsGH3.4 protein is the OsGH3.4 protein described in claim 1; OsGH3.4 The gene is as described in claim 1 or 2 OsGH3.4 Gene.

4. Substances that inhibit OsGH3.4 protein or OsGH3.4 The invention relates to an application of a gene material in plant breeding; the goal of the plant breeding is to cultivate plants with reduced fertility and / or reduced tillering number and / or increased plant height; the OsGH3.4 protein is the OsGH3.4 protein described in claim 1; OsGH3.4 The gene is as described in claim 1 or 2 OsGH3.4 Gene.

5. A method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the steps of: homozygous mutation of a plant genomic DNA OsGH3.4 The segment "ATGGCGCAGTACATCCCGACACTGGAGTTCTACGGC" in the gene is mutated into "ATGGCGCAGTACATCCCGATCACTGGAGTTCTACGGC"; OsGH3.4 The gene is as described in claim 1 or 2 OsGH3.4 Gene.

6. A method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the steps of: OsGH3.4 Genes are edited to obtain gene-edited plants, and plants with reduced fertility and / or reduced tillering number and / or increased plant height relative to the recipient plant are screened from the gene-edited plants; OsGH3.4 The gene is as described in claim 1 or 2 OsGH3.4 Gene.

7. A method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the steps of: inhibiting OsGH3.4 Gene expression results in plants with reduced fertility and / or reduced tillering number and / or increased plant height relative to the recipient plant; OsGH3.4 The gene is as described in claim 1 or 2 OsGH3.4 Gene.

8. A method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the following steps: reducing the fertility of the plant and / or reducing the tillering number and / or increasing the plant height by reducing the content of OsGH3.4 protein in the plant; the OsGH3.4 protein is the OsGH3.4 protein described in claim 1.

9. Application of OsGH3.4 protein-related biological materials in cultivating transgenic plants with increased fertility and / or increased tillering number and / or reduced plant height; The OsGH3.4 protein-related biological material is any one of the following (c1) to (c4): (c1) a nucleic acid molecule encoding an OsGH3.4 protein; (c2) an expression cassette containing the nucleic acid molecule described in (c1); (c3) a recombinant vector containing the nucleic acid molecule described in (c1) or a recombinant vector containing the expression cassette described in (c2); (c4) a recombinant microorganism containing the nucleic acid molecule described in (c1), a recombinant microorganism containing the expression cassette described in (c2), or a recombinant microorganism containing the recombinant vector described in (c3); The OsGH3.4 protein is the OsGH3.4 protein described in claim 1.

10. A method for cultivating plants with increased fertility and / or increased tillering number and / or reduced plant height, comprising the steps of: introducing into a recipient plant OsGH3.4 Gene, resulting in a plant with increased fertility and / or increased tillering number and / or reduced plant height relative to the recipient plant; OsGH3.4 The gene is as described in claim 1 or 2 OsGH3.4 Gene.

Images