Double-tandem base editor as well as preparation method and application thereof

Abstract

The invention provides a double-tandem base editor as well as a preparation method and application thereof, and belongs to the technical field of gene editing. The double tandem base editor disclosed by the invention is obtained by recombining a gRNA1-tRNA-gRNA2 unit component and an adenine base editor, the gRNA1 is designed for a target gene 1 and comprises a gRNA target specific spacer region and a gRNA skeleton of the target gene 1; the gRNA 2 is designed for a target gene 2 and comprises a gRNA target specific spacer region and a gRNA skeleton of the target gene 2. According to the double tandem base editor provided by the invention, different gene loci can be targeted only by changing 20bp gRNA, multi-gene editing on large animal cells is realized, accurate and safe multi-gene editing is realized under the condition of not introducing double-strand breakage, and the mutation efficiency is higher than that of a multi-plasmid co-transfection base editor.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and specifically relates to a double-tandem base editor and a preparation method and application thereof. Background Art

[0002] Gene editing, also known as genome editing or genome engineering, is a relatively precise genetic engineering technology that can modify specific target genes in the genome of an organism. Currently, CRISPR / Cas9 is the most commonly used gene editing tool, which consists of a single guide RNA (gRNA) and Cas9 protein. After the gRNA targets the binding site, the Cas9 protein cuts the DNA and produces DNA double-strand breaks (DBS), which will induce cells to activate homology-directed repair (HDR) and non-homologous end joining (NHEJ). NHEJ is a rapid DSB repair mechanism that connects broken DNA double strands. This repair mechanism is uncontrollable, and the number of inserted and deleted bases cannot be controlled. Large-scale deletion of the genome and genome rearrangement cause safety risks. HDR relies on the insertion of a DNA template (donor DNA) to repair DSB. Although the repair mechanism is accurate, it is inefficient. CRISPR / Cas9 gene editing can effectively modify genes in many large animals, but there is a risk of causing double-strand breaks in the genome. In order to avoid the side effects caused by DSB, base editing technology has been developed based on CRISPR / Cas9, which can achieve single-base editing without introducing double-strand breaks. For example, the adenine base editor (ABE) fuses Cas9, which only cuts single-stranded DNA, with the Escherichia coli RNA adenine deaminase TadA. Under gRNA recognition, the 4-8 AT base pairs are converted to GC base pairs to achieve genome mutations. Although single-gene editing can improve a single economic trait, in practice, the demand for the coordinated improvement of multiple traits of agricultural organisms is increasing. Changing only a single trait cannot meet people's high-quality needs. Therefore, the development of multi-gene editors is urgently needed.

[0003] The polycistronic tRNA gRNA-processing system (PTG) can simultaneously express multiple gRNAs through a single transcript and target the corresponding gene targets, thereby achieving simple and efficient multi-gene editing. At present, this strategy has been successfully applied to multi-gene editing in plants, and plant cells have relatively good tolerance to multiple gene editing. However, when performing multi-gene editing on large animal cells, due to the delivery efficiency of gene editing tools, it is difficult to deliver multiple editing tools into cells at the same time and achieve efficient editing. At present, the construction of multi-gene editing pigs, cattle, sheep, etc. usually uses multiple CRISPR / Cas9 vectors targeting a single gene to co-transfect cells, screen out cell lines with multiple gene editing at the same time, and then produce multi-gene editing animals through somatic cell cloning. Although this method is feasible, it has been proven to be inefficient in practice. Therefore, it is urgent to develop efficient and accurate multi-gene editing tools to produce multi-gene editing of large animals. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide a double-tandem base editor that can achieve precise and safe dual-gene editing without introducing double-strand breaks, and the mutation efficiency is higher than that of the base editor co-transfected with the plasmid.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a double tandem base editor, which is obtained by recombining a gRNA1-tRNA-gRNA2 unit component and an adenine base editor; the gRNA1 is designed for target gene 1, including a gRNA target-specific spacer region and a gRNA skeleton of target gene 1; the gRNA2 is designed for target gene 2, including a gRNA target-specific spacer region and a gRNA skeleton of target gene 2.

[0007] Preferably, in the gRNA1-tRNA-gRNA2 unit component, the nucleotide sequence of the gRNA skeleton is shown as SEQ ID NO.1, and the nucleotide sequence of the tRNA is shown as SEQ ID NO.2.

[0008] Preferably, the adenine base editor is obtained by recombination of a vector backbone and an expression element, the nucleotide sequence of the expression element is shown in SEQ ID NO.3, and the vector backbone is a PX459 plasmid.

[0009] Preferably, the target gene 1 is the porcine CD163 gene, and the target gene 2 is the porcine MSTN gene; the nucleotide sequence of the gRNA1-tRNA-gRNA2 unit component is shown in SEQ ID NO.4.

[0010] Preferably, the target gene 1 is the porcine MSTN gene, and the target gene 2 is the porcine CD163 gene; the nucleotide sequence of the gRNA1-tRNA-gRNA2 unit component is shown in SEQ ID NO.5.

[0011] The present invention also provides a method for preparing the above-mentioned double tandem base editor, comprising the following steps: treating the adenine base editor with the restriction endonuclease Bbs I to obtain a linearized backbone, annealing the gRNA1-tRNA-gRNA2 unit assembly, and connecting the linearized backbone and the annealed gRNA1-tRNA-gRNA2 unit assembly to obtain a double tandem base editor.

[0012] Preferably, the preparation method of the adenine base editor comprises: treating the expression element with Age I and Bgl II restriction enzymes to obtain an expression element fragment, treating the vector backbone with Age I and BglII restriction enzymes to obtain a vector backbone fragment, and connecting the expression element fragment and the vector backbone fragment to obtain an adenine base editor.

[0013] The present invention also provides the use of the above-mentioned double tandem base editor or the double tandem base editor prepared by the above-mentioned preparation method in cell editing.

[0014] Preferably, the cells are porcine fibroblasts.

[0015] The present invention also provides the use of the above-mentioned double tandem base editor or the double tandem base editor prepared by the above-mentioned preparation method in pig breeding and reproduction.

[0016] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0017] The present invention combines the PTG strategy with adenine base editor, which has a multi-gRNA production function, and connects the adenine base editor to the polycistronic-tRNA-gRNA gene tandem expression system. Only by changing 20bp of the gRNA, different gene sites can be targeted to achieve multi-gene editing in pigs. The double tandem base editor constructed by the present invention can achieve accurate and safe multi-gene editing without introducing double-strand breaks, and the mutation efficiency is higher than that of the base editor of multi-plasmid co-transfection. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1: Schematic diagram of the design of PTG combined with ABE targeting Ningxiang pig MSTN / CD163 editing; A is a schematic diagram of the PX-ABE8e106W structure; B is a schematic diagram of the gRNA1-tRNA-gRNA2 unit assembly structure; C is a base conversion mediated by adenine base editing at the splice acceptor and splice donor of the CD163 gene in pig cells; D is a base conversion mediated by adenine base editing at the splice acceptor and splice donor of the MSTN gene in pig cells;

[0019] Figure 2 :PTG combined with ABE targeting Ningxiang pig MSTN / CD163 editing activity test; A is the sequencing result; B is the A-to-G conversion efficiency mediated by the base editor;

[0020] Figure 3 : Preparation and identification of PTG combined with ABE targeting Ningxiang pig MSTN / CD163 edited cells; A is a representative single cell colony; B is the growth activity and cell morphology of the single cell colony after 2 generations of subculture; C is the sequencing result;

[0021] Figure 4 : Detection of indel mutations caused by DSB and gRNA-dependent off-target effects; A is the agarose gel electrophoresis band; B is the sequencing result. DETAILED DESCRIPTION

[0022] The present invention also provides a double tandem base editor, which is obtained by recombining a gRNA1-tRNA-gRNA2 unit component and an adenine base editor; the gRNA1 is designed for target gene 1, including a gRNA target-specific spacer and a gRNA skeleton of target gene 1; the gRNA2 is designed for target gene 2, including a gRNA target-specific spacer and a gRNA skeleton of target gene 2.

[0023] In the gRNA1-tRNA-gRNA2 unit assembly of the present invention, each gRNA comprises a target-specific spacer and a conserved gRNA backbone. The nucleotide sequence of the gRNA backbone is: GTTTTAGAGCTAGAAATAGCAAGT TAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC, as shown in SEQ ID NO.1, and the nucleotide sequence of tRNA is: AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTA CCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA, as shown in SEQ ID NO.2. The primary transcript of the gRNA1-tRNA-gRNA2 unit assembly of the present invention is cleaved by endogenous RNase P and RNase R in the cell to release mature gRNAs to target multiple gene sites, such as Figure 1 As shown in B.

[0024] The adenine base editor described in the present invention is obtained by recombining a vector skeleton and an expression element. The expression element is recorded as ABE 8e106W expression vector, and the structure is: U6-(polycistronic-tRNA-gRNA)-CBh-NLS-Tad-SpCas9n-NLS-T2A-PURO-bGH-pA. Among them, U6 is the promoter for starting (polycistronic-tRNA-gRNA); CBh is the promoter of the ABE8eV106W expression vector; NLS is a nuclear localization signal; Tad is an adenosine deaminase that catalyzes the deamination of adenine in DNA; SpCas9n is the nuclease of the system, responsible for cutting at a specific position of DNA to achieve gene editing; NLS is a nuclear localization signal; T2A is a self-cleavage element that enables the spCas9n protein and subsequent proteins to be translated from the same mRNA molecule at the same time and expressed independently; PURO is puromycin, which is used as a resistance gene to transfect cells for screening; bGH is bovine growth hormone, which mainly plays a role in promoting the expression of the target protein; pA is a poly (A) signal site to ensure that the encoded target protein can be efficiently transcribed into a stable mRNA and then achieve efficient expression; there is a Bbs I restriction site between U6 and CBh. The nucleotide sequence of the ABE8ev106W expression vector of the present invention is shown in SEQ ID NO.3, and the vector backbone is a PX459 plasmid. The structure of the adenine base editor of the present invention is PX459-U6-(polycistronic-tRNA-gRNA)-CBh-NLS-Tad-SpCas9n-NLS-T2A-PURO-bGH-pA, such as Figure 1The nucleotide sequence is shown in A in SEQ ID NO. 6. The sequence of (polycistronic-tRNA-gRNA) does not belong to the structure of the PX-ABE8eV106W expression vector, indicating the position where the PX-ABE8eV106W expression vector is connected to the multi-gene gRNA.

[0025] Preferably, the double tandem base editor of the present invention is used to simultaneously edit the porcine CD163 gene and the porcine MSTN gene. When the target gene 1 is the porcine CD163 gene and the target gene 2 is the porcine MSTN gene, the nucleotide sequence of the gRNA1-tRNA-gRNA A2 unit component is as shown in SEQ ID NO.4: cttaccagcccatcttctcc GTTTTagagctaGAAAt agca agttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAtttcagcccacaggaaaccc gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc When the target gene 1 is the porcine MSTN gene, and the target gene 2 is the porcine CD163 gene; the nucleotide sequence of the gRNA1-tRNA-gRNA2 unit component is as shown in SEQ ID NO.5: tttcagcccacaggaaaccc GTTTTagagctaGAAAtagc aag ttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCActtaccagcc catcttctcc gt tttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc The bold part in the sequence represents the gRNA target-specific spacer, and the underlined part is the gRNA backbone.

[0026] The porcine CD163 gene (gene related to resistance to reproductive and respiratory syndrome infection) and the porcine MSTN gene (myostatin gene) are gene loci associated with economic trait loci (gene loci contain expected ABE editing sites). Porcine CD163 is one of the main receptor genes for PRRSV (porcine reproductive and respiratory syndrome virus) to infect porcine alveolar macrophages, of which the fifth SRCR (cysteine-rich scavenger receptor domain) is the main receptor for PRRSV infection. It is encoded by the seventh exon, and the seventh exon is 315bp in length. The MSTN gene is an inhibitor of muscle growth and a key major gene for controlling muscle growth and development. This gene mutation significantly improves the meat production efficiency of livestock. The full length of porcine MSTN exon 2 is 374bp. According to the principle of exon skipping, gRNA is designed: the AG sequence of the splicing donor of CD163 intron 6 induces exon 6 skipping. The GT sequence in the splicing donor of MSTN intron 2 induces exon 2 skipping. Figure 1 C and D show base conversion mediated by adenine base editing at the splice acceptor and splice donor of the CD163 / MSTN gene in cultured pig cells, respectively.

[0027] The present invention also provides a method for preparing the above-mentioned double tandem base editor, comprising preparing an adenine base editor and connecting the annealed gRNA1-tRNA-gRNA2 unit components.

[0028] The preparation method of the adenine base editor described in the present invention comprises the following steps: treating the expression element with Age I and Bgl II restriction enzymes to obtain an expression element fragment, wherein the system for treatment with Age I and Bgl II restriction enzymes is: pCMV-ABE8eV106W 10 μg, endonuclease AgeI (10U / μL) 1 μL, endonuclease BglII (10U / μL) 1 μL, Buffer (10×) 2 μL, and ddH2O supplemented to 20 μL; pCMV-ABE8eV106W is a plasmid vector containing the ABE8eV106W sequence. The vector backbone fragment is obtained by treating the vector backbone with Age I and Bgl II restriction enzymes. The system for treating with Age I and BglII restriction enzymes is: PX459 10 μg, endonuclease AgeI (10U / μL) 1 μL, endonuclease BglII (10U / μL) 1 μL, Buffer (10×) 2 μL, and ddH2O supplemented to 20 μL. The temperature for treating with Age I and Bgl II restriction enzymes is 36-38°C, more preferably 37°C; the treatment time is 3.5-4.5h, more preferably 4h. The present invention connects the expression element fragment and the vector backbone fragment to obtain an adenine base editor. Preferably, the expression element fragment and the vector backbone fragment are connected by T4 DNA ligase; the connection system is: 3 μL of PX459 digestion product, 3 μL of pCMV-ABE8eV106W digestion product, 0.4 μL of T4 DNA ligase (5U / μL), 2 μL of T4 DNA buffer (10×), and ddH2O is added to 20 μL. The connection temperature is 21-23°C, preferably 22°C; the connection time is 50-70 min, preferably 60 min.

[0029] The present invention uses the restriction endonuclease Bbs I to treat the above-mentioned adenine base editor to obtain a linearized backbone, anneals the gRNA1-tRNA-gRNA2 unit assembly, and connects the annealed gRNA1-tRNA-gRNA2 unit assembly to the Bbs I restriction site to obtain a double tandem base editor. The annealing method and connection method described in the present invention adopt conventional methods in the art.

[0030] The present invention also provides the use of the above double tandem base editor or the double tandem base editor prepared by the above preparation method in cell editing. Preferably, the cell is a porcine fibroblast, more preferably a porcine kidney fibroblast.

[0031] The present invention also provides the use of the above-mentioned double tandem base editor or the double tandem base editor prepared by the above-mentioned preparation method in pig breeding and breeding. By editing cells with the double tandem base editor, engineered cells are constructed, the association of pig economic trait genes is studied, and breeds with excellent economic traits are bred.

[0032] The technical scheme of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. In the following embodiments, unless otherwise specified, all are conventional methods. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can be obtained from commercial channels.

[0033] Example 1

[0034] Preparation of PX-ABE8e106W vector: pCMV-ABE8eV106W plasmid and PX459 plasmid were cut with AgeI and BglII restriction enzymes respectively. The enzyme treatment system was: pCMV-ABE8eV106W (purchased from Shenzhen BGI Co., Ltd.) 10 μg, endonuclease AgeI (10 U / μL) 1 μL, endonuclease BglII (10 U / μL) 1 μL, Buffer (10×) 2 μL, ddH2O supplemented to 20 μL; the enzyme treatment system was: PX459 10 μg, endonuclease AgeI (10 U / μL) 1 μL, endonuclease BglII (10 U / μL) 1 μL, Buffer (10×) 2 μL, ddH2O supplemented to 20 μL. The temperature was kept at 37°C during the cutting period, and the cutting was carried out for 4 hours. The digested fragments were recovered to obtain the ABE8e106W plasmid fragment and the PX459 plasmid fragment, which were connected by T4 DNA ligase; the connection system was: 3 μL of PX459 digested product, 3 μL of pCMV-ABE8eV106W digested product, 0.4 μL of T4 DNA ligase (5U / μL), 2 μL of T4 DNA buffer (10×), ddH2O to 20 μL, and the temperature was kept at 22°C for 1 hour. The two were connected to form the PX-ABE8e106W vector, and the nucleotide sequence was shown in SEQ ID NO.6.

[0035] Preparation of gRNA (CD163)-tRNA-gRNA (MSTN) editor: Aoke Biotech Co., Ltd. was commissioned to synthesize the gRNA (CD163)-tRNA-gRNA (MSTN) sequence, SEQ ID NO.4, and the sequence was directly inserted into the Bbs I restriction site of the PX-ABE8eV106W vector after annealing. The gRNA (CD163)-tRNA-gRNA (MSTN) editor was obtained, and the nucleotide sequence is shown in SEQ ID NO.7.

[0036] Example 2

[0037] Preparation of PX-ABE8e106W vector: pCMV-ABE8eV106W plasmid and PX459 plasmid were cut with AgeI and BglII restriction enzymes respectively. The enzyme treatment system was: pCMV-ABE8eV106W (purchased from Shenzhen BGI Co., Ltd.) 10 μg, endonuclease AgeI (10 U / μL) 1 μL, endonuclease BglII (10 U / μL) 1 μL, Buffer (10×) 2 μL, ddH2O supplemented to 20 μL; the enzyme treatment system was: PX459 10 μg, endonuclease AgeI (10 U / μL) 1 μL, endonuclease BglII (10 U / μL) 1 μL, Buffer (10×) 2 μL, ddH2O supplemented to 20 μL. The temperature was kept at 37°C during the cutting period, and the cutting was carried out for 4 hours. The digested fragments were recovered to obtain the ABE8e106W plasmid fragment and the PX459 plasmid fragment, which were connected by T4 DNA ligase; the connection system was: 3 μL of PX459 digested product, 3 μL of pCMV-ABE8eV106W digested product, 0.4 μL of T4 DNA ligase (5U / μL), 2 μL of T4 DNA buffer (10×), ddH2O to 20 μL, and the temperature was kept at 22°C for 1 hour. The two were connected to form the PX-ABE8e106W vector, and the nucleotide sequence was shown in SEQ ID NO.6.

[0038] Preparation of gRNA (MSTN)-tRNA-gRNA (CD163) editor: Aoke Biotech Co., Ltd. was commissioned to synthesize the gRNA (MSTN)-tRNA-gRNA (CD163) sequence, SEQ ID NO.5, and the sequence was directly inserted into the Bbs I restriction site of the PX-ABE8eV106W vector after annealing. The gRNA (MSTN)-tRNA-gRNA (CD163) editor was obtained, and the nucleotide sequence is shown in SEQ ID NO.8.

[0039] Test Example 1

[0040] 1. Preparation of Ningxiang pig kidney fibroblasts

[0041] After deep anesthesia, newborn piglets were euthanized, and both kidneys were removed and minced in Dulbecco's phosphate-buffered saline (DPBS). The tissue fragments were washed several times with DPBS and digested in 0.25% trypsin-EDTA solution at 37°C for 30 min. The isolated cells were cultured in DMEM medium supplemented with 20% fetal bovine serum for 1 to 2 generations and then frozen in liquid nitrogen for later use.

[0042] 2. Activity test of base editing in Ningxiang pig cells

[0043] The experiment used an editor (ABE) targeting a single MSTN and CD163 gene locus as a control. The three plasmids were tested and compared for editing activity in Ningxiang pig kidney fibroblasts to achieve ABE-mediated A-to-B conversion.

[0044] Preparation of ABE vectors targeting a single MSTN gene locus or a single CD163 gene locus:

[0045] gRNA(CD163): CTTACCAGCCCATCTTCTCC, SEQ ID NO.9;

[0046] gRNA(MSTN):TTTCAGCCCACAGGAAACCC, SEQ ID NO.10;

[0047] Provide PX-ABE8e106W vector (prepared in Example 1) and gRNA (CD163), gRNA (MSTN) sequences; gRNA (CD163) / gRNA (MSTN) editor preparation method:

[0048] gRNA (CD163) annealing: CD163-sg-F (SEQ ID NO.9) 10μM 1μL, CD163-sg-R (complementary sequence of SEQ ID NO.9 10μM 1μL, 10×NEB buffer 32μL, ddH2O 16μL.

[0049] gRNA (MSTN) annealing: MSTN-sg-F (SEQ ID NO.10) 10μM 1μL, MSTN-sg-R (complementary sequence of SEQ ID NO.10) 10μM 1μL, 10×NEB buffer 32μL, ddH2O 16μL.

[0050] BbsI digested the PX-ABE8eV106W vector: PX-ABE8eV106W 10μg, endonuclease BbsI (10U / μL) 3μL, Buffer (10×) 3μL, ddH2O to 20μL, digested at 37℃ for 30min to form a linearized backbone.

[0051] Using the kit ( Gel DNA Extraction Mini Kit, Novezan official website) was used to purify and recover the linearized backbone. The purified and recovered linearized backbone was connected to the gRNA (CD163) and gRNA (MSTN) sequences at 22°C for 1h using T4 ligase. The connection system was: 3μL of linearized vector backbone, 2μL of annealed gRNA, 0.4μL of T4 DNA ligase (5U / μL), 2μL of T4 DNA buffer (10×), and ddH2O was added to 20μL.

[0052] The nucleotide sequence of the gRNA (CD163) editor is shown in SEQ ID NO. 11. The nucleotide sequence of the gRNA (MSTN) editor is shown in SEQ ID NO. 12.

[0053] The gRNA (CD163)-tRNA-gRNA (MSTN) editor of Example 1 was transfected into Ningxiang pig kidney fibroblasts;

[0054] The gRNA (MSTN)-tRNA-gRNA (CD163) editor of Example 2 was transfected into Ningxiang pig kidney fibroblasts;

[0055] The gRNA (CD163) editor and gRNA (MSTN) editor were simultaneously transfected into Ningxiang porcine kidney fibroblasts (dual vector co-transfection strategy);

[0056] The gRNA (CD163) editor was transfected into Ningxiang porcine kidney fibroblasts;

[0057] The gRNA (MSTN) editor was transfected into Ningxiang porcine kidney fibroblasts;

[0058] 100,000 Ningxiang pig kidney fibroblasts at passage 1 to 2 were grown to a fusion rate of about 80% to 90%, and then transfected using electroporation technology: (1) Take out complete culture medium and DPBS from the refrigerator, preheat in a 38°C water bath for 10 minutes, and thaw trypsin TE in an incubator. (2) Wash the cells twice with DPBS. (3) Add an appropriate amount of TE solution and digest at 39°C for 2 minutes. (4) When the adherent cells float, add complete culture medium to terminate the digestion, and blow the cells with a pipette. (5) Transfer the cell suspension to a centrifuge tube, seal it, and centrifuge it at 2400rpm for 2 minutes. (6) Clean the electroporation cup: rinse it repeatedly with alcohol 2 to 3 times, then soak it in alcohol and use the tip of the pipette to repeatedly scrape the inner wall of the electroporation cup to scrape off the residual material. (7) Draw 1 ml of DPBS and rinse it repeatedly to clean the alcohol. (8) Rinse the electroporation cup with electroporation solution; and use the tip of the electroporation pipette to absorb the remaining liquid. Put it in an incubator for preheating. (9) Set the parameters: voltage 120V, electric shock time 3ms, pulse 1, number of electric shocks 1. (10) Add 5000ng of plasmid, 6μL of cell pellet, and make up to 100μL of electroporation solution to the collected cells. (11) Use a pipette to blow and mix repeatedly, use a special electroporation gun tip to aspirate the mixed liquid, and transfer it to an electroporation cup. (12) Place it in the electroporator. After the electric shock is completed, there will be two beeps. Take out the electroporation cup, use a special electroporation gun tip to aspirate the sample and transfer it to the culture plate, and then perform the electric shock operation on the next sample; (13) Move the cells to a six-well plate and culture it in a 39°C, 5% CO2 incubator.

[0059] After 1 day, the cells were distributed to 35mm cell culture dishes (NUNC) for culture. After 24 hours of recovery, the transfected cells were selected with 1.0ng / mL puromycin for 3 days. After drug withdrawal, the cells were continuously cultured for 5-7 days. Then all the cells were digested and genomic DNA was extracted. For each test of the gene locus, three independent experiments of cell transfection were performed. The cells from the three independent transfections were combined and the genomic DNA was extracted using a genomic DNA kit. Design primers for PCR reaction:

[0060] MSTN forward primer: GCTGATCTTCTAATGCAAGTG, SEQ ID NO. 13;

[0061] NSTN reverse primer: TTCCACTACTCATTCACAT, SEQ ID NO. 14;

[0062] CD163 forward primer: AGGTATAGAATCGGCTAAGC, SEQ ID NO.15;

[0063] CD163 reverse primer: GATGTCTGTGACTACCTAAC, SEQ ID NO.16.

[0064] The PCR reaction system was: 2 μL genomic DNA, 10 μM 0.5 μL forward primer, 10 μM 0.5 μL reverse primer, 10 μL 2× phantaMax Master Mix (Vazyme), and deionized water was added to a total volume of 20 μL. The PCR amplification conditions were: 1 cycle at 95°C for 3 min; 35 cycles at 95°C, 63°C, and 72°C for 15 s, 15 s, and 20 s, respectively; and then at 72°C for 5 min. A PCR amplification solution containing 0.01% (v / v) Andy Gold TM PCR products were detected by 1.5% (w / v) agarose gel electrophoresis with nucleic acid gel stain (Applied BioProbes, Davis, CA, USA).

[0065] PCR amplification products were purified using a universal DNA purification kit (Tiangen) and sent to Shanghai Sangon Biotech for Sanger and next-generation sequencing. For next-generation sequencing, PCR amplification products were ligated to adapters and sequenced on an Illumina MiSeq 2×300bp sequencing platform. More than 50,000 reads were collected for each test. ABE-mediated base editing was determined by aligning the reads with the wild-type sequence.

[0066] PTG combined with ABE targeting Ningxiang pig MSTN / CD163 editing activity test Figure 2 As shown in the figure, A. Sequencing results, with red arrows indicating base editing-induced A-to-G (T-to-C in the complementary chain) conversion, and red boxes marking the original spacer adjacent motif (PAM) sequence. Representative A-to-G (T-to-C in the complementary chain) base editing-induced hybridization peaks appeared in the Sanger DNA sequencing results. The allele frequencies from deep sequencing are listed on the right; B. ABE-mediated A-to-G conversion efficiency.

[0067] The results showed that A-to-G base editing could occur at both the expected gene sites CD163 and MSTN under the two arrangement orders of gRNA (CD163)-tRNA-gRNA (MSTN) and gRNA (MSTN)-tRNA-gRNA (CD163). The CD163 target editing efficiency was 34.8% and 52.8 in the two tandem modes, respectively. The MSTN target editing efficiency was 69.5% and 36.5% in the two tandem modes, respectively. Compared with the dual-vector co-transfection strategy, the editing efficiency was increased by 0.83 to 1.78 times and 3.80 to 8.14 times, respectively. This shows that the PTG-mediated multi-gene site base editing system has higher editing efficiency in pig cells and can significantly promote the preparation process of multi-gene edited pig cells.

[0068] 3. ABE-mediated base conversion of conservative splicing sites of Ningxiang pig MSTN and CD163 double genes

[0069] The method for transfecting the editor into Ningxiang pig kidney fibroblasts is the same as step 2.

[0070] The transfected cells were subcultured in a 60 mm culture dish. After 48 hours, the cells were treated with 1.0 μg / mL puromycin for 3 days to eliminate the non-transfected cells. After drug withdrawal, the remaining drug-resistant cells were further cultured for 9 to 10 days. Once a single cell colony with a diameter of 2 to 3 mm (containing about 1000 cells) was found. The cell colony was separated, and the monoclonal cells were found under a 4x microscope, marked, and switched to a 10x microscope to check the cell status. After the complete monoclonal marking, the waste liquid was aspirated and washed twice with DPBS+PS. The cloning ring was coated with vaseline, and the end coated with vaseline was buckled on the marked monoclonal. Trypsin digestion was performed for 2 minutes, and the digestion was terminated with complete culture medium. The digested monoclonal clone was transferred to a new culture dish, and complete culture medium and 1% 1ng / μL FGF were added. After the cells matured, the genome of the monoclonal cells was extracted to detect the cell DNA.

[0071] Preparation and identification results of PTG combined with ABE targeting Ningxiang pig MSTN / CD163 edited cells Figure 3 As shown. In the figure, A. Representative single-cell colonies; B. Growth activity and cell morphology of single-cell colonies after 2 generations of subculture; C. Sequencing results, base editing-induced A-to-G (T-to-C in the complementary chain) conversion is indicated by a red arrow. The results showed that the single-cell colonies showed good growth activity and cell morphology after 2 generations of subculture. Sanger DNA sequencing results showed that the base editing target and the original spacer adjacent motif (PAM) were located on the wild-type (WT) sequence, and 10 single-cell colonies had the expected ABE-mediated A-to-G conversion (as shown by the red arrow).

[0072] The experiment obtained 33 monoclonal cell colonies, of which 10 colonies underwent CD163 / MSTN dual gene editing with an efficiency of 30.3% (10 / 33).

[0073] 4. Genomic off-target detection of adenine base-edited pig cell colonies

[0074] Four single cell colonies obtained in step 3 that carried homozygous editing of the CD163 / MSTN double gene and showed good cell growth and morphology were selected for off-target analysis, with one wild-type cell as a control. Three off-target sites with high scores (SCORE>0.8) were predicted by off-target analysis software for the CD163 and MSTN genes, respectively, to detect off-targets occurring in base-edited cell colonies. PCR primers were designed for the three off-target sites:

[0075] MSTN off-target site 1 sequence: GGAGAAGATGGGCTGGAAGG, SEQ ID NO. 17;

[0076] F: GGCGAATGGAGTCATGTGTG, SEQ ID NO.18;

[0077] R: TTGATGCCTCTAAACGGTGC, SEQ ID NO. 19.

[0078] MSTN off-target site 2 sequence: GGAGAAGATGGGGTGCTGAG, SEQ ID NO. 20;

[0079] F: GGCGAATGGAGTCATGTGTG, SEQ ID NO. 21;

[0080] R: TGACACAGAAGTGACCGACC, SEQ ID NO. 22.

[0081] MSTN off-target site 3 sequence: GGAGAAGATGAGCTGTTTCG, SEQ ID NO. 23;

[0082] F: CCAGAGAAGTCCCTGGGTTG, SEQ ID NO. 24;

[0083] R: CCTGCTTGGGTGTGAGAACT, SEQ ID NO. 25.

[0084] CD163 off-target site 1 sequence: TCTCAGCCCACAGTAAACCC, SEQ ID NO. 26;

[0085] F: GCTGCGGTCTCATAGCAGTA, SEQ ID NO.27;

[0086] R: CCTTGGAGATGAGGCTGATG, SEQ ID NO. 28.

[0087] CD163 off-target site 2 sequence: CCAGAGCCCACAGGAAACCC, SEQ ID NO. 29;

[0088] F: GCCAAGGTGATTCTGACGTG, SEQ ID NO.30;

[0089] R: AGCCTTCCCCCTTGTTGATT, SEQ ID NO. 31.

[0090] CD163 off-target site 3 sequence: TTCTAGCCCACAGGAAACCC, SEQ ID NO.32;

[0091] F: CCCGTCTTGAATCAGGTCCA, SEQ ID NO.33;

[0092] R: CTGAAGTAGCAGGCGTAGCAT, SEQ ID NO. 34.

[0093] The PCR reaction system was: 2 μL genomic DNA, 10 μM 0.5 μL forward primer, 10 μM 0.5 μL reverse primer, 10 μL 2× phanta Max Master Mix (Vazyme), and deionized water was added to a total volume of 20 μL. The PCR amplification conditions were: 1 cycle at 95°C for 3 min; 35 cycles at 95°C, 63°C, and 72°C for 15 s, 15 s, and 20 s, respectively; and then at 72°C for 5 min. The Andy Gold TM The PCR products were detected by 1.5% (w / v) agarose gel electrophoresis with nucleic acid gel stain (Applied BioProbes, Davis, CA, USA) and subjected to Sanger sequencing.

[0094] Detection of indel mutations caused by DSBs and gRNA-dependent off-target effects Figure 4As shown, A. Agarose gel electrophoresis bands, M represents Marker, WT represents wild type, 1#, 11#, 21#, 33# represent edited cell numbers; B. Sequencing results, OTS target and protospacer adjacent motif (PAM) indicate wild type (WT) sequence. The predicted base editing-induced A-to-G (T-to-C in the complementary chain) conversion is indicated by a red arrow, and the functional CRISPR / Cas9-induced DNA cutting site is indicated by a blue arrow (CRISPR / Cas9-induced deletion / insertion mutations usually occur near this site). The results of Sanger DNA sequencing showed that no A-to-G (T-to-C in the complementary chain) conversion occurred in the six selected OTSs, and no base deletion / insertion mutations caused by DNA double-strand breaks were detected in the four ABE-edited single-cell colonies tested, indicating that the PTG-mediated multi-gene site base editing system constructed in the present invention can induce efficient base editing without causing significant genomic off-target effects, thereby providing a guarantee for the further use of somatic cell nuclear transfer technology to produce gene-edited pigs.

[0095] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A double tandem base editor, characterized in that: It is obtained by recombining the gRNA1-tRNA-gRNA2 unit components and the adenine base editor; the gRNA1 is designed for target gene 1, including the gRNA target-specific spacer region and the gRNA backbone of target gene 1; the gRNA2 is designed for target gene 2, including the gRNA target-specific spacer region and the gRNA backbone of target gene 2.

2. The double tandem base editor according to claim 1, characterized in that In the gRNA1-tRNA-gRNA2 unit component, the nucleotide sequence of the gRNA skeleton is shown as SEQ ID NO.1, and the nucleotide sequence of the tRNA is shown as SEQ ID NO.

2.

3. The double tandem base editor according to claim 1, characterized in that The adenine base editor is obtained by recombination of a vector backbone and an expression element, the nucleotide sequence of the expression element is shown in SEQ ID NO.3, and the vector backbone is a PX459 plasmid.

4. The double tandem base editor according to claim 1, characterized in that The target gene 1 is the porcine CD163 gene, and the target gene 2 is the porcine MSTN gene; the nucleotide sequence of the gRNA1-tRNA-gRNA2 unit component is shown in SEQ ID NO.

4.

5. The double tandem base editor according to claim 1, characterized in that The target gene 1 is the porcine MSTN gene, and the target gene 2 is the porcine CD163 gene; the nucleotide sequence of the gRNA1-tRNA-gRNA2 unit component is shown in SEQ ID NO.

5.

6. The method for preparing a double tandem base editor according to any one of claims 1 to 5, characterized in that: The following steps are involved: The adenine base editor was treated with restriction endonuclease Bbs I to obtain a linearized backbone, the gRNA1-tRNA-gRNA2 unit assembly was annealed, and the linearized backbone and the annealed gRNA1-tRNA-gRNA2 unit assembly were connected to obtain a double tandem base editor.

7. The preparation method according to claim 6, characterized in that: The preparation method of the adenine base editor includes: treating the expression element with Age I and Bgl II restriction enzymes to obtain an expression element fragment, treating the vector backbone with Age I and Bgl II restriction enzymes to obtain a vector backbone fragment, and connecting the expression element fragment and the vector backbone fragment to obtain the adenine base editor.

8. Use of the double tandem base editor described in any one of claims 1 to 5 or the double tandem base editor prepared by the preparation method described in any one of claims 6 to 7 in cell editing.

9. The use according to claim 8, characterized in that: The cells are porcine fibroblasts.

10. Use of the double tandem base editor described in any one of claims 1 to 5 or the double tandem base editor prepared by the preparation method described in any one of claims 6 to 7 in pig farming and breeding.

Images