Application and method of gene GhDRP1 in negative regulation of cotton drought

Abstract

The invention belongs to the field of gene engineering, and relates to application and a method of a gene GhDRP1 in negative regulation of cotton drought, an amino acid sequence of a protein coded by the gene GhDRP1 is shown as SEQ ID No.2, and a nucleotide sequence is shown as SEQ ID No.1. The gene is silenced in upland cotton by utilizing a VIGS technology, and natural drought treatment finds that the drought resistance of an interfered plant is enhanced, the survival rate is increased, and the drought resistance of the plant is improved. It is further proved that expression of the gene GhDRP1 is in negative correlation with the drought resistance of cotton. The drought resistance of the cotton is obviously enhanced, the survival rate of the cotton is improved, and the method has important significance for cultivating new varieties of drought-resistant cotton.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and relates to the function and application of cotton drought resistance genes. Background Art

[0002] The world's arid and semi-arid regions account for about 36% of the total land area and 43% of the cultivated land area. Water shortage has become a global environmental problem, seriously affecting the growth of cotton. Cotton is highly dependent on water throughout its entire growth period, and different growth periods have different water requirements. From sowing to emergence, the water requirement is small, and the water requirement in the seedling stage gradually increases. The bud stage and the boll stage are the key water demand periods, and the water requirement in the boll opening stage gradually decreases. Water shortage during the key growth period will have a significant impact on the growth and development of cotton and the yield quality. Although cotton itself has a certain degree of drought resistance, under severe drought, cotton will experience early leaf shedding, limited growth in plant height and stem thickness, and reduced leaf area, which will ultimately lead to a reduction in yield.

[0003] The ubiquitin proteasome pathway is the most important protein degradation pathway with high selectivity in all known eukaryotic organisms. U-box protein is a new type of E3 protein that determines substrate specificity recognition in the ubiquitin system. The U-box domain is composed of approximately 70 amino acid residues and is highly conserved in eukaryotic organisms such as yeast, plants and animals (Hatakeyama & Nakayama, 2003). Studies have shown that E3 ubiquitin ligases play an important role in plant abiotic stress responses (drought, salt, cold, etc.) (Meng et al., 2024; Du et al., 2024; Wang et al., 2023). Modern biotechnology provides a new approach for cotton drought resistance research, such as cloning and studying the functions of drought-related genes through genetic engineering, providing theoretical support for breeding cotton varieties with stronger stress resistance.

[0004] Du C, Liu M, Yan Y, Guo X, Cao X, Jiao Y, Zheng J, Ma Y, Xie Y, Li H, Yang C, Gao C, Zhao Q, Zhang Z. The U-box E3 ubiquitin ligase PUB35 negativelyregulates ABA signaling through AFP1-mediated degradation of ABI5. PlantCell. 2024 Sep3;36(9):3277-3297.

[0005] Hatakeyama S, Nakayama KI. U-box proteins as a new family ofubiquitin ligases. BiochemBiophys Res Commun. 2003 Mar 21;302(4):635-45.

[0006] Meng Y, Lv Q, Li L, Wang B, Chen L, Yang W, Lei Y, Xie Y, Li X. E3ubiquitin ligaseTaSDIR1-4A activates membrane-bound transcription factorTaWRKY29 to positively regulate drought resistance. Plant Biotechnol J. 2024Apr;22(4):987-1000.

[0007] Wang X, Zhang X, Song CP, Gong Z, Yang S, Ding Y. PUB25 and PUB26 dynamically modulate ICE1 stability via differential ubiquitination during cold stress in Arabidopsis. Plant Cell. 2023 Sep 1;35(9):3585-3603. Summary of the invention

[0008] The invention provides an application and method of the gene GhDRP1 in negatively regulating cotton drought, which significantly enhances the drought resistance of cotton and improves the survival rate of cotton, and is of great significance for breeding new drought-resistant cotton varieties.

[0009] The technical solution of the present invention is achieved in this way: The application of gene GhDRP1 in negatively regulating cotton drought, the amino acid sequence of the protein encoded by the above gene GhDRP1 is more than 90% similar to the amino acid sequence shown in SEQ ID No.2. Those skilled in the art know that when the amino acid sequences have more than 90% similarity, the functions they play are basically the same.

[0010] Preferably, the amino acid sequence of the protein encoded by the above gene GhDRP1 is shown as SEQ ID No.2.

[0011] The nucleotide sequence of the above gene GhDRP1 is more than 75% similar to the nucleotide sequence shown in SEQ ID No. 1, or 80% similar, or 85% similar, or 90% similar, or 95% similar.

[0012] The nucleotide sequence of the above gene GhDRP1 is shown in SEQ ID No.1.

[0013] The application of the gene GhDRP1 in negatively regulating cotton drought is achieved by inhibiting or knocking out the gene GhDRP1 in the plant through gene interference.

[0014] The above-mentioned gene interference method is RNAi technology or gene editing.

[0015] A method for cultivating drought-resistant cotton, the method comprising inhibiting or knocking out the gene GhDRP1 in cotton plants, the nucleotide sequence of the gene GhDRP1 being shown in SEQ ID No.1.

[0016] The inhibition is achieved by constructing a VIGS expression vector of the gene GhDRP1, and then injecting it into the back of the cotton cotyledon through the Agrobacterium transformation method. After the injection, the vector is protected from light for 12 hours and then cultured under normal light.

[0017] The above injection area should exceed 95% of the cotton cotyledon area.

[0018] The above-mentioned knockout was achieved by using gene editing technology to construct a CRISPR / Cas9 recombinant vector of the gene GhDRP1, which was then transferred into the hypocotyls of yellowing cotton seedlings through Agrobacterium transformation to obtain gene-edited plants; and drought-resistant cotton was obtained by changing the coding sequence of the GhDRP1 gene through CRISPR / Cas9 gene editing.

[0019] The present invention has the following beneficial effects: 1. The virus-mediated gene silencing technology (VIGS) was used to silence the gene in upland cotton. Through natural drought treatment, it was found that the drought resistance of the interfered plants was enhanced and the survival rate was improved. The above results show that the expression of the gene GhDRP1 is negatively correlated with the drought resistance of cotton. The gene editing material ghdrp1 of GhDRP1 was obtained by CRISPR / Cas9 gene editing technology, so it can be used as a candidate gene for breeding drought-resistant cotton varieties through genetic engineering.

[0020] 2. The present application has cloned the negatively regulated cotton drought resistance gene GhDRP1, and improved the drought resistance of cotton by reducing its expression. This not only provides new ideas for the molecular regulatory mechanism of cotton resistance to drought stress, but also provides new candidate genes and genetic materials for cotton drought resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 The expression pattern of GhDRP1 gene under drought treatment in two cotton varieties ZY007 (drought-tolerant type) and ZY168 (sensitive type); the black bar on the left is normal leaves; the gray bar on the right is drought leaves ns: no significant difference; *: significant difference; **: extremely significant difference.

[0023] Figure 2 Figure 1 is the interference efficiency detection of TRV: GhDRP1; (a) is the nucleic acid gel electrophoresis of TRV: GhDRP1 Agrobacterium detection; (b) is the acid gel electrophoresis of RT-PCR interference efficiency detection; (c) is the bar graph of QRT-PCR results of interference efficiency detection (TRV: 00: black bar graph on the left, TRV: GhDRP1: gray bar graph on the right, ***: extremely significant difference).

[0024] Figure 3 The figure is a test of the drought resistance of TRV:GhDRP1 interference materials; (a) shows the growth of the control plant TRV:00 and the silent plant TRV:GhDRP1 under the conditions of sufficient water, drought for 10 days and re-watering for 12 hours; (b) shows the positive control, the TRV:CLA interference plant (CLA is a key enzyme for chlorophyll synthesis) appears white; (c) is a bar graph of the statistical results of plant height and survival rate of the control plant TRV:00 and the silent plant TRV:GhDRP1. (TRV:00: black bar graph on the left, TRV:GhDRP1: gray bar graph on the right. ns: no significant difference; ***: extremely significant difference).

[0025] Figure 4 This is a test of drought resistance of ghdrp1 mutant materials; (a) shows the growth of wild-type plants WT and gene-edited plants ghdrp1 under conditions of sufficient water, drought for 10 days, and rehydration for 12 hours; (b) shows a bar graph of the statistical results of plant height and survival rate of wild-type plants WT and gene-edited plants ghdrp1. (WT: black bar graph on the left, gray bar graph on the right for ghdrp1. ns: no significant difference; ***: extremely significant difference). DETAILED DESCRIPTION

[0026] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] Unless otherwise specified, the experimental methods used in the following experimental examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0028] Example 1: Acquisition of candidate genes The present invention uses two cotton varieties, ZY007 (drought-resistant type) and ZY168 (sensitive type), to screen out the gene GhDRP1 ( Figure 1 ), the cDNA sequence of the GhDRP1 gene is shown in SEQ ID No.1. GhDRP1 (U-box protein) belongs to E3 ubiquitin ligase and is involved in cotton drought resistance response. Reducing the expression of this gene can effectively enhance cotton drought resistance. The gene was silenced in upland cotton (TM-1) using virus-mediated gene silencing technology (VIGS). Through natural drought treatment, it was found that the drought resistance of the interfered plants was enhanced and the survival rate was improved. The above results show that the expression of the gene GhDRP1 is negatively correlated with cotton drought resistance. The gene editing material ghdrp1 of GhDRP1 was obtained using CRISPR / Cas9 gene editing technology, so it can be used as a candidate gene for breeding drought-resistant cotton varieties through genetic engineering.

[0029] Example 2: Construction of TRV:GhDRP1 viral interference vector and VIGS-mediated transformation For the construction of VIGS expression vector, the following primers were designed based on the nucleotide sequence of GhDRP1. The primer sequences are as follows: Forward primer GhDRP1-VIGS-F (5′-CTGGTCAGACATATGACAGACCC-3′); Reverse primer: GhDRP1-VIGS-R (5'-CATCTTCTCTGGAGATCAGGGTG-3').

[0030] First, the GhDRP1 gene was cloned from a cotton cDNA library. (Reaction system: 2×Phanta Max Buffer 10 μL, dNTP (10 mM) 0.4 μL, GhDRP1-VIGS-F 30 mM, GhDRP1-VIGS-R 30 mM, template (cDNA) 5 μL, Phanta Max Super-Fidelity DNA Polymerase (5 U / μL) 0.1 μL ddH 2 O to make up to 20 μL; Amplification program: (95°C, 5 min; 95°C, 30 s; 58°C, 15 s; 72°C, 10 s; 38 cycles; 12°C, 10 min to clone the TRV:GhDRP1 gene fragment), pTRV2 plasmid was double-digested with restriction endonucleases BamH1 and Kpn1 (purchased from NEB, China) (reaction system: 10× Cutsmart Buffer 5 μL, BamH1 1 μL, Kpn1 1 μL, pTRV2 plasmid 2 μg, ddH 2 O to 50 μL; reaction procedure: 37°C for 3 h).

[0031] The cloned PCR product was connected with the pTRV2 plasmid fragment recovered by restriction digestion using a one-step cloning method: (Reaction system: 5×CE II Buffer 2 μL, TRV: GhDRP1 gene fragment 100 ng, pTRV2 plasmid digestion product 50 ng, Exnase II 1 μL, ddH 2 O to 10 μL; reaction procedure: 37°C 30 min); The ligation product is the viral silencing vector TRV:GhDRP1. The vector was heat-shocked and transferred into Escherichia coli DH5α (purchased from Tiangen Biochemical Technology Co., Ltd.). Some single clones were picked for positive detection and tested using primers GhDRP1-VIGS-F and GhDRP1-VIGS-R. The positive clones after detection were sent to the company for sequencing. After the sequence alignment was correct, the positive clones were expanded and the plasmids were extracted, and then transformed into Agrobacterium GV3101 (purchased from Tiangen Biochemical Technology Co., Ltd.). After detection, the positive bacterial solution was stored at -80℃ for later use.

[0032] The constructed TRV:GhDRP1 Agrobacterium GV3101 was inoculated into LB (1 g peptone, 0.5 g yeast powder, 0.5 g NaCl in 100 mL sterile water) medium at a ratio of 1:10, and activated at 180 rpm for about 10-12 h. The OD of the bacterial solution was 600When the concentration of bacterial culture solution reaches 1.0-1.2, collect the bacterial solution into an EP tube and resuspend it with resuspension solution (1 mL of 1M MES, 1M MgCl 2 1 mL, 0.1MAS 200 μL to 100 mL sterile water) to suspend the bacteria and adjust to OD 600 Between 0.8 and 1.0. Take cotton with flat cotyledons grown for about a week at 23°C with 16 h of light / 8 h of darkness, mix pTRV2 bacterial solution, pTRV:GhDRP1 and pTRV1 bacterial solution in a ratio of 1:1, and inject on the back of the cotton cotyledons. The injection area should reach more than 95%. After the injection is completed, keep it away from light for 12 hours and then culture it under normal light.

[0033] Example 3: TRV:GhDRP1 interference efficiency detection According to the gene sequence of TRV:GhDRP1 vector, the primers for fluorescence quantification were designed as follows: GhDRP1-qRT-F:GGCTGAATGCGGGCAATAG GhDRP1-qRT-R:AGGGTTCGGCAGTTCTATCC Three biological replicates were obtained from the true leaves of TRV:00 and TRV:GhDRP1 cotton plants that had been interfered for about 14 days. The RNA was extracted from cotton according to the steps and reagents provided by the polysaccharide and polyphenol plant total RNA extraction kit (DP441) of Tiangen Biotechnology Co., Ltd. The synthesis of cDNA was reverse transcribed using total RNA as a template using the ReverTra Ace qPCR RT Kit (Toyobo, Japan). The specific operation steps were as follows: 1 μg of total RNA was added with 1 μL Olig dT, and the mixture was made up to 13 μL with Nuclease-free Water, incubated at 65℃ for 2 min, and immediately placed on ice for 2 min. 2 μL 5 × RT buffer, 2 μL dNTPs, 0.5 μL RT Enzyme and 0.5 μL PRI were added respectively, with a total volume of 20 μL; the reaction was denatured and reversed at 50℃ for 60 min, and the enzyme was inactivated at 85℃ for 5 min to terminate the reaction. The cDNA sample obtained after reverse transcription was diluted 50 times for RT-PCR.

[0034] Reaction system: 10×Taq Buffer 2 μL, dNTP (10 mM) 0.4 μL, GhDRP1-qRT-F 30 μL, GhDRP1-qRT-R 30 mM, template (cDNA) 5 μL, Taq enzyme (5 U / μL) 0.1 μL ddH 2 O to make up to 20 μL; Amplification program: (95°C, 5 min; 95°C, 30 s; 58°C, 30 s; 72°C, 20 s; 28 cycles; 12°C, 10 min) qRT-PCR amplification: Reaction system: 2×Master Mix 5 μL, GhDRP1-qRT-F 20 mM, GhDRP1-qRT-R 20 mM, template (cDNA) 5 μL; Amplification program: 95℃, 10 s; 60℃, 30 s; 40 cycles; 12℃, 10 min). The gene encoding ubiquitin protein GhUBQ7 was used as an internal reference.

[0035] The PCR amplification products were detected by 1.2% gel electrophoresis ( Figure 2 a, b). qRT-PCR experiments were performed on the Roche LightCycler 96 real-time fluorescence quantitative PCR system. GhUBQ7 was used as the reference gene and three replicates were set for each reaction. −∆Ct The relative gene expression was calculated by Figure 2 c) by Figure 2 c It can be seen that the expression level of GhDRP1 gene in the leaves of TRV:GhDRP1 interference plants is only 18% of the expression level of GhDRP1 gene in the control TRV:00 plants.

[0036] Example 4: Determination of drought resistance of TRV:GhDRP1 interference materials The control TRV:00 and TRV:GhDRP1-intervention plants grew to the two-leaf and one-heart stage. There was no significant difference in plant height between the TRV:GhDRP1-intervention plants and the control TRV:00 plants. Water shortage treatment was started when the soil moisture content was 80%. After 10 days of continuous water shortage, the leaves of the control TRV:00 plants wilted more severely than those of the TRV:GhDRP1-intervention plants. The results showed that the survival rate of the TRV:GhDRP1-intervention plants was about 2.5 times that of the control TRV:00 plants after drought treatment and rehydration for 24 hours ( Figure 3 c), the above results show that TRV:GhDRP1 plants have stronger drought resistance than the control TRV:00 ( Figure 3 a), indicating that GhDRP1 negatively regulates cotton drought resistance.

[0037] Example 5: Creation of GhDRP1 gene CRISPR / Cas9 material First, design the target site containing the GhDRP1 gene-specific sequence, i.e., sgRNA: sgRNA1 (SEQ ID No.3):ACTGCCTTCGCTCTCACCGT; sgRNA2 (SEQ ID No. 4): GTTCAATAAACGATCCTCGC; The first round of PCR amplification was performed using pYLgRNA-AtU3b and pYLgRNA-AtU6-29 as templates: 20 μL reaction system: 2×KOD Buffer 10 μL, pYLgRNA-AtU3b or pYLgRNA-AtU6-29 (20-50 ng), primer UF 40mM / GhDRP1-SgRNA1-R 20 mM, GhDRP1-SgRNA2-R 20 mM; GhDRP1-sgRNA1-F 20 mM, GhDRP1-SgRNA2-F 20 mM / gR-R 40 mM, gently mix; the primer sequences involved are: GhDRP1-SgRNA1-F (SEQ ID No.5): ACTGCCTTCGCTCTCACCGTGTTTTAGAGCTAGAAAT; GhDRP1-SgRNA1-R (SEQ ID No. 6): ACGGTGAGAGCGAAGGCAGTCAATCTCTTAGTCGACT; GhDRP1-SgRNA2-F (SEQ ID No.7): GTTCAATAAACGATCCTCGCGTTTTAGAGCTAGAAAT; GhDRP1-SgRNA2-R (SEQ ID No.8): GCGAGGATCGTTTATTGAACTGACCAATGTTGCTCC.

[0038] UF: CTCCGTTTTACCTGTGGAATCG; gR-R:CGGAGGAAAATTCCATCCAC.

[0039] The amplification program was: 98℃, 10 s; 68℃, 5 s; 42 cycles; 12℃, 10 min. The gene products containing the promoters and sgRNA fragments of pYLgRNA-AtU3b and pYLgRNA-AtU6-29 were cloned and detected by 1% agarose gel electrophoresis. The second round of PCR amplification used the first round of PCR products as templates: 20 μL reaction system: 2×KOD Buffer 10 μL, the first round of PCR mixed product 20-50 ng, primers Pps-GGL / Pgs-GG2 30 / 30 mM, Pps-GG2 / Pgs-GGR 30 / 30 mM, filled to 20 μL with ddH2O, and gently mixed; the primer sequences involved were: Pps-GGL:TTCAGAggtctcTctcgACTAGTATGGAATCGGCAGCAAAGG; Pgs-GG2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC; Pps-GG2:TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG; Pgs-GGR:AGCGTGggtctcGaccgACGCGTATCCATCCACTCCAAGCTC.

[0040] The amplification program was as follows: 98℃, 10 s; 68℃, 5 s; 42 cycles; 12℃, 10 min to clone the complete sgRNA1 / 2 expression cassette. The second round of PCR products were purified and recovered, and the size and concentration of the amplified products were detected by agarose gel electrophoresis. The Cas9 gene and the sgRNA1 / 2 expression cassette were assembled in tandem on the modified cotton CRISPR / Cas9 vector using the Golden Gate method.

[0041] 15 μL reaction system: 10×CutSmart Buffer 1.5 μL, 10 mM ATP 1.5 μL, CRISPR / Cas9-P35-N (gene editing vector was kindly donated by Professor Liu Yaoguang of South China Agricultural University) 80-150 ng, sgRNA expression cassette mixture 20-50 ng, BsaⅠ-HF 0.5 μL (10 U), T4 DNA Ligase 0.2 μL (80 U). Mix gently and transform Escherichia coli DH5α by heat shock. Positive clones were screened using kanamycin resistance, and the grown colonies were identified by PCR using the SP-L2 (GTCGTGCTCCACATGTTGACCG) and SP-R (CCGACATAGATGCAATAACTTC) vector primer pairs for sgRNA1 and sgRNA2 expression cassettes. Finally, the correctly sequenced single clone plasmid was transformed into Agrobacterium LBA4404, and the hypocotyls of yellowed cotton seedlings were transformed using the Agrobacterium-mediated cotton genetic transformation method. Through a series of processes such as cell dedifferentiation, redifferentiation, and plant regeneration, gene-edited plants were finally obtained.

[0042] Example 6: Drought resistance test of ghdrp1 mutant materials Wild-type and ghdrp1 mutant plants were treated with drought when they reached the 2-leaf-1-heart stage. Figure 4 As shown: after 10 days of continuous water shortage, all leaves of wild-type plants wilted, while only cotyledons of ghdrp1 mutant plants showed wilting, and true leaves did not show the wilting phenotype. After the mutant plants were rehydrated for 12 hours, the survival rate of the mutants was about 2.5 times that of the wild-type, and there was no significant difference in plant height between the wild-type and ghdrp1 mutant plants. The above results indicate that ghdrp1 mutant plants have stronger drought resistance than the wild type.

[0043] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Application of gene GhDRP1 in negative regulation of cotton drought, characterized by: The amino acid sequence of the protein encoded by the gene GhDRP1 is more than 90% similar to the amino acid sequence shown in SEQ ID No.

2.

2. The use of the gene GhDRP1 in negatively regulating cotton drought according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the gene GhDRP1 is shown in SEQ ID No.

2.

3. The use of the gene GhDRP1 in negatively regulating cotton drought according to claim 1, characterized in that: The nucleotide sequence of the gene GhDRP1 is more than 75% similar to the nucleotide sequence shown in SEQ ID No.

1.

4. The use of the gene GhDRP1 in negatively regulating cotton drought according to claim 3, characterized in that: The nucleotide sequence of the gene GhDRP1 is shown in SEQ ID No.

1.

5. Application of gene GhDRP1 in negative regulation of cotton drought, characterized in that: The application is achieved by inhibiting or knocking out the gene GhDRP1 in plants by gene interference.

6. The use of the gene GhDRP1 in negatively regulating cotton drought according to claim 5, characterized in that: The gene interference method is RNAi technology or gene editing.

7. A method for cultivating drought-resistant cotton, characterized in that: The method is to inhibit or knock out the gene GhDRP1 in cotton plants, and the nucleotide sequence of the gene GhDRP1 is shown in SEQ ID No.

1.

8. The method for cultivating drought-resistant cotton according to claim 7, characterized in that: The inhibition is achieved by constructing a VIGS expression vector of the gene GhDRP1, and then injecting it into the back of the cotton cotyledon through the Agrobacterium transformation method. After the injection, the vector is protected from light for 12 hours and then cultured under normal light.

9. The method for cultivating drought-resistant cotton according to claim 8, characterized in that: The injection area should exceed 95% of the cotton cotyledon area.

10. The method for cultivating drought-resistant cotton according to claim 7, characterized in that: The knockout was achieved by using gene editing technology to construct a CRISPR / Cas9 recombinant vector of the gene GhDRP1, which was then transferred into the hypocotyls of yellow cotton seedlings by Agrobacterium transformation to obtain gene-edited plants.

Images