A glycosyltransferase ugt76g1 mutant and a method for catalyzing synthesis of rebaudioside a

Abstract

This invention discloses a glycosyltransferase UGT76G1 mutant and a method for catalyzing the synthesis of rebaudioside A, belonging to the field of biocatalytic synthesis technology. The glycosyltransferase UGT76G1 mutant is any one of the following (A)-(C): (A) a protein obtained by any one or more mutations of the following amino acid sequence shown in SEQ ID NO.1: amino acid 109 is mutated from L to Q; amino acid 113 is mutated from S to C; amino acid 424 is mutated from I to F; (B) a protein with more than 95% identity to the amino acid sequence defined in (A) and having the same function; (C) a fusion protein obtained by attaching a tag to the end of the protein defined in (A) or (B). The glycosyltransferase UGT76G1 mutant of this invention has high enzyme activity and can efficiently synthesize rebaudioside A using steviol glycoside STV as a substrate.

Description

Technical Field

[0001] This invention relates to the field of biocatalytic synthesis technology, and in particular to a glycosyltransferase UGT76G1 mutant and a method for catalyzing the synthesis of rebaudioside A. Background Technology

[0002] Rebaudioside A is a natural sweetener extracted from the leaves of the stevia plant. It is calorie-free, does not participate in human blood glucose metabolism, and is suitable for diabetics. Multiple international food safety agencies have approved its use as a food additive, deeming it safe within permitted limits. Compared to other steviol glycosides in stevia extract, rebaudioside A is known for its taste, which is closer to sucrose. It has no noticeable bitter aftertaste or metallic flavor, offering a purer, sweeter taste. Furthermore, it exhibits good stability at high temperatures, making it suitable for formulations in heat-processed foods and beverages, as its sweetness does not significantly change or degrade upon heating.

[0003] Rebaudioside A has an extremely high sweetness, typically considered to be 200 to 450 times sweeter than sucrose. Due to its exceptionally high sweetness, only a very small amount is needed to achieve a similar sweetness to sucrose, thus significantly reducing the calorie intake of food or beverages. Because of its low-calorie properties, rebaudioside A is widely used in the development of various low-sugar, sugar-free, and reduced-sugar products, such as beverages, candies, baked goods, condiments, and table sugars, meeting consumers' demands for healthy eating.

[0004] Rebaudioside A is usually extracted from stevia leaves using separation and purification techniques, but the yield of rebaudioside A obtained by this method is relatively low and cannot meet the high market demand. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a glycosyltransferase UGT76G1 mutant and a method for catalyzing the synthesis of rebaudioside A, in order to overcome the problem of low yield of rebaudioside A in the prior art.

[0006] In a first aspect, the present invention provides a glycosyltransferase UGT76G1 mutant, wherein the UGT76G1 mutant is any one of the following (A)-(C):

[0007] (A) Proteins obtained by performing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.1:

[0008] The amino acid at position 109 is mutated from L to Q;

[0009] The 113th amino acid is mutated from S to C;

[0010] The 424th amino acid is mutated from I to F;

[0011] (B) is a protein with more than 95% identity to the amino acid sequence defined by (A) and has the same function;

[0012] (C) A fusion protein obtained by attaching a tag to the end of the protein defined in (A) or (B).

[0013] Compared with existing technologies, the glycosyltransferase UGT76G1 mutant provided by this invention exhibits higher enzyme activity than the wild-type glycosyltransferase UGT76G1, enabling efficient synthesis of rebaudioside A using steviol STV as a substrate. The optimal mutant, 68S, can convert 60 mM steviol STV into 60 mM rebaudioside A within 18 hours, effectively converting all steviol STV into rebaudioside A, demonstrating excellent application prospects in industrial production.

[0014] Furthermore, the amino acid sequence of the glycosyltransferase UGT76G1 mutant is shown in SEQ ID NO.3.

[0015] In a second aspect, the present invention provides any of the following biomaterials:

[0016] (A) An expression gene that encodes the above-mentioned glycosyltransferase UGT76G1 mutant;

[0017] (B) A recombinant plasmid having the expression gene described in (A) linked to it;

[0018] (C) A recombinant cell containing the recombinant expression plasmid or the expression gene of the UGT76G1 mutant.

[0019] The above-mentioned expressed gene is obtained by one or more of the following mutations in SEQ ID NO.2:

[0020] In SEQ ID NO.2, bits 325-327 are replaced by CAG instead of CTG;

[0021] In SEQ ID NO.2, bits 337-339 are replaced by TGC;

[0022] Bits 1270-1272 of SEQ ID NO.2 are replaced with TTG;

[0023] Preferably, the nucleotide sequence of the expressed gene is shown in SEQ ID NO.4.

[0024] Thirdly, the present invention provides an enzyme composition comprising: a glycosyltransferase UGT76G1 mutant and a sucrose synthase AtSUS;

[0025] Sucrose synthase AtSUS is either (B1) or (B2) as follows: The amino acid sequence of (B1) is shown in SEQ ID NO.5;

[0026] Proteins whose amino acid sequences defined by (B2) and (B1) are more than 95% identical and have the same function.

[0027] Fourthly, the present invention provides a complete set of recombinant strains expressing the above-mentioned enzyme composition, comprising recombinant strain A and recombinant strain B: recombinant strain A contains recombinant plasmid A, which is obtained by constructing the coding gene of the mutant glycosyltransferase UGT76G1 into an expression vector; recombinant strain B contains recombinant plasmid B, which is obtained by constructing the coding gene of sucrose synthase AtSUS into a plasmid; the sequence of the coding gene of sucrose synthase AtSUS is shown in SEQ ID NO. 6.

[0028] Furthermore, the host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, or Corynebacterium glutamicum.

[0029] Fifthly, the present invention provides a method for synthesizing rebaudioside A using a glycosyltransferase UGT76G1 mutant, comprising the following steps:

[0030] Stevioside STV, UDPG, sucrose, and the enzyme combination or the induced expression enzyme product of the above-mentioned recombinant strains are added to the catalytic reaction system. The reaction is carried out, the enzyme is inactivated, and the supernatant is obtained by centrifugation. The supernatant contains rebaudioside A.

[0031] Compared with existing technologies, this invention uses steviol glycosides STV, UDPG, and sucrose as reaction substrates, and couples the glycosyltransferase UGT76G1 mutant with sucrose synthase AtSUS to catalyze the reaction. This not only enables the recycling and regeneration of the substrate UDPG to efficiently generate rebaudioside A, but also allows for the indirect measurement of glycosyltransferase activity based on the quantitative analysis of fructose in the product, thereby screening out superior mutants with high enzyme activity.

[0032] Furthermore, the inducible expression enzyme products of the above-mentioned complete set of recombinant strains include inducible expression enzyme product A and inducible expression enzyme product B;

[0033] The method for obtaining the induced expression enzyme product A includes the following steps:

[0034] The seed culture of the above recombinant strain A was inoculated into a culture medium containing kanamycin sulfate, and the OD of the culture medium was measured. 600When the concentration reaches 0.6–0.8, add L-arabinose and continue induction culture for 8–40 h. Centrifuge and collect the bacterial cells, break the cells, centrifuge again, and collect the supernatant, which is the induced expression enzyme product A; the inoculum size is 1 v / v%; the final concentration of kanamycin sulfate is 10–100 μg / mL; and the final concentration of L-arabinose is 0.1–15 mM.

[0035] The method for obtaining the induced expression enzyme product B includes the following steps:

[0036] The seed culture of the above recombinant strain B was inoculated into a medium containing kanamycin sulfate and cultured at 30–40°C and 200–300 rpm until OD500. 600 When the concentration reaches 0.6–0.8, add L-arabinose and continue culturing for 8–40 h. Centrifuge and collect the bacterial cells, break the cells, centrifuge again, and collect the supernatant, which is the induced expression enzyme product B. The inoculum size is 1 v / v%. The final concentration of kanamycin sulfate is 10–100 μg / mL. The final concentration of L-arabinose is 0.1–15 mM.

[0037] Furthermore, the concentration of steviol glycoside STV in the catalytic reaction system is 10–100 mM, the concentration of UDPG is 0.1–5 mM, the concentration of sucrose is 50–800 mM, the amount of induced expression enzyme product of recombinant strain A is 0.1–50 mL, and the amount of induced expression enzyme product of recombinant strain B is 0.1–50 mL.

[0038] Furthermore, in the above catalytic reaction system, the pH value is 5.0–8.0, the temperature is 25–60℃, and the reaction time is 5–30 h. Attached Figure Description

[0039] Figure 1 The yield of rebaudioside A (RA) under the catalysis of different glycosyltransferase UGT76G1 mutants in Example 3.

[0040] Figure 2 The yield of rebaudioside A (RA) in Example 4 changes with conversion time. Detailed Implementation

[0041] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.

[0042] Example 1

[0043] Preparation of recombinant bacteria expressing sucrose synthase AtSUS

[0044] Using Inf-pYB1k-atsus-F and Inf-pYB1k-atsus-R as primers, and with cDNA of the Arabidopsis-derived sucrose synthase AtSUS as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct atsus gene fragment. The sequence of the encoding gene for sucrose synthase AtSUS is shown in SEQ ID NO.6. The amino acid sequence of sucrose synthase AtSUS is shown in SEQ ID NO.5.

[0045] Inf-pYB1k-atsus-F:GCTAACAGGAGGAATTAACCATGGAAAATAAAACG GAGACC(SEQ IDNO.7)

[0046] Inf-pYB1k-atsus-R:CCAGATCTACCCTCGAGTTACAACGATGAAATGTAA GAAAC(SEQ IDNO.8)

[0047] Using pYB1k-F and pYB1k-R as primers and the empty pYB1k vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct pYB1k expression vector fragment. (You R, Wang L, Shi C, Chen H, Zhang S, Hu M, Tao Y. Efficient production of myo-inositol in Escherichia coli through metabolic engineering. Microb. Cell Fact. 2020 May 24; 19(1):109. This pYB1k vector has been disclosed.)

[0048] pYB1k-F:CTCGAGGGTAGATCTGGTAC (SEQ ID NO.9)

[0049] pYB1k-R:GGTTAATTCCTCCTGTTAGC (SEQ ID NO.10)

[0050] The Gibson assembly method was used to ligate the AtSUS gene fragment and the pYB1k expression vector fragment.

[0051] The Gibson ligation product was added to *E. coli* DH5α competent cells (Beijing TransGen Biotech Co., Ltd.), incubated on ice for 30 min, then incubated in a 42°C water bath for 90 s, and then placed on ice for 2 min. *E. coli* was then added to 1 mL of LB medium, and the cells were incubated at 37°C on a shaker for 1 h. Finally, the cells were plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Multiple single clones were cultured, and PCR verification was performed using primers pBAD-F and atsus-F300-R. Positive clones with the correct target sequence size were selected, cultured, and plasmids were extracted to obtain the positive clone plasmid pYB1k-atsus.

[0052] pBAD-F:GATTATTTGCACGGCGTCAC(SEQ ID NO.11)

[0053] atsus-F300-R:CTTGTGGGTCGTTGTCGAGGATG(SEQ ID NO.12)

[0054] The plasmid pYB1k-atsus was transformed into E. coli BW25113 competent cells, then plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Positive clones containing the pYB1k-atsus plasmid were selected, which were the recombinant E. coli expressing sucrose synthase AtSUS.

[0055] Example 2

[0056] Preparation of recombinant bacteria expressing wild-type glycosyltransferase UGT76G1

[0057] Using Inf-pRB1k-ugt76g1-F and Inf-pRB1k-ugt76g1-R as primers, and with cDNA of the glycosyltransferase UGT76G1 from wild-type stevia as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct ugt76g1 gene fragment.

[0058] Inf-pRB1k-ugt76g1-F:

[0059] CTAACAGGAGGAATTAACCATATGGCCGAAAACAAGACCGA(SEQ ID NO.13)

[0060] Inf-pRB1k-ugt76g1-R:

[0061] GTACCAGATCTACCCTCGAGTTACAAAGAGGAAATGTAAGA(SEQ ID NO.14)

[0062] Using pRB1k-XhoI-F and pRB1k-NcoI-R as primers and the empty pRB1k vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibote Biotechnology Co., Ltd.) to obtain the correct pRB1k expression vector fragment. (This pRB1k vector was previously disclosed in Qun Liu, Baixue Lin, Yong Tao. Improved methylation in E. coli via an efficient methyl supply system driven by betaine. Metabolic Engineering, Volume 72, 2022, 46-55).

[0063] pRB1k-XhoI-F:CTCGAGGGTAGATCTGGTAC (SEQ ID NO.15)

[0064] pRB1k-NcoI-R:GGTTAATTCCTCCTGTTAGC (SEQ ID NO.16)

[0065] The ugt76g1 gene fragment and the pRB1k expression vector fragment were ligated using the Gibson assembly method. The Gibson ligation product was added to *E. coli* DH5α competent cells (Beijing TransGen Biotech Co., Ltd.), incubated on ice for 30 min, then in a 42°C water bath for 90 s, followed by 2 min on ice. The mixture was then added to 1 mL of LB medium and incubated at 37°C for 1 h in a shaker. Finally, it was plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Multiple single-clone strains were cultured, and PCR verification was performed using primers pBAD-F and ugt76g1-F300-R. Positive clones with the correct target sequence size were selected, cultured, and plasmids were extracted to obtain the positive clone plasmid pRB1k-ugt76g1.

[0066] pBAD-F:GATTATTTGCACGGCGTCAC(SEQ ID NO.11)

[0067] ugt76g1-F300-R:CTGCAGTTCCAGTTCACGAC(SEQ ID NO.17)

[0068] The plasmid pRB1k-ugt76g1 was transformed into Escherichia coli BW25113 competent cells, then plated on LB agar plates containing kanamycin and incubated overnight at 37°C. The next day, positive clones containing pRB1k-ugt76g1 were selected, which were the recombinant Escherichia coli expressing the wild-type glycosyltransferase UGT76G1.

[0069] Example 3

[0070] Construction of a library of glycosyltransferase UGT76G1 mutants and screening of superior mutants

[0071] The wild-type glycosyltransferase UGT76G1 gene sequence was randomly mutated using error-prone PCR to construct a mutant library. Using ugt76g1-ATG-F and ugt76g1-TAA-R primers and pRB1k-ugt76g1 plasmid as a template, ep-PCR amplification was performed using rTaq DNA polymerase (TAKARA) due to its low-fidelity nature. The amplification system and procedure are shown in Tables 1 and 2.

[0072] ugt76g1-ATG-F:ATGGCCGAAAACAAGACCGA(SEQ ID NO.18)

[0073] ugt76g1-TAA-R:TTACAAAGAGGAAATGTAAG(SEQ ID NO.19)

[0074] Table 1 Error-prone PCR amplification systems

[0075]

[0076] Table 2 Commonly Misunderstood PCR Amplification Procedures

[0077]

[0078]

[0079] The PCR product was purified to obtain the UGT76G1 mutant gene fragment. The UGT76G1 mutant gene fragment was ligated to the vector pRB1k using the Gibson seamless ligation kit to obtain a complete plasmid mutant library containing the UGT76G1 mutant gene. The Gibson ligation reaction system is shown in Table 3.

[0080] Table 3 Gibson linkage reaction system

[0081]

[0082] After reacting in a 50℃ water bath for 1 hour, the Gibson ligation product was transferred to *E. coli* DH5α competent cells for culture. After culturing, the *E. coli* cells were placed in a shaker for 1 hour to recover. Following recovery, the *E. coli* cells were plated and incubated at 37℃ for 12 hours. Once colonies grew, five single-clone strains were randomly selected, cultured, and their plasmids were extracted and sequenced. Subsequently, colonies on the plate were scraped with a glass rod to extract plasmids, yielding a plasmid mutant library, which was stored at -20℃ for subsequent high-throughput screening of the mutant library.

[0083] The high-throughput screening steps are as follows:

[0084] (1) After the construction of the glycosyltransferase UGT76G1 mutant library was completed, single colonies on the plate were picked with a toothpick that had been sterilized by high temperature and high pressure and inoculated into a 96-well plate containing 800 μL of LB medium (containing kanamycin sulfate). Seed culture was obtained by shaking in a 96-well plate at 37℃ and 900 rpm for 24 h.

[0085] (2) Dip the inoculation needle into the seed culture and transfer it to another new 96-well LB medium containing kanamycin sulfate (final concentration 50 μg / mL). Incubate at 37°C and 900 rpm until OD is achieved. 600 When the concentration reaches 0.6–0.8, add 1 mM L-arabinose to a final concentration and continue induction culture for 22 h in a 96-well plate at 30°C and 900 rpm. After induction culture, centrifuge at 3000 × g for 20 min and collect the bacterial cells. Add lysozyme solution to each well, mix thoroughly, and allow the lysozyme to fully act on the cells, lysing the cells and releasing the intracellular enzyme. After cell lysis, centrifuge at 4°C and 3000 × g for 20 min in a refrigerated centrifuge to obtain the glycosyltransferase UGT76G1 mutant enzyme solution.

[0086] (3) Preparation of AtSUS enzyme solution: Seed culture of recombinant E. coli expressing sucrose synthase AtSUS was taken with an inoculation needle and transferred to an Erlenmeyer flask containing 10 mL of LB medium. The medium also contained kanamycin sulfate (final concentration 50 μg / mL). The culture was carried out in a shaker at 37℃ and 220 r / min. When OD... 600 When the concentration reaches 0.6–0.8, L-arabinose with a final concentration of 1 mM is added. After culturing at 30°C and 220 r / min for 22 h, the cells are collected by centrifugation and ultrasonic disruption. The cells are then centrifuged at 5000 × g for 5 min to obtain the sucrose synthase AtSUS enzyme solution.

[0087] (4) Mix 25 mM steviol glycoside STV, 150 mM sucrose, 2.5 mM UDPG, 0.16 mL AtSUS enzyme solution, 0.16 mM LUGT76G1 mutant enzyme solution, and 100 mM sodium phosphate buffer. Incubate at 37°C for 7 h, then heat for 5 min to terminate the reaction. The pH of the reaction system is 7.

[0088] (5) DNS detection: Centrifuge at 3000×g for 20 min at 4°C in a refrigerated centrifuge and collect the supernatant. Add 70 μL of the reaction supernatant and 210 μL of DNS to a clean 96-well plate, mix well, and heat for 5 min to perform the DNS colorimetric reaction. After cooling to room temperature, centrifuge at 3000×g for 18 min, and transfer 200 μL of the supernatant to a 96-well microplate for OD detection using a microplate reader. 540 Numerical values. Filter out OD. 540 The reaction solution with high values ​​used the UGT76G1 mutant and was retested in vials.

[0089] (6) Small-bottle validation: OD was obtained by screening with a 96-well plate. 540 After using the mutant in the high-value reaction solution, single colonies of UGT76G1 mutant, wild-type UGT76G1, and recombinant E. coli expressing sucrose synthase AtSUS were picked and inoculated into test tubes, respectively. The tubes were then incubated in a shaker at 37°C and 220 rpm for 12 h to obtain seed culture. The seed culture was then inoculated into 20 mL LB medium (containing kanamycin sulfate at a final concentration of 50 μg / mL) at a 1% volume ratio, and incubated at 37°C and 220 rpm until OD was obtained. 600 L-arabinose was added to a final concentration of 1 mM at pH values ​​of 0.6-0.8 for induction, and the cells were cultured at 30℃ and 220 rpm for 18 h. After the culture was completed, the bacterial cells were collected by centrifugation (5000×g for 10 min), resuspended in 0.51 mL of 100 mM pH 8.0 sodium phosphate buffer, and then the cells were lysed and centrifuged to obtain UGT76G1 mutant enzyme solution, wild-type UGT76G1 enzyme solution, and sucrose synthase AtSUS enzyme solution for subsequent experiments.

[0090] The reaction system consisted of 25 mM steviol glycoside STV, 150 mM sucrose, 2.5 mM UDPG, 0.5 mL UGT76G1 mutant enzyme solution or wild-type UGT76G1 enzyme solution, 0.2 mL AtSUS enzyme solution, and 100 mM sodium phosphate buffer to a total volume of 10 mL. The pH of the reaction system was 7. After reacting in a water bath at 37°C for 7 hours, the reaction was terminated by boiling for 5 minutes. The supernatant was then centrifuged at 10000 × g for 2 minutes for DNS detection, and the OD was analyzed. 540The reaction products catalyzed by mutants with higher values ​​than wild-type UGT76G1 were analyzed by HPLC to verify the yield of rebaudioside A (RA).

[0091] After multiple initial screenings and vial re-screenings of the UGT76G1 mutant library using 96-well plates, six superior mutants were ultimately selected from nearly 35,000 mutants. These mutants exhibited higher enzyme activities than the wild type, and significantly improved efficiency in catalyzing the synthesis of rebaudioside A from steviol STV. The yield of rebaudioside A from these superior mutants in vial re-testing was as follows: Figure 1 As shown in the figure. The yield of rebaudioside A synthesized using mutant 68S was more than 30 times higher than that of wild-type UGT76G1. Mutant 68S, as sequenced, is obtained by mutating the amino acid sequence shown in SEQ ID NO.1 as follows: amino acid position 109 is mutated from L to Q, amino acid position 113 is mutated from S to C, and amino acid position 424 is mutated from I to F.

[0092] Example 4

[0093] Scale-up study of the synthesis of rebaudioside A by the optimal mutant 68S

[0094] Seed cultures of mutant 68S and sucrose synthase AtSUS were inoculated separately into 400 ml LB medium (containing kanamycin sulfate at a final concentration of 50 μg / mL) at a volume ratio of 1%, and cultured at 37°C with shaking at 220 rpm until OD was achieved. 600 L-arabinose was added to a final concentration of 1 mM at pH values ​​of 0.6-0.8 for induction, and the cells were cultured at 30℃ and 220 rpm for 18 h. After the culture was completed, the bacterial cells were collected by centrifugation (5000×g for 10 min), resuspended in 10.5 mL of 100 mM pH 8.0 sodium phosphate buffer, and then the cells were lysed and centrifuged to obtain UGT76G1 mutant 68S enzyme solution and sucrose synthase AtSUS enzyme solution.

[0095] The reaction system was as follows: 60 mM steviol glycoside STV, 360 mM sucrose, 3 mM UDPG, 10 mL AtSUS enzyme solution, 10 mL 68S enzyme solution, and 100 mM sodium phosphate buffer to a final volume of 100 mL. The reaction was carried out at 37°C for 18 h. The pH of the reaction system was 7.

[0096] The reaction solution was sampled every 4 hours, and the yield of rebaudioside A was analyzed by HPLC as a function of conversion time. The results are as follows: Figure 2 As shown, the optimal mutant 68S can convert 60mM steviol STV into 60mM rebaudioside A within 18 hours, meaning that all steviol STV can be converted into rebaudioside A.

[0097] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A glycosyltransferase UGT76G1 mutant, characterized in that, The UGT76G1 mutant is any one of the following (A)-(B): (A) The protein obtained by making the following mutations based on the amino acid sequence shown in SEQ ID NO.1: The amino acid at position 109 is mutated from L to Q; The 113th amino acid is mutated from S to C; The 424th amino acid is mutated from I to F; (B) A fusion protein obtained by attaching a tag to the end of the protein defined in (A).

2. The glycosyltransferase UGT76G1 mutant according to claim 1, characterized in that, The amino acid sequence of the UGT76G1 mutant is shown in SEQ ID NO.

3.

3. Any of the following biological materials: (A) An expression gene encoding the UGT76G1 mutant of claim 1 or 2; (B) A recombinant plasmid having the expression gene described in (A) attached thereto; (C) A recombinant cell containing the expression gene of the recombinant plasmid or the UGT76G1 mutant.

4. An enzyme composition, characterized in that, The enzyme composition comprises: a glycosyltransferase UGT76G1 mutant and a sucrose synthase AtSUS; the glycosyltransferase UGT76G1 mutant is as described in claim 1 or 2; The amino acid sequence of the sucrose synthase AtSUS is shown in SEQ ID NO.

5.

5. A complete recombinant bacterial strain expressing the enzyme composition of claim 4, characterized in that, The recombinant strain includes recombinant strain A and recombinant strain B: recombinant strain A contains recombinant plasmid A, which is obtained by constructing the encoding gene of the glycosyltransferase UGT76G1 mutant as described in claim 1 or 2 into an expression vector; recombinant strain B contains recombinant plasmid B, which is obtained by constructing the encoding gene of sucrose synthase AtSUS into a plasmid.

6. The complete set of recombinant strains according to claim 5, characterized in that, The host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, or Corynebacterium glutamicum.

7. A method for synthesizing rebaudioside A using a glycosyltransferase UGT76G1 mutant, characterized in that, Includes the following steps: Stevioside STV, UDPG, sucrose, and the enzyme composition of claim 4 or the induced expression enzyme product of the complete set of recombinant strains in claim 5 are added to the catalytic reaction system. The reaction is carried out, the enzyme is inactivated, and the supernatant is obtained by centrifugation. The supernatant contains rebaudioside A.

8. The method according to claim 7, characterized in that, The inducible expression enzyme products of the complete set of recombinant strains in claim 5 include inducible expression enzyme product A and inducible expression enzyme product B; The method for obtaining the induced expression enzyme product A includes the following steps: The seed culture of recombinant strain A from claim 5 was inoculated into a culture medium containing kanamycin sulfate, and the OD of the culture medium was... 600 When the concentration reaches 0.6-0.8, L-arabinose is added and the culture is continued for 8-40 hours. The cells are then collected by centrifugation, the cells are broken up, centrifuged again, and the supernatant is collected as the induced expression enzyme product A. The inoculum volume of the seed culture is 1% by volume. The final concentration of kanamycin sulfate is 10-100 μg / mL. The final concentration of L-arabinose is 0.1-15 mM. The method for obtaining the induced expression enzyme product B includes the following steps: The seed culture of recombinant strain B from claim 5 was inoculated into a culture medium containing kanamycin sulfate and cultured at 30-40°C and 200-300 r / min until OD. 600 When the concentration reaches 0.6-0.8, add L-arabinose and continue culturing for 8-40 hours. Centrifuge and collect the bacterial cells, break the cells, centrifuge again, and collect the supernatant, which is the induced expression enzyme product B. The inoculum volume of the seed culture is 1% by volume. The final concentration of kanamycin sulfate is 10-100 μg / mL. The final concentration of L-arabinose is 0.1-15 mM.

9. The method according to claim 7 or 8, characterized in that, In the catalytic reaction system, the concentration of steviol glycoside STV is 10-100 mM, the concentration of UDPG is 0.1-5 mM, the concentration of sucrose is 50-800 mM, the amount of inducible expression enzyme product of recombinant strain A is 0.1-50 mL, and the amount of inducible expression enzyme product of recombinant strain B is 0.1-50 mL.

10. The method according to claim 7, characterized in that, The catalytic reaction system has a pH of 5.0 to 8.0, a temperature of 25 to 60°C, and a reaction time of 5 to 30 hours.

Images