Monoclonal antibody targeting tumor-associated antigen CDCP1 protein and preparation method and application thereof

Abstract

The invention discloses a monoclonal antibody targeting a tumor-associated antigen CDCP1 as well as a preparation method and application of the monoclonal antibody. The anti-CDCP1 monoclonal antibody can specifically recognize natural CDCP1 protein expressed by pancreatic cancer cells, is combined with recombinant CDCP1 extracellular domain protein in a high affinity manner, can remarkably inhibit migration of CDCP1 positive pancreatic cancer cells, and has the characteristic of repression function. The anti-CDCP1 monoclonal antibody provided by the invention is suitable for CDCP1 positive tumor detection, prognosis monitoring and diagnosis. The invention is applicable to the development of antibody drugs for targeted therapy of CDCP1 positive tumors.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a monoclonal antibody targeting tumor-associated antigen CDCP1 and a preparation technology and application thereof. Background Art

[0002] Pancreatic cancer is one of the most common malignant tumors. Less than 20% of pancreatic cancer patients can undergo surgical resection. However, even after radical resection, most patients will relapse, metastasize and die from cancer.

[0003] As an immunotherapy, monoclonal antibodies have been widely used to treat tumors. For example, rituximab, a human-mouse chimeric antibody with CD20 antigen, is used to treat B lymphocyte lymphoma. Trastuzumab, a monoclonal antibody targeting HER2, is the earliest humanized antibody drug used to treat HER2-positive breast cancer. Although a variety of drugs for targeted treatment of malignant tumors have been developed based on monoclonal antibodies for clinical use, there is no antibody drug approved by the FDA for the treatment of pancreatic cancer.

[0004] CUB domain-containing protein 1 (CDCP1) is a type I transmembrane glycoprotein, also known as CD318, SIMA135 or TRASK, which is mainly localized on the cell surface. It consists of a signal peptide, an extracellular domain, a transmembrane domain, and a cytoplasmic domain. The extracellular region of CDCP1 contains three CUB-like domains of unknown function, which may be involved in cell adhesion or interaction with the extracellular matrix. In addition, the extracellular region of CDCP1 contains 14 N-linked glycosylation sites, and the modification of these sites causes the molecular weight of the protein to increase from about 90kDa to about 135kDa. The cytoplasmic domain of CDCP1 contains five tyrosine residue sites. CDCP1 is often abnormally highly expressed in a variety of malignant tumors, including pancreatic cancer and breast cancer. CDCP1 protein forms homodimers after the R / K motif between the CUB1 and CUB2 domains in the extracellular region is hydrolyzed by proteases (such as trypsin and MT-SP1), and then interacts with Src and protein kinase Cδ (PKCδ), participating in the migration and invasion of tumor cells in a tyrosine phosphorylation-dependent manner.

[0005] CDCP1 is expressed at elevated levels in tumor tissues of pancreatic cancer patients. Knockdown of CDCP1 expression in pancreatic cancer cells BxPC3 can significantly inhibit cell migration and invasion. On the one hand, tyrosine phosphorylated CDCP1 regulates ECM degradation by promoting the secretion of proteases including MMP-9 by pancreatic cancer cells. On the other hand, tyrosine phosphorylation at the CDCP1-Y734 site triggers its association with the downstream target PKCδ and forms a SFKs (Src family kinase)-CDCP1-PKCδ complex, leading to enhanced PKCδ tyrosine phosphorylation and activity. Activated PKCδ further promotes the expression of cortactin, a downstream protein of the CDCP1-PKCδ pathway, thereby promoting the migration and invasion of pancreatic cancer cells BxPC3. Since the CDCP1 protein plays an important role in the migration, invasion, and drug resistance of pancreatic cancer cells, antibodies targeting CDCP1 are becoming attractive targets for the treatment of pancreatic cancer.

[0006] The development of antibodies targeting CDCP1 for anti-tumor activity research has been going on for many years. In 2020, Alajati et al. reported a paper on the anti-CDCP1 antibody CUB4, which can recognize the N-terminal domain of the CDCP1 protein. The research team conjugated the Fab segment of the CUB4 antibody to doxorubicin and packaged it with immunoliposomes. The modified antibody-drug conjugate was named anti-CDCP1-ILs. When used in combination with enzalutamide, it significantly inhibited the tumor growth of androgen-deprived prostate cancer cells LNCaP. In addition, the mouse antibody 10D7 that recognizes the extracellular domain of CDCP1 has the characteristic of being rapidly internalized by ovarian cancer cells. 10D7 and nuclide 89 Zr or conjugated with the microtubule polymerization inhibitor monomethyl auristatin E (MMAE) to generate antibody-drug conjugates (ADCs) showed good antitumor activity against ovarian cancer cell xenografts. In addition, Moroz et al. prepared a monoclonal antibody 4A06 that recognizes full-length CDCP1 and cleaved CDCP1 using phage technology. 177 After Lu coupling, it showed good efficacy on subcutaneous xenograft tumors of pancreatic cancer cells HPAC in mice. To date, most anti-CDCP1 monoclonal antibodies are antibody-coupled cytotoxic drugs or nuclides to generate ADCs. Preclinical research data show that these ADCs can significantly inhibit the growth of xenograft tumors. However, there are currently no FDA-approved antibody drugs targeting CDCP1. Therefore, the development of monoclonal antibody drugs with inhibitory effects based on the target CDCP1 will provide new therapies for the targeted treatment of CDCP1-positive tumors. Summary of the invention

[0007] In view of the important role of CDCP1 in the metastasis and drug resistance of pancreatic cancer, we previously used CDCP1-ECD-311 recombinant protein (311 amino acids of CDCP1 extracellular segment) expressed by eukaryotic cells to sensitize mice with mixed immune adjuvants, prepared monoclonal antibodies that recognize CDCP1 extracellular segment as antigenic epitopes, and tested the function of anti-CDCP1 monoclonal antibody (clone 2G5) in an in vitro model of pancreatic cancer. We found that anti-CDCP1 monoclonal antibody (2G5) recognizes natural CDCP1 protein expressed by pancreatic cancer cells. We used a protein interaction instrument to perform surface plasmon resonance analysis (SPR) and calculated the affinity of anti-CDCP1 monoclonal antibody to recombinant CDCP1 protein ( K D ) is about 8.78nM. Importantly, the anti-CDCP1 monoclonal antibody can significantly inhibit the migration of CDCP1-positive pancreatic cancer cells. The present invention will lay a solid foundation for the development of antibody drugs targeting CDCP1 to treat pancreatic cancer, and has practical guiding significance for the targeted treatment of CDCP1-positive solid tumors.

[0008] Therefore, in order to solve the problem of CDCP1-based target, the present invention develops a monoclonal antibody with inhibitory effect. The inventor uses CDCP1-ECD-311 (311 amino acids in the extracellular region) as an antigen for animal immunization, and uses CDCP1-ECD-311 protein as an antigen to coat an enzyme-labeled plate for ELISA screening, and prepares a monoclonal antibody that specifically recognizes recombinant CDCP1 protein. The anti-CDCP1 monoclonal antibody (2G5) specifically recognizes the natural CDCP1 protein expressed by tumor cells. And the monoclonal antibody has high affinity and strong specificity. And the anti-CDCP1 monoclonal antibody can inhibit the migration of CDCP1-positive pancreatic cancer cells and has inhibitory functional characteristics.

[0009] The present invention first provides an antigen, which is composed of 311 amino acids in the extracellular region of CDCP1.

[0010] Furthermore, a monoclonal cell line is provided which secretes and specifically binds to the antigen as claimed in claim 1.

[0011] The present invention particularly provides an antibody or an antigen-binding fragment thereof, which is prepared from the antigen and specifically binds to the antigen as claimed in claim 1.

[0012] In particular, it is a monoclonal antibody.

[0013] Preferably, the amino acid sequences of VH-CDR1, VH-CDR2 and VH-CDR3 of the heavy chain variable region are shown in SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3, respectively; and the amino acid sequences of VL-CDR1, VL-CDR2 and VL-CDR3 of the light chain variable region are shown in SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8, respectively.

[0014] More preferably, the amino acid sequence of the heavy chain variable region is: SEQ ID NO:4; and the amino acid sequence of the light chain variable region is: SEQ ID NO:9.

[0015] The present invention further provides a nucleic acid encoding the antibody or its antigen-binding fragment.

[0016] Preferably, the nucleic acid sequence of the heavy chain variable region is: SEQ ID NO:5; and the nucleic acid sequence of the light chain variable region is: SEQ ID NO:10.

[0017] The present invention also provides the use of the antibody or the antigen binding fragment thereof in preparing a targeted therapeutic drug for preventing or treating CDCP1 positive tumors.

[0018] The beneficial effects of the present invention are as follows: CDCP1 protein is abnormally highly expressed in malignant tumors such as pancreatic cancer and breast cancer. CDCP1 protein plays an important role in promoting tumor cell metastasis. The present invention provides a monoclonal antibody targeting tumor-associated antigen CDCP1, a preparation method and use thereof, and an anti-CDCP1 monoclonal antibody (2G5) specifically recognizes natural CDCP1 protein expressed by tumor cells. The anti-CDCP1 monoclonal antibody binds to the recombinant CDCP1 protein with high affinity. The anti-CDCP1 monoclonal antibody can inhibit the migration of CDCP1-positive pancreatic cancer cells. The present invention lays a solid foundation for potential clinical transformation applications in the targeted treatment of CDCP1-positive tumors.

[0019] The antibody of the present invention has the advantage of being able to specifically recognize the full-length (molecular weight of about 90 kDa) and glycosylated full-length CDCP1 (molecular weight of about 135 kDa) expressed by pancreatic cancer cells. The anti-CDCP1 monoclonal antibody (2G5) can specifically recognize the full-length CDCP1 (molecular weight of about 90 kDa), while the commercially available anti-CDCP1 antibodies generally can only recognize the intracellular region of the CDCP1 protein, while the anti-CDCP1 antibody of the present invention recognizes the extracellular region. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Purification and identification of recombinant human CDCP1-ECD-311 protein. Coomassie brilliant blue staining and western blot were used to analyze the expression of recombinant human CDCP1 protein.

[0021] Figure 2 Cell fusion using hybridoma technology. (A) Culture in HAT medium to screen positive mother clones. (B) Culture in HAT medium to amplify and screen positive mother clones. (C) Culture in HT medium to amplify and screen positive subclones. Subcloning and other methods. Screening of monoclonal hybridoma cell clones that specifically recognize recombinant human CDCP1 protein. The horizontal axis shows the OD value of mouse IgG, and the vertical axis shows the dilution multiple of the cell culture supernatant.

[0022] Figure 3 Purification of anti-CDCP1 monoclonal antibody (clone 2G5). Heavy and light chains of the antibody were detected by Coomassie blue staining.

[0023] Figure 4 The affinity of anti-CDCP1 monoclonal antibody (2G5) was measured by surface plasmon resonance analysis (SPR).

[0024] Figure 5 Anti-CDCP1 monoclonal antibody (2G5) recognizes the natural CDCP1 protein expressed by pancreatic cancer cells. (A) Western blot detection of CDCP1 protein level in pancreatic cancer cells. (B) Immunoprecipitation assay detection of anti-CDCP1 monoclonal antibody (2G5) recognition of natural CDCP1 expressed by pancreatic cancer cells.

[0025] Figure 6 Anti-CDCP1 monoclonal antibody (2G5) significantly inhibited the migration of CDCP1-positive pancreatic cancer cells.

[0026] Figure 7 Antibody subtype identification of anti-CDCP1 monoclonal antibody (2G5). DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention is further described in detail below in combination with specific embodiments and with reference to the accompanying drawings.

[0028] Example 1: Selection and preparation of antigens 1. Selection of Antigens The CDCP1 protein consists of a signal peptide (29 amino acid residues), an extracellular domain (638 amino acid residues), a transmembrane domain (21 amino acid residues) and a cytoplasmic domain (148 amino acid residues). The extracellular region of CDCP1 contains three CUB-like domains (CUB-L1, CUB-L2, CUB-L3) of unknown function (sequences are shown in Table 1 below). It is reported that most CDCP1 antibodies in clinical trials only recognize the antigenic determinant group in CDCP1-CUB-L1. The R / K motif between the CUB1 and CUB2 domains in the extracellular region of the CDCP1 protein is hydrolyzed by proteases (trypsin and MT-SP1, etc.), which makes it possible for the protease-hydrolyzed CDCP1-nitrogen end to be free and enter the peripheral blood for free circulation. The free CDCP1-nitrogen end can neutralize most CDCP1 antibodies, which limits the amount of antibodies that can target CDCP1 on the surface of tumor cells.

[0029] In view of the shortcomings of antibody research and development that recognizes CDCP1, and the important role of CDCP1 in the metastasis and drug resistance of pancreatic cancer, the present invention uses recombinant CDCP1-ECD-311 protein (311 amino acids of the CDCP1 extracellular segment containing CDCP1-CUB-L2 and CDCP1-CUB-L3 domains) expressed by eukaryotic cells and mixed with immune adjuvants to sensitize mice, and prepares a monoclonal antibody that recognizes the CDCP1 extracellular segment as an antigen epitope.

[0030] Table 1

[0031]

[0032]

[0033] 2. Preparation, purification and identification of recombinant human CDCP1 extracellular domain protein RNA was extracted from pancreatic cancer cells CFPAC-1, reverse transcribed to synthesize cDNA, and after PCR amplification, the human CDCP1 extracellular domain fragment (CDCP1-ECD-311) was inserted into the pcDNA3.0 expression vector to construct a vector pcDNA3.0-CDCP1-ECD-311-6xHis expressing recombinant human CDCP1 protein. This expression vector (2.5µg / mL) was mixed with polyethyleneimine (PEI, 7.5µg / mL) in a certain proportion and transiently transferred into CHO eukaryotic cell suspension culture (200 ml system). After six days, the supernatant was collected and the recombinant protein was purified with Ni-NTA beads, resulting in 2.3 mg of protein. Coomassie staining experiments showed that the purity of the purified protein was greater than 70% ( Figure 1 The expression of recombinant human CDCP1 protein was detected by Western blot using anti-His-tag antibody, and its molecular weight was about 50 kDa ( Figure 1 ).

[0034] Example 2: Animal immunization with recombinant human CDCP1 extracellular domain protein In order to prepare monoclonal antibodies that specifically recognize human CDCP1 protein. We mixed recombinant CDCP1-ECD-311 protein (50μg / mouse) with immune adjuvant and injected it intraperitoneally into Balb / c mice (female, four weeks old, n=3) three times. After animal immunization, orbital blood was collected from mice, and the titer of mouse serum IgG (immunoglobulin G) was detected by enzyme-linked immunosorbent assay (ELISA). First, 96-well ELISA plates were coated with recombinant CDCP1-ECD-311 protein (5μg / mL, 100μL), blocked with PBS-B (containing 3% bovine serum albumin) for 30 minutes, and then incubated with serum (100μL / well) diluted in multiples (a total of 8 gradients, 50 times, 200 times, 800 times, 3200 times, 12800 times, 51200 times, 204800 times, 819200 times) at room temperature for 2 hours. The 96-well ELISA plate was washed 5 times with PBS-T and incubated with anti-mouse IgG-HRP secondary antibody. After TMB color development, the absorbance value (OD value) was measured at a wavelength of 450nm to determine whether there was a specific antibody that recognized the recombinant CDCP1-ECD-311 protein. As shown in Table 2, the titer of the No. 1 and No. 3 mouse sera was higher than 51,200 times, which has reached the usable titer.

[0035] Table 2

[0036] Example 3: Screening of monoclonal hybridoma cells that specifically recognize recombinant human CDCP1-ECD-311 protein We extracted lymphocytes from the spleen of mouse No. 3, which had a high antibody titer. The spleen lymphocyte suspension was mixed with SP2 / 0 mouse myeloma cells that had reached the logarithmic growth phase at a ratio of 5:1 (total cell number was approximately 1.9×10 8 ) in a 50mL centrifuge tube. After mixing, wash twice with DMEM medium, uniformly drip 1mL of preheated PEG (polyethylene glycol) solution into the mixed cell pellet in a 37℃ water bath, centrifuge the centrifuge tube at 1000rpm for 90 seconds (18℃), and discard the supernatant. Then add 10.5mL of preheated DMEM medium, from drip to flow, gently shake the centrifuge tube to mix and complete the whole process within 5 minutes. Centrifuge the centrifuge tube at 1000rpm for 5 minutes (37℃), and discard the supernatant. The cells are fully suspended in about 20mL of DMEM medium containing 20% ​​fetal bovine serum, 1% double antibody, and 2% HAT (hypoxanthine-aminopterin-thymidine), plated on 96-well plates, and cultured in a 37℃ cell culture incubator with 5% CO2.

[0037] Two weeks after cell fusion, the cell supernatant of the 96-well plate was taken for positive detection. The 96-well ELISA plate was coated with recombinant CDCP1-ECD-311 protein (5µg / mL, 100µL). About 100μL of the cell supernatant was added to the coated plate, PBS was used as a blank control, and the orbital serum of immune mice was used as a positive control, and incubated at room temperature for 2 hours; after washing 5 times with PBS-T (pH7.4, 1% Tween), 100μL of anti-mouse IgG-HRP secondary antibody was added, and incubated at room temperature for 1 hour; after washing 5 times with PBS-T, 100μL of TMB colorimetric solution was added, and after incubation for 10 minutes, 50μL of 1M sulfuric acid was added to terminate the reaction, and the absorbance value was measured at 450nm using an ELISA reader. As shown in Figure 2A, the OD values ​​of the supernatants from wells 3B8 and 3H11 in cell culture plate No. 3 were greater than 0.5, and the OD values ​​of the supernatants from wells 4G5, 4F6, and 4A7 in cell culture plate No. 4 were greater than 0.3.

[0038] Next, we plated five clones, 3B8, 3H11, 4G5, 4F6 and 4A7, in 24-well cell culture plates and 6-well cell culture plates, and continued to amplify them in a medium containing HAT. The ELISA method was used to detect the antibody titer of the cell supernatant. As shown in Figure 2B, the antibody titer of the culture supernatant of clones 4G5, 4F6, 4A7 and 3H11 cells was very low. Only 3B8 cells proliferated significantly in a medium containing HAT, and the antibody titer was high.

[0039] 3B8 cells that were positive for recombinant CDCP1-ECD-311 protein were selected for further limited dilution and subclone screening. The titer of the monoclonal positive cell supernatant was measured (diluted 3 times, 9 times, 27 times, 81 times, 243 times, and 729 times, respectively), and finally a monoclonal cell that can produce anti-CDCP1 antibodies with high antigen binding affinity was screened, namely clone 2G5 (clone 2G5, C in Figure 2).

[0040] Example 4: Preparation and purification of anti-CDCP1 monoclonal antibodies To purify the anti-CDCP1 monoclonal antibody (2G5), we injected pristane (500 µL / mouse) intraperitoneally into Balb / c mice. After 10-14 days, 2G5 hybridoma cells (1x10 6 Cells) were injected into mice intraperitoneally to induce ascites, and the anti-CDCP1 monoclonal antibody (2G5) was obtained by chromatography purification using protein-A beads. Coomassie brilliant blue staining results showed that the purified anti-CDCP1 monoclonal antibody had a high purity ( Figure 3 ), the heavy chain (50kDa) and light chain (25kDa) of the antibody can be observed very clearly, and there are no other protein bands.

[0041] Example 5: Detection of the affinity of anti-CDCP1 monoclonal antibody (2G5) In order to detect the affinity (equilibrium dissociation constant) of the interaction between anti-CDCP1 monoclonal antibody and antigen, we coupled the recombinant CDCP1-ECD-311 protein to the surface of CM5 biosensor chip through amino groups, used the anti-CDCP1 monoclonal antibody diluted in multiple ratios as ligand, and performed surface plasmon resonance analysis (SPR) using a protein interaction instrument (Biacore X100). Figure 4 As shown, the affinity of anti-CDCP1 monoclonal antibody (2G5) and recombinant CDCP1-ECD-311 protein was calculated ( K D ) is 8.78nM. Generally, if the affinity of the antibody-antigen interaction is less than 10 nM, it is considered that the antibody affinity is good.

[0042] Example 6: Anti-CDCP1 monoclonal antibody can recognize natural CDCP1 protein expressed by pancreatic cancer cells It is reported that CDCP1 protein is abnormally highly expressed in a variety of tumors, including pancreatic cancer, prostate cancer, colon cancer, lung cancer and breast cancer. CDCP1 protein is a type I transmembrane glycoprotein. In cancer cells, CDCP1 protein is mainly expressed in three types, which are divided into full-length type (molecular weight about 90kDa), glycosylated full-length type (molecular weight about 135kDa) and shear type (molecular weight about 70kDa) according to protein glycosylation modification.

[0043] In order to explore whether the anti-CDCP1 monoclonal antibody (2G5) can recognize the CDCP1 protein expressed by pancreatic cancer cells, we used commercially available CDCP1 rabbit monoclonal antibody (Cat.13794S, CST) for Western blot analysis to detect the expression level of CDCP1 protein in pancreatic cancer cells CFPAC-1, PANC-1, PATU-8988 and normal pancreatic ductal cells hTERT-HPNE. Figure 5 As shown in A, the expression level of CDCP1 protein (glycosylated full-length, molecular weight about 135kDa) in PATU-8988 cells is the highest, followed by CFPAC-1 and PANC-1. The above three pancreatic cancer cells all express the cleaved CDCP1 protein (molecular weight about 70kDa). CFPAC-1 and PATU-8988 cells express the full-length CDCPC1 protein (molecular weight about 90kDa). In contrast, normal pancreatic ductal cells hTERT-HPNE do not express the three types of CDCP1 proteins.

[0044] Furthermore, the above four cells were lysed and then immunoprecipitated with anti-CDCP1 monoclonal antibody (1µg / tube, 2G5) and isotype control antibody mouse IgG2a (1µg / tube). The results showed that anti-CDCP1 monoclonal antibody (2G5) could immunoprecipitate full-length and glycosylated full-length CDCP1 in CFPAC-1, PANC-1 and PATU-8988 cells, but could not immunoprecipitate cleaved CDCP1 protein ( Figure 5 (B). The isotype control antibody mouse IgG2a cannot immunoprecipitate CDCP1 protein expressed by pancreatic cancer cells. Immunoprecipitation experiments showed that the anti-CDCP1 monoclonal antibody (2G5) can recognize CDCP1 in its native conformation in pancreatic cancer cells ( Figure 5 Middle B).

[0045] Therefore, the antibody of the present invention has the advantage of being able to specifically recognize the full-length CDCP1 (molecular weight of about 90 kDa) and the glycosylated full-length CDCP1 (molecular weight of about 135 kDa) expressed by pancreatic cancer cells. Figure 5 As shown in B, the anti-CDCP1 monoclonal antibody (2G5) can specifically recognize the full-length CDCP1 (molecular weight of about 90 kDa). The commercially available anti-CDCP1 antibodies generally can only recognize the intracellular region of the CDCP1 protein, while the anti-CDCP1 antibody of the present invention recognizes the extracellular region.

[0046] Example 7: Anti-CDCP1 monoclonal antibody significantly inhibits the migration of CDCP1-positive pancreatic cancer cells CDCP1 plays an important role in pancreatic cancer cell migration and invasion. To explore the effect of anti-CDCP1 monoclonal antibody on pancreatic cancer cell migration, we incubated anti-CDCP1 monoclonal antibody (10µg / mL) and isotype control antibody mouse IgG2a (10µg / mL) with pancreatic cancer cells PANC-1, PATU-8988 and normal pancreatic duct cells (hTERT-HPNE) for 30 minutes, and then performed a Trans-well experiment. After 24 hours, crystal violet staining was used to analyze cell migration. Figure 6 As shown in the figure, compared with the isotype control antibody treatment group, the anti-CDCP1 monoclonal antibody significantly inhibited the migration of CDCP1-positive pancreatic cancer cells PANC-1 and PATU-8988, with inhibition rates of 46% and 59%, respectively. As expected, the anti-CDCP1 monoclonal antibody did not affect the migration of normal pancreatic ductal cells hTERT-HPNE ( Figure 6 Our results showed that anti-CDCP1 monoclonal antibody could significantly inhibit the migration of CDCP1-positive pancreatic cancer cells and had suppressive functional characteristics.

[0047] Table 3

[0048] Example 8: Identification of subtypes of anti-CDCP1 monoclonal antibody (2G5) The 96-well ELISA plate was coated with recombinant CDCP1-ECD-311 protein (5µg / mL, 100µL), blocked with PBS-B (containing 3% bovine serum albumin) for 30 minutes, and then incubated with 2G5 hybridoma cell culture fluid (100µL / well) diluted in multiples at room temperature for 2 hours, with a total of 6 dilution gradients (3 times, 9 times, 27 times, 81 times, 243 times, 729 times, etc.). The ELISA plate was washed 5 times with PBS-T, and incubated with the corresponding secondary antibodies (anti-mouse IgG-HRP, anti-mouse IgG1-HRP, anti-mouse IgG2a-HRP, anti-mouse IgG2b-HRP, anti-mouse IgG3-HRP) for 1 hour, and the antibody subtype of the anti-CDCP1 monoclonal antibody was detected after TMB color development. Figure 7 As shown, the antibody subtype of the anti-CDCP1 monoclonal antibody (2G5) is IgG2a.

[0049] Example 9: Identification of CDR sequences of heavy and light chain variable regions of anti-CDCP1 monoclonal antibodies Total RNA was isolated from 2G5 hybridoma cells according to the technical manual of RNA isolation kit. Then, cDNA was synthesized by reverse transcriptase. Antibody fragments of heavy chain variable region (VH) and light chain variable region (VL) were amplified according to the standard operating procedure of PCR amplification. Primers are as shown: heavy chain primers, IGG2a: GGAAGATCTCTTGACCAGGCATCCTAGAGTCA, 5'MH2: CTTCCGGAATTCSARGTNMAGCTGSAGSAGTCWGG; light chain Kappa chain primers, 3'Kc: GGTGCATGCGGATACAGTTGGTGCAGCATC, 5'Mk: GGGAGCTCGAYATTGTGMTSACMCARWCTMCA. The amplified antibody fragments were cloned into standard cloning vectors respectively. Colony PCR method was used to screen clones with correct insert size. No less than 5 colonies with inserts and correct size were sequenced for each fragment. Sequences of different clones were compared, and consensus sequences of these clones were obtained. The consistent antibody heavy chain variable region (VH) and light chain (VL) variable region nucleic acid sequences were analyzed and determined according to the Kabat numbering method to determine the heavy chain variable region CDR (3 segments) and light chain variable region CDR (3 segments) amino acid sequences.

Claims

1. An antigen, characterized in that It is composed of 311 amino acids in the extracellular region of CDCP1.

2. A monoclonal cell line that secretes a protein that specifically binds to the antigen as claimed in claim 1.

3. An antibody or an antigen-binding fragment thereof, characterized in that: It is prepared from the antigen as claimed in claim 1 and specifically binds to the antigen as claimed in claim 1.

4. The antibody or antigen-binding fragment thereof according to claim 3, wherein: It is a monoclonal antibody.

5. The antibody or antigen-binding fragment thereof according to claim 4, wherein: The amino acid sequences of VH-CDR1, VH-CDR2 and VH-CDR3 in the heavy chain variable region are shown in SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3, respectively; and the amino acid sequences of VL-CDR1, VL-CDR2 and VL-CDR3 in the light chain variable region are shown in SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8, respectively.

6. The antibody or antigen-binding fragment thereof according to claim 5, wherein: The amino acid sequence of the heavy chain variable region is: SEQ ID NO: 4; The amino acid sequence of its light chain variable region is: SEQ ID NO:

9.

7. A nucleic acid encoding the antibody or antigen-binding fragment thereof according to any one of claims 3 to 6.

8. The encoding nucleic acid according to claim 7, characterized in that The nucleic acid sequence of the heavy chain variable region is: SEQ ID NO: 5; The nucleic acid sequence of its light chain variable region is: SEQ ID NO:

10.

9. Use of the antibody or antigen-binding fragment thereof according to any one of claims 3 to 6 in the preparation of a targeted therapeutic drug for preventing or treating CDCP1-positive tumors.

Images