Application of heat stress resistance related protein OsDNAJL1 or substance for regulating expression of heat stress resistance related protein OsDNAJL1

Abstract

The invention discloses application of a heat stress resistance related protein OsDNAJL1 or a substance for regulating expression of the heat stress resistance related protein OsDNAJL1. The invention belongs to the technical field of biology, and relates to application of a heat stress resistance related protein OsDNAJL1 or a substance for regulating expression of the heat stress resistance related protein OsDNAJL1. The protein OsDNAJL1 disclosed by the invention is as follows: A1) an amino acid sequence as shown in SEQ ID No: 1; a2) a protein which is obtained by substitution and / or deletion and / or addition of amino acid residues on the protein of A1), has 75% or more of identity with the protein of A1) and has the same function as the protein of A1); a3) a fusion protein obtained by connecting a protein tag to the N terminal or / and the C terminal of A1) or A2). After the OsDNAJL1 gene is subjected to gene knockout, an osdnajl1 knockout mutant subjected to heat stress treatment has a high-temperature-resistant phenotype, which indicates that the OsDNAJL1 gene plays an important role in regulating and controlling the heat resistance of rice.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to application of a heat stress resistance-related protein OsDNAJL1 or a substance for regulating the expression thereof. Background Art

[0002] During the growth cycle of rice, it is subject to a variety of abiotic stresses, such as high salt, high temperature, drought and cold damage. With the frequent occurrence of extreme temperatures due to global climate change, temperature stress is an important factor affecting crop yields and threatening food security.

[0003] DNA N6-methyladenosine (6mA) can regulate DNA replication, transcription, and participate in stress response. Studies have shown that DNA 6mA plays an important role in regulating embryonic development, cell differentiation, and organ development; it can also regulate the stress response of animals and plants caused by changes in the external environment. Studies have found that DNA 6mA shows dynamic changes during rice development, indicating that it plays an important role in plant development. At the same time, the modification level of DNA 6mA will also change when plants respond to stress. The above studies show that DNA 6mA can not only regulate the development and stress response of mammals; it can also participate in the growth and development of rice and the high temperature response process. Therefore, identifying the methyltransferase, demethyltransferase, and recognition protein of DNA 6mA in plants and studying the function of regulating plant development and stress response is of great value for the targeted improvement of crop yield and stress resistance using molecular breeding methods. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to regulate the heat stress resistance of plants.

[0005] In order to solve the problems existing in the prior art, the present invention provides a protein.

[0006] The protein provided by the present invention may be any of the following proteins: A1) a protein with an amino acid sequence as shown in SEQ ID No: 1; A2) a protein having more than 75% identity with the protein shown in A1) and having the function of regulating plant heat stress resistance obtained by replacing and / or deleting and / or adding amino acid residues of the protein shown in A1); for example, a person skilled in the art can obtain a protein mutant having the same function as the amino acid sequence shown in SEQ ID No: 1 by replacing, deleting and / or adding one or more amino acids without affecting its activity according to the amino acid sequence shown in SEQ ID No: 1 and conventional technical means in the art such as conservative substitution of amino acids; Those skilled in the art can easily mutate the nucleotide sequence encoding the protein OsDNAJL1 of the present invention by using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 75% or more identity with the nucleotide sequence of the protein OsDNAJL1 isolated by the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein OsDNAJL1 and have the function of the protein OsDNAJL1.

[0007] The above-mentioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0008] A3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1) or A2).

[0009] The protein described in A1) above is called OsDNAJL1. The OsDNAJL1 protein consists of 603 amino acids.

[0010] In order to facilitate purification or detection of the protein in A1), a tag protein may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No: 1 in the sequence listing.

[0011] The tag protein includes but is not limited to: GST (glutathione sulfhydryltransferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0012] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0013] Herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence or a nucleotide sequence can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and searching for a pair of amino acid sequences or nucleotide sequences to calculate the identity, then the value (%) of the identity can be obtained.

[0014] Herein, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0015] Herein, the 90% or greater identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0016] In the above, the protein is derived from rice ( Oryza sativa L.).

[0017] The present invention also provides a biological material related to the above protein, and the biological material may be any one of the following: B1) a nucleic acid molecule encoding the protein described above; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2); B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) a transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2); C1) a nucleic acid molecule that inhibits, reduces or silences the expression of the gene encoding the protein mentioned above; C2) expressing a gene encoding the nucleic acid molecule described in C1); C3) an expression cassette containing the coding gene described in C2); C4) a recombinant vector containing the coding gene described in C2) or a recombinant vector containing the expression cassette described in C3); C5) a recombinant microorganism containing the coding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4); C6) a transgenic plant cell line containing the coding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4); C7) transgenic plant tissue containing the coding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4); C8) A transgenic plant organ containing the coding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0018] In the above biological material, the nucleic acid molecule described in B1) may be the gene shown in E1) or E2) below: E1) a cDNA molecule or a DNA molecule whose coding sequence is SEQ ID No: 2; E2) The nucleotide sequence is a cDNA molecule or a DNA molecule of SEQ ID No: 3.

[0019] DNA molecule shown in SEQ ID No:2 (regulating plant heat stress resistance) OsDNAJL1 Gene) encodes the protein OsDNAJL1 whose amino acid sequence is SEQ ID No: 1.

[0020] The nucleotide sequence shown in SEQ ID No: 2 is the nucleotide sequence of the protein OsDNAJL1 encoding gene (CDS).

[0021] The present invention OsDNAJL1 The gene may be any nucleotide sequence capable of encoding the protein OsDNAJL1. Considering the degeneracy of codons and the preference of codons of different species, those skilled in the art may use codons suitable for expression of a specific species as required.

[0022] B1) The nucleic acid molecule may also include a nucleic acid molecule obtained by modifying the codon preference based on the nucleotide sequence shown in SEQ ID No: 2.

[0023] B1) The nucleic acid molecule may also include a nucleic acid molecule having a nucleotide sequence identity of more than 95% with the nucleotide sequence shown in SEQ ID No: 2 and derived from the same species.

[0024] The nucleic acid molecule described herein can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0025] The vectors described herein are well known to those skilled in the art, including but not limited to: plasmids, bacteriophages (such as lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), Ti plasmids or viral vectors.

[0026] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.) or chemical agent resistance marker genes (such as herbicide resistance genes), etc. Considering the safety of transgenic plants, no selective marker genes can be added, and transformed plants can be directly screened by adversity.

[0027] The microorganism described herein may be yeast, bacteria, algae or fungi. Among them, the bacteria may be from the genus Escherichia ( Escherichia ), Erwinia ( Erwinia ), Agrobacterium tumefaciens ( Agrobacterium ), Flavobacterium ( Flavobacterium ), Alcaligenes spp. Alcaligenes ), Pseudomonas spp. ( Pseudomonas ), Bacillus spp. ( Bacillus ) etc. Specifically, it can be Agrobacterium tumefaciens EHA105.

[0028] The present invention also provides the use of the above-mentioned protein OsDNAJL1 or a substance regulating the expression of a gene or a substance regulating the activity or content of the protein in any of the following: U1) Application in regulating plant heat stress resistance; U2) Application in the preparation of products for regulating plant heat stress resistance; U3) Application in breeding plants with enhanced resistance to heat stress; U4) Use in the preparation of products for breeding plants with enhanced resistance to heat stress; U5) Application in plant breeding.

[0029] Herein, the substance that regulates the activity and / or content of the protein may be a substance that regulates the expression of a gene, wherein the gene encodes the protein OsDNAJL1.

[0030] In the above application, the substance that regulates the expression of the gene or the substance that regulates the activity or content of the protein may be a biological material related to the protein, and the biological material may be the biological material described above.

[0031] The present invention also provides a method for regulating plant heat stress resistance, comprising regulating the activity and / or content of the above-mentioned protein in the target plant, or / and the expression level of the gene encoding the protein, to regulate the plant heat stress resistance.

[0032] In the above method, the regulation of the activity and / or content of the protein OsDNAJL1 in the target plant, or / and the expression level of the gene encoding the protein, comprises introducing into the recipient plant a gene encoding the protein OsDNAJL1 The substance is used to obtain a target plant with changed heat stress resistance; OsDNAJL1 The gene encoding the protein OsDNAJL1.

[0033] In the above-mentioned applications and methods, the regulation may be increasing, enhancing or up-regulating.

[0034] In the above-mentioned uses and methods, the regulation may be inhibition, reduction or silencing.

[0035] The present invention also provides a method for cultivating plants with altered heat stress resistance, comprising: 1) inhibiting, reducing or silencing the expression level of the gene encoding the protein mentioned above in the target plant, or / and inhibiting, reducing or silencing the activity and / or content of the gene encoding the protein mentioned above, to obtain plants with enhanced heat stress resistance; 2) Increasing, enhancing or up-regulating the expression level of the gene encoding the protein mentioned above in the target plant, or / and increasing, enhancing or up-regulating the activity and / or content of the gene encoding the protein mentioned above to obtain a plant with reduced heat stress resistance.

[0036] In a specific embodiment, a method for cultivating a plant with enhanced heat stress resistance comprises the following steps: inhibiting the expression of a nucleic acid molecule encoding an OsDNAJL1 protein in a target plant to obtain a transgenic plant with enhanced heat stress resistance. The inhibiting the expression of a nucleic acid molecule encoding an OsDNAJL1 protein in a target plant can be achieved by introducing an interference vector or a knockout vector targeting a nucleic acid molecule encoding an OsDNAJL1 protein into the target plant.

[0037] In the present invention, the knockout can be achieved by the CRISPR / Cas9 system.

[0038] In the present invention, the knockout of the coding gene of the protein in the target rice may be to perform at least one of the following mutations on the coding gene of the protein shown in Sequence 1 in the rice genome: 1) replacing 5'-TGCACCAAGCCCTGCTCCGCCGATGAT -3' in the gene encoding the protein in rice genomic DNA with 5'-TGCACCAAGCCCTGCTCCGCCGTATGAT -3', thereby knocking out the gene encoding OsDNAJL1 protein; 2) Replacing 5'TGCACCAAGCCCTGCTCCGCCGATGAT -3' in the gene encoding the protein in rice genomic DNA with 5'-TGCACTAT -3', thereby knocking out the gene encoding OsDNAJL1 protein.

[0039] In the present invention, the purpose of plant breeding includes cultivating plants with enhanced / weakened heat stress resistance.

[0040] In the present invention, the enhanced heat stress resistance can be manifested in that after heat stress treatment, the growth performance of the mutant plant is better than that of the control plant, and the growth performance can specifically be the survival rate.

[0041] The heat stress treatment condition is: culturing in a 45° C. incubator for 48 hours.

[0042] In the above application or method, the plant is any one of the following: N1) monocots or dicots; N2) Gramineae; N3) Gramineae; N4) Oryza plants; N5) Rice.

[0043] Will OsDNAJL1 After the gene was knocked out by CRISPR gene editing, compared with the recipient rice Nip, the osdnajl1 The knockout mutant showed a high temperature tolerance phenotype, indicating OsDNAJL1 Genes play an important role in regulating rice resistance to heat stress and are of great significance for breeding high temperature resistant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Recombinant plasmid SG2027 -Osdnajl1 Schematic diagram of the structure.

[0045] Figure 2 The nucleotide sequence of the mutation site and its surrounding nucleotides.

[0046] Figure 3It is a phenotype diagram of key agronomic shapes of rice. Osdnajl1 and Osdnajl1 Plant height comparison chart; B, Nip, Osdnajl1 and Osdnajl1 Tillering comparison chart; C, Nip, Osdnajl1 and Osdnajl1 Comparison of ear phenotypes.

[0047] Figure 4 It is a statistical chart of key agronomic shapes of rice. A, rice Nip, mutant strain OsDNAJL1-1 and OsDNAJL1-2 Plant height; B, rice Nip, mutant OsDNAJL1-1 and OsDNAJL1-2 Tillering number of strains; C, rice Nip, mutant strains OsDNAJL1-1 and OsDNAJL1-2 Panicle length of strains; D, rice Nip, mutant strains OsDNAJL1-1 and OsDNAJL1-2 Number of primary branches of strains; E, rice Nip, mutant strains OsDNAJL1-1 and OsDNAJL1-2 Number of secondary branches per plant.

[0048] Figure 5 Statistics of phenotypes and survival rates in heat stress experiments. Figure 5 A in the middle is the growth status of the tested plant at the three-leaf stage (time point A). Figure 5 The growth status of the plants to be tested in B was transferred to a 45°C incubator and cultured for 48 hours (time point B). Figure 5 The growth status of the plants tested in C after being heat treated at 45°C and transferred back to the greenhouse and continued to be cultured for 7 days (time point C). The survival rate results are shown in Figure 5 Middle D.

[0049] Figure 6 for Dot blot Results of detecting the abundance of DNA 6mA modification. DETAILED DESCRIPTION

[0050] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0051] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0052] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0053] The pSG2027 vector in the following examples has been recorded in Zhang Q, Liang Z, Cui X, et al. N6-methyladenine DNA methylation in Japonica and Indica rice genomes and its association with gene expression, plant development, and stress responses. Molecular Plant, 2018, 11(12): 1492-1508. The public can obtain the biological material from the applicant. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0054] The Nipponbare in the following examples has been recorded in: National Rice Data Center, website: https: / / www.ricedata.cn / . The public can obtain the biological material from the applicant, and the biological material is only used to repeat the experiment of the present invention and cannot be used for other purposes.

[0055] The following examples use EXCEL software to perform statistical analysis of data, and SPASS software to perform multiple difference comparisons of data.

[0056] Example 1, rice OsDNAJL1 Acquisition of genes DNA from the leaves of the rice variety Nipponbare was extracted and used as a template. OsDNAJ- F: 5'-ATGGCGGTGTCCTCGCCGG-3'; OsDNAJL1- R: 5'-TCAGCAGCTCATCGCCTCGC-3' was amplified by PCR using Phanta® MaxSuper-Fidelity DNA Polymerase (Cat. No.: P505-d1, Vazyme) to obtain the amplified product (i.e. OsDNAJL1 coding region of a gene). OsDNAJL1 The coding sequence (CDS) of the gene in the rice variety Nipponbare is SEQ ID No: 2, and the encoded amino acid sequence is the OsDNAJL1 protein of SEQ ID No: 1. In the genomic DNA of the rice variety Nipponbare, the genomic gene encoding the OsDNAJL1 protein is shown in SEQ ID No: 3 of the sequence table, and the 394-447th position of SEQ ID No: 3 is the first exon, and the 583-2340th position is the second exon.

[0057] Example 2: Construction for knockout OsDNAJL1 Recombinant plasmid pSG2027 -OsDNAJL1 Recombinant plasmid pSG2027 -OsDNAJL1 The structural diagram is as follows Figure 1 . Recombinant plasmid pSG2027 -OsDNAJL1 The nucleotide sequence is SEQ ID No: 4 in the sequence listing. - OsDNAJL1 Expression targeting OsDNAJL1 The target sequence of the sgRNA for the gene is: 5'-CCGATGATACCTCCTCTTCC-3' (SEQ ID No: 5). The target site of the sgRNA is located at OsDNAJL1 The second exon of the gene, the nucleotide sequence of the target of the sgRNA is 839-858 of SEQ ID No: 3 or corresponds to 311-330 of SEQ ID No: 2.

[0058] Embodiment 3, OsDNAJL1 Obtaining and identifying gene knockout rice 1. OsDNAJL1 Obtaining gene knockout rice The recombinant plasmid pSG2027 obtained in Example 2 -OsDNAJL1 Agrobacterium tumefaciens EHA105 (Shanghai Biotech Co., Ltd., Catalog No.: B528432-0010) was introduced to obtain recombinant Agrobacterium. The recombinant Agrobacterium was used to genetically transform embryonic callus of rice Nipponbare by Agrobacterium infection method, and then resistant callus was selected (resistance selection was performed using 100 mg / L hygromycin), followed by differentiation and regeneration culture, and then rooting culture was performed to obtain regenerated plants.

[0059] The specific steps are as follows: (1) Take out the mature seeds of the plant, remove the shells, and select the plump, smooth and sterile seeds for disinfection.

[0060] (2) Inoculate the sterilized seeds onto the induction medium and culture them in the dark at 28°C for about 14 days. Select the callus with good appearance and good growth ability.

[0061] (3) Take the recombinant vector pSG2027 constructed in Example 2 -OsDNAJL1 Introduce Agrobacterium tumefaciens EHA105 to obtain recombinant bacteria, named EHA105 / pSG2027- OsDNAJL1 .

[0062] (4) Take the recombinant bacteria obtained in step (3) and resuspend the bacteria in infection medium to obtain EHA105 / pSG2027-OsDNAJL1 bacterial suspension.

[0063] (5) Soak the Nipponbare callus tissue prepared in step (2) in the EHA105 / pSG2027 prepared in step (4) - OsDNAJL1 After infection, the bacterial suspension was discarded, the callus tissue was taken, and the water was absorbed with sterile filter paper, and then placed on the co-culture medium with acetosyringone and glucose, and cultured in the dark at 28°C for 50-55h.

[0064] (6) After completing step (5), select callus tissue with no obvious Agrobacterium on the surface and transfer it to an antibacterial medium containing cephalosporin, and culture it in the dark at 28°C for 3-4 days.

[0065] (7) The callus tissue cultured above was transferred to a screening medium supplemented with hygromycin and cephalosporin and cultured in the dark at 28°C for 30 days, with subculturing every 10 days.

[0066] (8) After completing step (7), fresh hygromycin-resistant callus tissue was taken and inoculated into the pre-regeneration medium. The cells were cultured in the dark at 28°C for 7 days, and then placed in a light culture room (12 h light / 12 h dark) for another 7 days. The cells were then transferred to the regeneration medium and continued to be cultured in the light until regenerated plants were grown. Candidate OsDNAJL1 Gene knockout plants.

[0067] The recombinant vector SG2027 will be used -OsDNAJL1 The transgenic plants obtained were recorded as OsDNAJL1 Transgenic plants.

[0068] The induction medium and differentiation medium were both MS medium (Phytotechnology, product number M519-100L).

[0069] 2. OsDNAJL1 Identification of gene knockout rice Plants to be tested: Nipponbare Nip (control group) and candidates obtained in step 1 OsDNAJL1 Gene knockout plants.

[0070] Extract genomic DNA from leaves of the tested plants, use genomic DNA as template, and use primers OsDNAJL1- F1 and primers OsDNAJL1- PCR amplification was performed using the primer pair consisting of R1.

[0071] OsDNAJL1- F1: 5'-AAGCGGTGCTAGAGATGTCG-3'; OsDNAJL1- R1:5'-GCCCAAGACCAAGTACCTCC-3'.

[0072] With pSG2027- OsALKBHL1OsDNAJL1 The plasmid was used as a positive control (V), and the recipient variety Nipponbare was used as a negative control (CK). The resulting products were then sequenced.

[0073] The sequencing results showed that compared with the genomic DNA of Nip, OsDNAJL1-1 Plant (abbreviated as OsDNAJL1-1 ) in both homologous chromosomes, the genes encoding OsDNAJL1 protein underwent the following mutation: "5'-TGCACCAAGCCCTGCTCCGCCGATGATA-3'" (corresponding to positions 820-847 of SEQ ID No:3 and positions 292-319 of SEQ ID No:2) mutated to "5'-TGCACCAAGCCCTGCTCCGCCGTATGATA-3'", resulting in a frameshift of the amino acid translation after the editing site and premature termination of the protein sequence, thereby knocking out the gene encoding OsDNAJL1 protein. The sequencing results of the mutation site and its surrounding nucleotides are shown in Figure 2 .

[0074] The sequencing results showed that compared with the genomic DNA of Nip, OsDNAJL1-2 Plants (with OsDNAJL1-2 In the two homologous chromosomes (represented by ), the genes encoding the OsDNAJL1 protein have undergone the following mutation: "5'-TGCACCAAGCCCTGCTCCGCCGATGATA-3'" (corresponding to positions 820-847 of SEQ ID No: 3 and positions 292-319 of SEQ ID No: 2) mutated to "5'-TGCACTATA-3'", thereby knocking out the gene encoding the OsDNAJL1 protein. The sequencing results of the mutation site and its surrounding nucleotides are shown in Figure 2 .

[0075] Through the above identification, a single peak appeared near the target site, which was a homozygous edited plant and was named T0 generation transgenic plant. OsDNAJL1 Gene knockout rice, the above two homozygous editing methods are named OsDNAJL1-1 and OsDNAJL1-2 strains.

[0076] The above OsDNAJL1 The T0 generation rice mutant plants of the homozygous mutation type were further cultivated to screen out the T1 generation plants without transgenic elements. OsDNAJL1-1 and OsDNAJL1-2 plants and performed phenotypic characterization.

[0077] OsDNAJL1-1 The plants are self-pollinated and seeds are harvested, and the seeds are cultivated into plants, which are T1 generation plants. OsDNAJL1-1Plants and their self-fertilized offspring are called OsDNAJL1-1 strains.

[0078] OsDNAJL1-2 The plants are self-pollinated and seeds are harvested, and the seeds are cultivated into plants, which are T1 generation plants. OsDNAJL1-2 Plants and their self-fertilized offspring are called OsDNAJL1-2 strains.

[0079] Example 4: Comparison of rice production traits The plants to be tested are: rice Nip, mutant strains OsDNAJL1-1 and OsDNAJL1-2 T1 homozygous strain osdnajl1 and osdnajl2 .

[0080] The seeds of each tested strain were germinated and raised in a greenhouse (starting from the time of dew, for a total of 3 weeks, with environmental conditions of 28°C, 10 h light / 14 h dark) to obtain 3-week-old seedlings; the 3-week-old seedlings were transplanted to the field in Langfang, Hebei and cultivated and managed normally, and the plant height, tiller number, ear length and number of first (second) level branches of the tested strains were measured, and at least 30 individual plant data were counted for each material.

[0081] The growth of the plants to be tested is shown in Figure 3 AC and Figure 4 , compared with Nip, OsDNAJL1-1 and OsDNAJL1-2 The plant height increased significantly ( Figure 4 There was no significant difference in tiller number ( Figure 4 Middle B), the spike length becomes shorter ( Figure 4 Middle C), the number of primary branches remained unchanged ( Figure 4 Middle D), the number of secondary branches decreased significantly ( Figure 4 Middle E).

[0082] Example 5: Rice heat stress test The plants to be tested are: rice Nip, mutant strains OsDNAJL1-1 and OsDNAJL1-2 T1 homozygous plants of the strain osdnajl1 and osdnajl2 .

[0083] Seeds of each tested rice line were germinated and cultured in the greenhouse to the three-leaf stage (time point A, photographed), then transferred to a 45°C incubator for 48 hours (time point B, photographed), then transferred back to the greenhouse and continued to be cultured for 7 days (time point C, photographed), and then the survival rate was counted (at least 30 plants were counted for each test plant). Greenhouse conditions were: 28°C, 10 hours of light / 14 hours of darkness.

[0084] The results of heat stress experiment are as follows Figure 5 As shown: Figure 5A in the middle is the growth status of the tested plant at the three-leaf stage (time point A). Figure 5 The growth status of the plants to be tested in B was transferred to a 45°C incubator and cultured for 48 hours (time point B). Figure 5 The growth status of the plants tested in C after heat treatment at 45℃ and transfer back to the greenhouse and continue to be cultured for 7 days (time point C). The survival rate results are shown in Figure 5 D. After heat stress treatment, the survival rate of rice Nip was about 17.3%, OsDNAJL1-1 The survival rate of mutant plants was about 69.6%. OsDNAJL1-2 The survival rate of mutant plants was about 67.3%. , OsDNAJL1-1 and OsDNAJL1-2 The heat tolerance of the mutant plants was significantly improved.

[0085] Example 6. DNA 6mA modification levels The plants to be tested are: rice Nip, mutant strains OsDNAJL1-1 and OsDNAJL1-2 T1 homozygous plants of the strain osdnajl1 and osdnajl2 .

[0086] The seeds of each tested strain were germinated in a greenhouse and cultured to the three-leaf stage, the genomic DNA of the tested plants was extracted, and the abundance of DNA 6mA modification was detected by dot blot.

[0087] The results are as follows Figure 6 Shown: Compared with Nip, OsDNAJL1-1 and OsDNAJL1-2 The mutant plants had reduced levels of DNA 6mA modification.

[0088] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A protein, wherein the protein is any of the following: A1) a protein with an amino acid sequence as shown in SEQ ID No: 1; A2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein of A1) and having more than 75% identity with the protein of A1) and having the same function; A3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1) or A2).

2. The protein according to claim 1, characterized in that: The protein is derived from rice ( Oryza sativa L. ).

3. A biological material related to the protein according to claim 1 or 2, wherein the biological material is any one of the following: B1) A nucleic acid molecule encoding the protein according to claim 1 or 2; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2); B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) a transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2); C1) a nucleic acid molecule that inhibits, reduces or silences the expression of a gene encoding a protein as claimed in claim 1 or 2; C2) expressing a gene encoding the nucleic acid molecule described in C1); C3) an expression cassette containing the coding gene described in C2); C4) a recombinant vector containing the coding gene described in C2) or a recombinant vector containing the expression cassette described in C3); C5) a recombinant microorganism containing the coding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4); C6) a transgenic plant cell line containing the coding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4); C7) transgenic plant tissue containing the coding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4); C8) A transgenic plant organ containing the coding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

4. The biomaterial according to claim 3, characterized in that: B1) The nucleic acid molecule is the gene shown in E1) or E2) below: E1) a cDNA molecule or a DNA molecule whose coding sequence is SEQ ID No: 2; E2) The nucleotide sequence is a cDNA molecule or a DNA molecule of SEQ ID No:

3.

5. Use of the protein or gene expression regulating substance according to claim 1 or 2 or the substance regulating the activity or content of the protein in any of the following: U1) Application in regulating plant heat stress resistance; U2) Application in the preparation of products for regulating plant heat stress resistance; U3) Application in breeding plants with enhanced resistance to heat stress; U4) Use in the preparation of products for breeding plants with enhanced resistance to heat stress; U5) Application in plant breeding.

6. The use according to claim 5, characterized in that: The substance that regulates gene expression or the substance that regulates the activity or content of the protein is a biological material related to the protein, and the biological material is the biological material according to claim 3 or 4.

7. A method for regulating plant heat stress resistance, characterized in that: The method comprises regulating the activity and / or content of the protein described in claim 1 or 2, or / and the expression level of the gene encoding the protein described in claim 1 or 2 in the target plant to regulate the heat stress resistance of the plant.

8. The method according to claim 7, characterized in that: The regulating the activity and / or content of the protein described in claim 1 or 2 in the target plant, or / and the expression level of the gene encoding the protein described in claim 1 or 2, includes introducing a substance that inhibits the expression of the gene encoding the protein into the recipient plant, thereby obtaining a target plant with stronger plant heat stress resistance than the recipient plant; the encoding gene encodes the protein described in claim 1 or 2.

9. A method for cultivating a plant with altered resistance to heat stress, comprising: 1) Inhibiting or reducing or silencing the expression of the gene encoding the protein of claim 1 in a receptor plant, or / and inhibiting or reducing or silencing the activity and / or content of the gene encoding the protein of claim 1, to obtain a plant with enhanced heat stress resistance; 2) Increasing, enhancing and / or up-regulating the expression level of the gene encoding the protein described in claim 1 in the recipient plant, or / and increasing, enhancing and / or up-regulating the activity and / or content of the gene encoding the protein described in claim 1, to obtain a plant with reduced heat stress resistance.

10. The use according to claim 5 or 6, or the method according to any one of claims 7 to 9, characterized in that: The plant is any one of the following: N1) monocots or dicots; N2) Gramineae; N3) Gramineae; N4) Oryza plants; N5) Rice.

Images