CRISPR-Cas13a-based electrochemical biosensing system for detecting PEDV (porcine epidemic diarrhea virus) and application thereof

Abstract

The invention discloses an electrochemical biosensing system for detecting PEDV (Porcine Epidemic Diarrhea Virus) based on CRISPR-Cas13a (Clustered Regularly Interspaced Short Palindromic Repeats). The electrochemical biosensing system comprises an electrochemical biosensor and a CRISPR-Cas13a system, the electrochemical biosensor comprises a working electrode, wherein the surface of the working electrode is modified with a reduced graphene oxide-polypyrrole-gold nanoparticle composite material layer and an MB-RNA probe; one end of the MB-RNA probe is modified with sulfydryl, the other end of the MB-RNA probe is modified with signal molecules, and the MB-RNA probe is connected with the reduced graphene oxide-polypyrrole-gold nanoparticle composite material layer through Au-S bonds; the CRISPR-Cas13a system comprises the crRNA group according to the claim 1 and the Cas13a of the crRNA group according to the claim 1. The electrochemical biosensing system disclosed by the invention has extremely high clinical sensitivity and clinical specificity on PEDV (porcine epidemic diarrhea virus).

Description

Technical Field

[0001] The present invention relates to the field of molecular biology technology, and in particular to an electrochemical biosensor system for detecting PEDV based on CRISPR-Cas13a and applications thereof. Background Art

[0002] Porcine epidemic diarrhea virus (PEDV) is an enveloped single-stranded RNA virus belonging to the genus Coronavirus of the family Coronaviridae. Its gene length is about 28kb. It replicates in the villus epithelial cells of the small intestine of pigs, causing intestinal diseases and porcine epidemic diarrhea (PED). Clinical manifestations include diarrhea, vomiting, dehydration in suckling piglets, and a high mortality rate. The morbidity rate of suckling piglets is 80-100%, and the mortality rate is 50-90%, posing a serious threat to the pig industry and global food security.

[0003] At present, methods such as virus isolation, electron microscopy, immunofluorescence (IFA), loop-mediated isothermal amplification (LAMP), antigen enzyme-linked immunosorbent assay (ELISA), reverse transcription polymerase chain reaction (RT-PCR), quantitative PCR (qPCR) and high-throughput sequencing are commonly used to detect whether pigs are infected with PEDV. These technologies are labor-intensive and time-consuming, have false positives, rely on professional technicians and laboratory platforms, require expensive instruments, and are not suitable for timely and rapid on-site detection.

[0004] Therefore, there is an urgent need to establish a rapid, accurate, convenient, low-cost, highly sensitive and highly specific detection technology to quickly control the prevalence of PEDV and prevent its further spread.

[0005] CRISPR / Cas13a (Clustered Regularly interspaced short palindromicrepeat) is a branch of the CRISPR / Cas system. The CRISPR-Cas system is an acquired immune system in bacteria that is used to fight against exogenous DNA, plasmids and phages that invade bacteria. The CRISPR-Cas system consists of two parts: the CRISPR locus and the Cas gene. Among them, the CRISPR locus is mainly composed of a leader sequence, a repeat sequence and a spacer sequence. There are about dozens of proteins encoded by the Cas gene and related to CRISPR, including Cas9, Cas12a, and Cas13a. The system has developed gene editing technology, gene therapy technology, molecular biology detection technology, etc. based on Cas proteins with different functions. The CRISPR / Cas13a technology guides the Cas13a protein to cut the substrate RNA or ssRNA by designing and synthesizing a 20bp crRNA sequence that is complementary to the target sequence, and at the same time triggers the system's cutting function for any RNA around the reaction environment. If the reporter RNA that generates fluorescence after cutting is added to the reaction system, fluorescence can be generated after the substrate RNA contacts and reacts with CRISPR / Cas13a. The fluorescence signal can be collected by a fluorescence quantitative instrument to detect the substrate RNA, or the test result can be determined by only using a blue light transmission instrument to observe the product after the reaction. This test can not only be used to detect some RNA fragments including microRNA, but also can be combined with RT-RAA (recombinase polymerase amplification technology) and other technologies to complete the nucleic acid molecule detection of pathogens such as viruses and bacteria.

[0006] As a micro-device that combines biosensing and electrochemical analysis technology, electrochemical biosensors have the advantages of fast response, simple operation, good selectivity and high sensitivity. Combining the CRISPR / Cas system with electrochemical biosensors (CRISPR / Cas integrated electrochemical biosensors, E-CRISPR) has the purpose of enhancing sensitivity and specificity, shortening detection time at low concentrations, and achieving rapid and accurate detection. Summary of the invention

[0007] The present invention provides an electrochemical biosensor system for detecting PEDV based on CRISPR-Cas13a and application thereof. The electrochemical biosensor system has extremely high clinical sensitivity and clinical specificity to PEDV virus.

[0008] The technical solution of the present invention is as follows:

[0009] A crRNA set of CRISPR-Cas13a for detecting PEDV, comprising at least one of PEDV-crRNA3, PEDV-crRNA4 and PEDV-crRNA 9;

[0010] The nucleotide sequence of PEDV-crRNA 3 is shown in SEQ ID NO.30, the nucleotide sequence of PEDV-crRNA 4 is shown in SEQ ID NO.31, and the nucleotide sequence of PEDV-crRNA 9 is shown in SEQ ID NO.36.

[0011] The nucleotide sequence of PEDV-crRNA 3 is: GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAGCCAUCU UAACACCAUACAAGAUCAC;

[0012] The nucleotide sequence of PEDV-crRNA 4 is: GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAGAGUGAC AGUGCCAACACAAGAGGCC;

[0013] The nucleotide sequence of PEDV-crRNA 9 is: GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAGUGGCCU UGGCGACUGUGACGAAAUU.

[0014] An electrochemical biosensor system for detecting PEDV based on CRISPR-Cas13a, comprising an electrochemical biosensor and a CRISPR-Cas13a system;

[0015] The electrochemical biosensor comprises a working electrode, the surface of which is modified with a reduced graphene oxide-polypyrrole-gold nanoparticle (rGO-PPy-AuNPs) composite material layer and an MB (methylene blue)-RNA probe; one end of the MB-RNA probe is modified with a thiol group and the other end is modified with a signal molecule, and the MB-RNA probe is connected to the reduced graphene oxide-polypyrrole-gold nanoparticle composite material layer through an Au-S bond;

[0016] The CRISPR-Cas13a system includes the crRNA group and Cas13a.

[0017] Cas13a is combined with crRNA to form a Cas13a-crRNA complex, and the sample to be tested is mixed with the Cas13a-crRNA complex and then added dropwise to the surface of the working electrode of the electrochemical sensor for reaction. The change rate ΔI (%) of the SWV current peak of the electrode before and after the reaction is used to determine whether the sample to be tested contains PEDV virus. Compared with before the reaction, the SWV current peak of the electrode after electrochemical detection in the reaction system containing PEDV virus is significantly reduced, while the SWV current peak of the electrode after electrochemical detection in the negative reaction system without PEDV virus has no significant change.

[0018] Preferably, the Cas13a is LwaCas13a.

[0019] Preferably, the nucleotide sequence of the MB-RNA probe is shown in SEQ ID NO. 40. The nucleotide sequence of the MB-RNA probe is AAUGGCAAAUGGCA.

[0020] The substrate of the working electrode is a SPCE electrode.

[0021] The preparation method of the working electrode comprises: incubating the MB-RNA probe on the surface of the working electrode modified with a reduced graphene oxide-polypyrrole-gold nanoparticle composite material layer, and incubating with 6-mercapto-1-hexanol (MCH) to block the remaining sites.

[0022] Furthermore, the preparation method of the working electrode includes: pouring a solution of the MB-RNA probe onto the surface of the working electrode modified with a reduced graphene oxide-polypyrrole-gold nanoparticle composite material layer, incubating at 37°C for 1-2 hours, then dropping 6-mercapto-1-hexanol on the surface of the working electrode, and incubating at 37°C for 10-30 minutes to block the unbound sites on the surface of the working electrode.

[0023] The working electrode modified with the reduced graphene oxide-polypyrrole-gold nanoparticle composite material layer can be prepared by using existing technology.

[0024] Preferably, the method for preparing the working electrode modified with the reduced graphene oxide-polypyrrole-gold nanoparticle composite material layer comprises:

[0025] (1) Depositing graphene oxide on a working electrode by cyclic voltammetry (CV) and reducing it to reduced graphene oxide;

[0026] (2) depositing polypyrrole (PPy) on the surface of the reduced graphene oxide layer;

[0027] (3) dripping a gold nanoparticle (AuNPs) suspension onto the surface of the polypyrrole layer and drying it to obtain a working electrode modified with a reduced graphene oxide-polypyrrole-gold nanoparticle composite material layer.

[0028] Preferably, the electrochemical biosensor further comprises an auxiliary electrode and a reference electrode; the auxiliary electrode is carbon, and the reference electrode is silver-silver chloride.

[0029] The present invention also provides application of the electrochemical biosensor system in preparing products for detecting PEDV.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] The present invention modifies the reduced graphene oxide-polypyrrole-gold nanoparticle composite material onto the working electrode and couples it with the Cas13a enzyme cleavage system with high specificity, thereby constructing an electrochemical biosensor based on CRISPR-Cas13a for detecting PEDV RNA, which has extremely high clinical sensitivity (the minimum detection concentration reaches 3.9 copies / μL) and clinical specificity; the entire detection is completed within 45 minutes, which solves the problems of high detection cost, long detection time, insufficient sensitivity, etc., and is suitable for instant detection of PEDV. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Schematic diagram of the rGO-PPy-AuNPs electrochemical biosensor for detecting PEDV based on the CRISPR-Cas13a system provided by the present invention;

[0033] Figure 2 Scanning electron microscopy images of different modification processes of the electrode surface: (A) rGO, (B) rGO-PPy, (C) rGO-PPy-AuNPs;

[0034] Figure 3 The distribution diagram of C, N, O and Au elements on the surface of rGO-PPy-AuNPs electrode;

[0035] Figure 4 Cyclic voltammetry curves of different modification processes of the electrode surface;

[0036] Figure 5 Fourier infrared absorption spectrum (A) and X-ray photoelectron spectrum (B) of rGO-PPy-AuNPs electrode;

[0037] Figure 6 Screening results for a single crRNA (A) and a combination of three crRNAs (B);

[0038] Figure 7The detection limit experimental results of electrochemical detection of PEDV based on CRISPR-Cas13a system and rGO-PPy-AuNPs nanocomposites: (A) Target RNA concentration range (bj) 10 0 Up to 10 8 fg / mL SWV curve, (B) linear relationship between current change (ΔI) and the logarithm of target RNA concentration;

[0039] Figure 8 The specific experimental results of electrochemical detection of PEDV based on CRISPR-Cas13a system and rGO-PPy-AuNPs nanocomposite materials are shown in Figure 2.

[0040] Fig. 9 This is the experimental results of electrochemical detection of PEDV actual samples based on CRISPR-Cas13a system and rGO-PPy-AuNPs nanocomposites. DETAILED DESCRIPTION

[0041] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be pointed out that the embodiments described below are intended to facilitate the understanding of the present invention and do not have any limiting effect on the present invention.

[0042] The present invention provides general and / or specific descriptions of the materials and test methods used in the experiments. Although many materials and operating methods used to achieve the purpose of the present invention are well known in the art, the present invention is still described as detailed as possible here.

[0043] The instruments, reagents, materials, etc. involved in the following embodiments, unless otherwise specified, are all conventional instruments, reagents, materials, etc. in the prior art and can be obtained through regular commercial channels. The experimental methods, detection methods, etc. involved in the following embodiments, unless otherwise specified, are all conventional experimental methods, detection methods, etc. in the prior art.

[0044] The sources of the raw materials involved in the following examples are shown in Table 1:

[0045] Table 1 Raw material names and manufacturers

[0046] Raw material name factory Graphene oxide dispersion McLean-S992589 Pyrrole monomer McLean-P815710 Potassium ferrocyanide McLean-P816307 Potassium ferrocyanide hydrate McLean-T792171 Gold trichloride aqueous solution Aladdin-G109456 TCEP-HCl Sigma,646547 6-Mercapto-1-hexanol MCH Sigma-Aldrich,451088 Screen Printed Carbon Electrodes Changsha Sanjun Biotechnology (Hunan) Co., Ltd. DEPC water Shanghai Bioengineering Co., Ltd.

[0047] The Cas13a protein in the following examples is LwaCas13a protein.

[0048] The MB-RNA probe (SH-ssRNA-MB) used in the present invention was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.; the primers, crRNA and target RNA were synthesized by General Biosystems (Anhui) Co., Ltd.

[0049] All electrochemical signals were measured by a CHI 630E electrochemical workstation (Chenhua, Shanghai, China). Screen-printed carbon electrodes were purchased from Changsha Sanjun Biotechnology (Hunan) Co., Ltd. The electrode system included Ag / AgCl electrode, carbon electrode and carbon electrode as reference electrode, auxiliary electrode and working electrode, respectively.

[0050] The detection principle of the electrochemical biosensor system for detecting PEDV based on CRISPR-Cas13a is as follows Figure 1 shown.

[0051] The experimental steps are as follows:

[0052] 1. Construction of rGO-PPy-AuNPs electrochemical biosensor

[0053] The screen printed carbon electrode (SPCE) was ultrasonically treated in deionized water for 5 min to remove surface impurities and dried at room temperature. Cyclic voltammetry (CV) was used in PBS buffer for electrochemical cleaning and electrical activation. After the CV curve was stable, the SPCE was rinsed with deionized water and dried at room temperature.

[0054] 1. Preparation of rGO-PPy-AuNPs

[0055] The GO dispersion solution was prepared in a 1:1 ratio with the PBS solution, and GO was deposited by CV and reduced to rGO. Concentrated sulfuric acid, pyrrole, and ultrapure water were mixed and stirred until a uniform light yellow liquid was obtained for use. The above liquid was deposited by it (ampere-time curve) for 100s. HAuCl4 was diluted to 1mM with water and heated to boiling. 3.8mM trisodium citric acid solution was added to the boiling HAuCl4 solution at one time and stirred vigorously. The mixed solution was boiled, mixed, and slowly cooled to room temperature. The color of the obtained solution turned into wine red, indicating the formation of surface gold nanoparticles. The synthesized AuNPs were dripped onto the working electrode, left at room temperature for 1h to wait for the AuNPs to dry, rinsed, dried at room temperature, and stored at 4°C for use.

[0056] 2. Characterization of rGO-PPy-AuNPs

[0057] Scanning electron microscopy, X-ray photoelectron spectrometer, Fourier transform infrared spectrometer and other instruments were used to characterize the rGO-PPy-AuNPs nanocomposite materials and determine their structure and composition.

[0058] The scanning electron microscopy results are as follows Figure 2 As shown in Figure 2, after SPCE was modified with rGO, the surface was covered with a thin film and an organized graphene oxide layered structure ( Figure 2 A), PPy film has a cauliflower-like structure ( Figure 2 B) On the surface of rGO-PPy-AuNPs-SPCE, AuNPs are evenly distributed ( Figure 2 C).

[0059] The element distribution results are as follows Figure 3 As shown, a uniform distribution of C, N, O, and Au can be seen on the SPCE surface, among which Au is clearly visible.

[0060] The cyclic voltammetry curves of different electrode surface modification processes are shown in Figure 2. Figure 4 As shown, the bare electrode shows a smaller peak current. When SPCE is modified with rGO, the peak current increases, indicating faster electron transfer. Modification of the electrode surface with PPy produces a higher peak current, confirming the attachment of the polypyridine layer. When SPCE is modified with rGO, PPy and AuNPs at the same time, the highest redox peak is observed, indicating that rGO, PPy and AuNPs are all successfully attached.

[0061] The Fourier transform infrared absorption spectrum results are as follows Figure 5 As shown in (A), the formation of rGO-PPy composite materials and functional groups is confirmed; the X-ray photoelectron spectroscopy results are shown in Figure 5 As shown in (B), the characteristic peaks of Au, C, N and O elements are present, and there is no obvious impurity peak, indicating that rGO, PPy and AuNPs are loaded successfully. The above results fully prove the successful preparation of rGO-PPy-AuNPs-SPCE.

[0062] 2. MB-RNA Probe Modification

[0063] First, 5 μM MB-RNA probe was reduced in a metal bath with 10 mM TCEP-HCl at 37 °C in the dark for 60 min. Then 10 μL of 2.5 μM MB-RNA probe solution was cast on the working electrode of rGO-PPy-AuNPs-SPCE and incubated in an electric incubator at 37 °C for 2 h to fix the MB-RNA probe on the surface of rGO-PPy-AuNPs-SPCE through Au-S bonds, followed by rinsing with 10 mM Tris buffer and drying at room temperature.

[0064] Drop 20 μL of 2 mM MCH (6-mercapto-1-hexanol) on the working electrode area and incubate at 37°C for 30 min to fill the unbound sites on the working electrode surface and reduce false positive signals caused by nonspecific binding during detection. Finally, rinse with water and dry at room temperature.

[0065] 3. Preparation of RNA standards and crRNA of PEDV

[0066] The PEDV M gene (GenBank: AY974335.1) sequence was synthesized into the pUC-57 plasmid, and the pUC-57-PEDV plasmid (commissioned to Anhui General Synthesis) was used as a template. When designing primers, a T7 promoter was added to the 5' end of the upstream primer. The primers were designed as follows:

[0067] PEDV-F: TAATACGACTCACTATAGGGCGGTTCTATTCCCGTTGATG (SEQ ID No. 2);

[0068] PEDV-R:ATGAAGCACTTTCTCACTATC (SEQ ID No. 3).

[0069] Prepare PCR amplification reagents according to Table 2 below.

[0070] Table 2 PCR amplification system

[0071] Reagents Sample volume PEDV-F (10 μM) 2μL PEDV-R (10 μM) 2μL Fast PCR Master Mix (Takara) 10μL <![CDATA[ddH2O]]> To a total volume of 20 μL

[0072] The amplified PCR product was purified and recovered, and T7 High Yield RNA Transcription Kit (Nanjing Novozyme) was used for T7 transcription. The transcription product was purified by RNA purification kit (Tiangen) to obtain the RNA standard of PEDV (the sequence is shown in SEQ ID No. 1).

[0073] CTAACGGTTCTATTCCCGTTGATGAGGTGATTCAACACCTTAGAAACTGGAATTTCACATGGAATATCATACTGACGATACTACTTGTAGTGCTTCAGTATGGCCATTACAAGTACTCTGTGATCTTGTATGGTGTTAAGATGGCTATTCTATGGATACTTTGGCCTCTTGTGTTGGCACTGTCACTCTTTGACGCATGGGCTAGCTTTCAGGTCAACTGGGTCTTTTTCGCTTTCAGCATCCTTATGGCTTGCATCACTCTTATGCTGTGGATAATGTACTTTGTCAATAGCATTCGGTTGTGGCGCAGGACACATTCTTGGTGGTCCTTCAATCCTGAAACAGACGCGCTTCTCACTACTTCTGTGATGGGCCGACAGGTCTGCATTCCAGTGCTTGGAGCACCAACTGGTGTAACGCTAACACTCCTTAGTGGTACATTGCTTGTAGAGGGCTATAAGGTTGCTACTGGCGTACAGGTAAGTCAATTACCTAATTTCGTCACAGTCGCCAAGGCCACTACAACAATTGTCTACGGACGTGTTGGTCGTTCAGTCAATGCTTCATCTGGCACTGGTTGGGCTTTCTATGTACGGTCAAAACACGGCGACTACTCAGCTGTGAGTAATCCGAGTGCGGTTCTCACAGATAGTGAGAAAGTGCTTCAT(SEQ ID No.1).

[0074] IV. Preparation and Screening of PEDV-crRNA

[0075] 1. Preparation of PEDV-crRNA

[0076] With the PEDV M gene sequence as the target, 12 crRNAs were designed, and double-stranded DNA was formed by annealing the upstream and downstream primers (Table 3). The annealing procedure was 99°C for 10 min; 85°C, 5 min; 80°C, 5 min; 75°C, 5 min; 70°C, 5 min. The double-stranded DNA was purified and recovered using a 5-minute DNA rapid purification kit (Beijing Quanshijin). Then, T7 High Yield RNA Transcription Kit (Nanjing Novozyme) was used for T7 transcription, and the transcription product was purified by an RNA purification kit (Tiangen) to obtain PEDV-crRNA (Table 4).

[0077] Table 3 PEDV-crRNA upstream and downstream primer sequences

[0078]

[0079]

[0080] Table 4 PEDV-crRNA sequence

[0081]

[0082]

[0083] 2. Screening of PEDV-crRNA

[0084] The 12 crRNAs were screened by the fluorescence detection system. First, the CRISPR-Cas13a isothermal detection reagent was prepared. The reaction system is shown in Table 5 below (total volume 20 μL). The PEDV-Probe sequence is FAM- r U r U r U r U r U-BHQ1.

[0085] Table 5 CRISPR-Cas13a fluorescence detection system

[0086] Reagent ingredients Total volume 20 μL LwaCas13a (0.1 mg / mL) 1 RNase Inhibitor (40U / μL) 0.5 crRNA (60ng / μL) 1 PEDV-Probe (10μM) 0.5 10×Buffer 2 <![CDATA[ddH2O]]> 12.5 template 1 Total 20

[0087] The prepared reaction tube was centrifuged and placed in the ABI Step One instrument. The program was set as follows: 37°C pre-denaturation for 1s; 37°C denaturation for 45s, 37°C annealing and extension for 15s (fluorescence signal collection), for a total of 40 cycles. In the experimental results, the fluorescence value at 30min was used to compare the effects of each crRNA. The screening results are as follows: Figure 6 As shown in Table 4, the optimal PEDV-crRNA is the combination of crRNA3+crRNA4+crRNA 9, and its crRNA sequence is shown in Table 4.

[0088] 5. Construction and application of electrochemical detection system of PEDV based on CRISPR-Cas13a system and rGO-PPy-AuNPs nanocomposites

[0089] The detection of PEDV is achieved by trans-cutting the MB-RNA probe at the electrochemical sensor interface through the CRISPR / Cas13a system. The sequence of the MB-RNA probe is: SH-AAUGGCAAAUGGCA-MB (SEQ ID No. 40).

[0090] 1. Construction of CRISPR-Cas13a-driven electrochemical biosensor based on gold nanoparticles and graphene composites

[0091] Prepare the CRISPR-Cas13a cleavage reaction system according to Table 6.

[0092] Table 6 CRISPR-Cas13a cleavage MB-RNA probe reaction system

[0093] Reagent ingredients Total volume 20 μL LwaCas13a (0.1 mg / mL) 1 RNase Inhibitor (40U / μL) 0.5 crRNA (60ng / μL) 1 10×Buffer 2 <![CDATA[ddH2O]]> 12.5 template 1 Total 20

[0094] Add 20 μL of the reaction system to the working electrode and incubate at 37°C for 40 min.

[0095] The electrochemical SWV parameter settings were as follows: initial potential of -0.6 V, termination potential of -0.1 V, potential increment of 0.004 V, amplitude of 0.05 V, frequency of 50 Hz, standing time of 2 s, and current range of 10E-5 A.

[0096] Take 40 μL of 10 mM Tris buffer (pH 8.0) containing 100 mM NaCl as an electrolyte and drop it on the SCPE. Record the current value of the MB probe electrode before and after the addition of the CRISPR system. Calculate the change rate ΔI% value by SWV peak current. After electrochemical detection in the reaction system containing the PEDV template, the characteristic current peak of rGO-PPy-AuNPs-SPCE is significantly smaller than that before the reaction, while in the negative reaction system without the PEDV template, there is no obvious change in the characteristic current peak of rGO-PPy-AuNPs-SPCE after electrochemical detection.

[0097] 2. Sensitivity and specificity of CRISPR-Cas13a-driven electrochemical biosensor based on gold nanoparticles and graphene composites

[0098] The PEDV template was diluted to 10 8 , 10 7 , 10 6 , 10 5 , 104 , 10 3 , 10 2 , 10 1 , 10 0 fg / mL concentration gradient, adding templates containing different concentrations to the reaction system of Cas13a, dropping them on the labeled rGO-PPy-AuNPs-SPCE working electrode, and incubating them at 37°C for 30 minutes. After rinsing with ultrapure water and drying at room temperature, the SWV electrochemical signal was measured in 100mM NaCl 10mM Tris buffer (pH8.0). The experimental results are shown in Figure 7 As shown in (A), the change of the electrochemical peak of SWV response is positively correlated with the template concentration. As the template concentration increases, the electrochemical peak of SWV decreases more. The linear regression equation, linear range, correlation coefficient and detection limit are shown in Figure 7 As shown in (B), the linear regression equation is: Y = 6.673X + 16.986, R 2 =0.9963; Y is the current response rate ΔI (%), X is the logarithmic value of the PEDV template concentration (fg / mL), and the lowest detection concentration reaches 3.9 copies / μL.

[0099] Furthermore, in order to exclude the non-specific effects of this method in detecting PEDV, water, Transmissible Gastroenteritis Virus (TGEV), Porcine Deltacoronavirus (PDCoV), Classical Swine Fever Virus (CSFV) were used as negative controls for experiments. The results showed that only in the experiment with the addition of PEDV RNA samples, the ΔI (%) value changed significantly, while the ΔI (%) values ​​of the other negative samples did not change. The results are shown in Figure 8 .

[0100] 3. In order to further ensure the accuracy of the solution, actual sample verification experiments were also carried out

[0101] Nucleic acids were extracted from 30 blood samples and tested using RT-qPCR and CRISPR combined with rGO-PPy-AuNPs-SPCE electrochemical biosensor methods. The CRISPR combined with rGO-PPy-AuNPs-SPCE electrochemical biosensor method obtained consistent detection results with RT-qPCR and other methods within 45 minutes. The results are as follows Fig. 9 However, the RT-qPCR method is relatively time-consuming, the instrument is expensive, and it cannot achieve rapid on-site detection.

[0102] The embodiments described above provide a detailed description of the technical solutions and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, supplements and equivalent substitutions made within the scope of the principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A crRNA set of CRISPR-Cas13a for detecting PEDV, characterized in that, including at least one of PEDV-crRNA 3, PEDV-crRNA4, and PEDV-crRNA9; The nucleotide sequence of PEDV-crRNA3 is shown in SEQ ID NO.30, the nucleotide sequence of PEDV-crRNA4 is shown in SEQ ID NO.31, and the nucleotide sequence of PEDV-crRNA 9 is shown in SEQ ID NO.

36.

2. An electrochemical biosensor system for detecting PEDV based on CRISPR-Cas13a, characterized in that: Including electrochemical biosensors and CRISPR-Cas13a systems; The electrochemical biosensor comprises a working electrode, the surface of which is modified with a reduced graphene oxide-polypyrrole-gold nanoparticle composite material layer and an MB-RNA probe; one end of the MB-RNA probe is modified with a thiol group and the other end is modified with an MB signal molecule, and the MB-RNA probe is connected to the reduced graphene oxide-polypyrrole-gold nanoparticle composite material layer through an Au-S bond; The CRISPR-Cas13a system includes the crRNA group and Cas13a described in claim 1.

3. The electrochemical biosensor system for detecting PEDV based on CRISPR-Cas13a according to claim 2, characterized in that The Cas13a is LwaCas13a.

4. The electrochemical biosensor system for detecting PEDV based on CRISPR-Cas13a according to claim 2, characterized in that The nucleotide sequence of the MB-RNA probe is shown in SEQ ID NO.

40.

5. The electrochemical biosensor system for detecting PEDV based on CRISPR-Cas13a according to claim 2, characterized in that The preparation method of the working electrode comprises: incubating the MB-RNA probe on the surface of the working electrode modified with a reduced graphene oxide-polypyrrole-gold nanoparticle composite material layer, and incubating with 6-mercapto-1-hexanol (MCH) to block the remaining sites.

6. The electrochemical biosensor system for detecting PEDV based on CRISPR-Cas13a according to claim 2, characterized in that: The preparation method of the working electrode modified with the reduced graphene oxide-polypyrrole-gold nanoparticle composite material layer comprises: (1) Depositing graphene oxide on a working electrode by cyclic voltammetry (CV) and reducing it to reduced graphene oxide; (2) depositing polypyrrole (PPy) on the surface of the reduced graphene oxide layer; (3) dripping a gold nanoparticle (AuNPs) suspension onto the surface of the polypyrrole layer and drying it to obtain a working electrode modified with a reduced graphene oxide-polypyrrole-gold nanoparticle composite material layer.

7. The electrochemical biosensor system for detecting PEDV based on CRISPR-Cas13a according to claim 2, characterized in that The electrochemical biosensor also includes an auxiliary electrode and a reference electrode; the auxiliary electrode is carbon, and the reference electrode is silver-silver chloride.

8. Use of the electrochemical biosensor system according to any one of claims 2 to 7 in the preparation of a product for detecting PEDV.

Images