Preparation method and application of cuticle-thickened tobacco

Abstract

The invention discloses a preparation method and application of thickened cuticle tobacco, and aims to solve the technical problems that at present, research on plant epidermis cuticle generation genes is insufficient, and a molecular regulation network for cuticle development is not clear. According to the application, a plant cuticle negative regulation gene MYB-like is screened and identified, and by constructing a gene knockout plant and performing phenotype observation and foliar chemical component analysis, the NtMYB-like knockout strain leaf epidermis thickness is increased, the cuticle is thickened, and the wax content is remarkably increased, which indicates that the gene can negatively regulate the development of the plant cuticle. The application is of great significance to researches on molecular regulation network research of plant cuticle formation, plant cuticle development regulation, crop stress resistance quality improvement, fruit and vegetable preservation and the like.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and in particular to a preparation method of thickened stratum corneum tobacco and its application. Background Art

[0002] Plant epidermal tissue is the outer layer of cells that are in direct contact with the environment. It not only provides mechanical support for the integrity of plant organs, but also helps plants resist external environmental damage, sense environmental stimuli, and transmit signals. The cuticle is a lipid water-retaining layer on the outer surface of the epidermal tissue of terrestrial plants. It is formed during embryogenesis and early organ development. The cuticle is composed of two core components: cutin and wax. Cutin is mainly composed of polyesters formed by the polymerization of esterified hydroxy fatty acids, while wax is rich in very long-chain saturated fatty acids and their derivatives. After the precursors of these two components are synthesized on the endoplasmic reticulum, they will pass through the plasma membrane and penetrate the polysaccharide cell wall, and finally be transported to the surface of plant cells, where they are tightly arranged to form a highly hydrophobic protective layer. This highly specific cuticle structure plays multiple key roles on the surface of plants, which can effectively reduce the evaporation of water on the surface of plants and maintain water balance in the body. In addition, the cuticle also has self-cleaning ability, which can reduce the accumulation of pollutants such as dust and spores of diseases and insects on the leaf surface. More importantly, it can also serve as a solid line of defense to resist the invasion of harmful organisms such as microorganisms and insects, and escort the normal growth and development of plants.

[0003] The development of plant epidermis is a complex process, including the acquisition of epidermal cell fate, the maintenance of epidermal cell fate and the formation of mature epidermis. Although this process is crucial to plant growth, the complete molecular network of plant epidermis formation has not yet been fully resolved. In recent years, studies have revealed that members of the homeodomain-leucine zipper protein (HD-ZIP) IV family are mainly involved in epidermal cell differentiation, anthocyanin accumulation and trichome formation. NtHDZIP9 Gene found to positively regulate plant epidermal development: overexpression NtHDZIP9 Plants with the gene knocked out showed a thickened cuticle, while plants with the gene knocked out showed a thinner cuticle.

[0004] Although there are more and more reports on genes related to cuticle biosynthesis, transport and regulation, research on genes that negatively regulate plant cuticle development is still relatively scarce, resulting in the lack of clarity of the molecular regulatory network of cuticle formation. Therefore, in-depth exploration of genes that regulate plant cuticle development and studying the molecular regulatory network of plant cuticle formation have far-reaching significance for understanding the regulatory mechanism of plant cuticle development, improving crop stress resistance, and improving fruit and vegetable preservation technology.

[0005] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0006] Studies have found that tobacco NtHDZIP9 Genes can positively regulate plant epidermal development: overexpression NtHDZIP9 Plants with the gene showed a thickened cuticle, while plants with the gene knocked out showed a thinner cuticle. NtHDZIP9 Comparative analysis of transcriptomes of knockout strains revealed a MYB family gene NtMYB- like , which is NtHDZIP9 The expression level in the knockout strain was significantly higher than that in the control plant. Further research found NtMYB-like Negatively regulate the development of tobacco leaf epidermis. Based on this, the present application provides a preparation method of thickened cuticle tobacco and its application, aiming to solve the technical problems of insufficient research on the genes of plant epidermal cuticle and unclear molecular regulatory network of cuticle development.

[0007] According to the first aspect of the present disclosure, a plant epidermal regulatory gene is provided. NtMYB-like , whose nucleotide sequence is shown in SEQ ID NO.1.

[0008] According to a second aspect of the present disclosure, there is provided a plant epidermal regulatory gene NtMYB-like The encoded protein has an amino acid sequence as shown in SEQ ID NO.2.

[0009] According to the third aspect of the present disclosure, a biological material is provided, comprising the plant epidermal regulatory gene NtMYB-like or fragments thereof.

[0010] In some embodiments of the present disclosure, the biological material is recombinant DNA, an expression cassette, a plasmid vector, a viral vector or an engineered bacterium.

[0011] According to the fourth aspect of the present disclosure, the plant epidermal regulatory gene NtMYB-like , the encoded protein or the biological material is used in any one of the following (1) to (7): (1) Application in negatively regulating the thickness of plant epidermis or in preparing reagents for negatively regulating the thickness of plant epidermis; (2) Application in negatively regulating the thickening of plant cuticle or in preparing reagents for negatively regulating the thickening of cuticle; (3) Application in negatively regulating the wax content of plant leaves or in preparing reagents for negatively regulating the wax content of plant leaves; (4) Application in negatively regulating the content of plant leaf components or in preparing a method for negatively regulating the content of plant leaf components, wherein the leaf component is at least one of a straight-chain alkane, a branched-chain alkane, a primary alcohol, and a triterpenoid compound; (5) Application in the construction of transgenic plants with thickened epidermis, cuticle and / or wax layer or in the breeding of new varieties / lines; (6) Application in improving plant stress resistance or preparing reagents for improving plant stress resistance; (7) Application in improving the preservation performance of fruits and vegetables or in the preparation of reagents for improving the preservation performance of fruits and vegetables.

[0012] In some embodiments of the present disclosure, knocking out or down-regulating the expression of the plant epidermal regulatory gene NtMYB-like .

[0013] In some embodiments of the present disclosure, the plant comprises tobacco.

[0014] According to a fifth aspect of the present disclosure, a method for cultivating stress-resistant tobacco is provided, comprising the following steps: (1) Design based on conservative sequences sgRNA Primers, construct the plant epidermal development negative regulatory gene MYB-like Gene editing vectors; (2) transforming the gene editing vector into a recipient tobacco and cultivating the recipient tobacco to obtain a transgenic tobacco with thickened epidermis, cuticle and / or wax layer One or more technical solutions provided in the embodiments of the present application have at least any of the following technical effects or advantages: Screening and identification of negative regulatory genes of plant cuticle MYB-like , which encodes 450 amino acids and 1 stop codon, has a typical MYB DNA-binding domain, and is expressed at the highest level in plant epidermal tissue, making it a dominantly expressed gene in the epidermis. Based on the phenotypic and physiological characteristics of knockout plants and controls, the study showed that compared with the control plants, NtMYB-like The mutant (M) has obvious leaf veins and darker green leaves; the leaf wax is more complete, the epidermis is thicker, the cuticle is thicker, and the cuticle structure is clear; and NtMYB-like The wax content (such as straight-chain alkanes, branched-chain alkanes, primary alcohols and triterpenoids) of the mutant was significantly higher than that of the control, indicating that the gene can negatively regulate the development of the plant epidermal cuticle. Therefore, it is of great significance for the study of the molecular regulatory network of plant cuticle formation, the regulation of plant cuticle development, the improvement of crop stress resistance and quality, and the preservation of fruits and vegetables. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the prediction result of the conserved domain of tobacco NtMYB-like protein in one embodiment of the present application.

[0016] Figure 2 In one embodiment of the present application, tobacco NtMYB-like Analysis results of tissue expression characteristics of genes.

[0017] Figure 3 In one embodiment of the present application, tobacco NtMYB-like Analysis diagram of gene mutant sequencing; the control strain (CK) is the common flue-cured tobacco variety Cui Bi No. 1; M is NtMYB-like Gene mutant plants.

[0018] Figure 4 The following is a picture of the epidermal phenotype of tobacco leaves in one embodiment of the present application; wherein A: leaf morphology observation result; B: electron microscopic observation result of leaf wax; C: transmission electron microscopic observation result of leaf epidermal layer; common tobacco flue-cured tobacco variety Cui Bi No. 1: control strain (CK); M: NtMYB-like Gene mutant plants.

[0019] Figure 5 This is a statistical analysis chart of the leaf wax content in one embodiment of the present application; ordinary flue-cured tobacco variety Cui Bi No. 1: control strain (CK); M: NtMYB-like Gene mutant plants. DETAILED DESCRIPTION

[0020] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents unless otherwise specified; the detection methods involved are all conventional methods unless otherwise specified.

[0021] In order to better understand the technical solution of the present application, the above technical solution will be described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0022] Example 1, ordinary tobacco NtMYB-like Gene cloning and bioinformatics analysis This example is based on common tobacco ( Nicotiana tobacum ) NtHDZIP9 The results of the study on the positive regulation of plant epidermal development by genes (Xu et al, 2023, Industrial Crop & Products) found that NtMYB-like Gene in NtHDZIP9 The expression level of the knockout strain was significantly higher than that of the control plant, suggesting that the gene may negatively regulate plant epidermal development. Therefore, the gene was cloned and bioinformatics analyzed.

[0023] 1. Ordinary tobacco NtMYB-like Gene cloning (1) Cultivate the common flue-cured tobacco variety Cui Bi No. 1 seedlings to the six-leaf stage, take 5 g of leaves, add liquid nitrogen and grind them into powder, use the Beijing Zhuangmeng Biotechnology Plant Total RNA Extraction Kit to extract the total RNA of the leaves, and reverse transcribe the RNA into cDNA.

[0024] (2) Gene cloning: Designed using Primer 5.0 software MYB-like The CDS amplification primers of the gene are used to perform PCR amplification using cDNA as a template.

[0025] PCR system (20 μL): 10 μL Mix; 0.5 μL each of F / R; 1.0 μL cDNA; 8.0 μL ddH2O.

[0026] PCR amplification program: 95°C, 5 min; 95°C, 50 s; 56°C, 50 s; 72°C, 2 min; 35 cycles; 72°C, 10 min.

[0027] Amplification primers are as follows: F: 5'-TCTCTTTCTTGCTACAAACAGTT-3'; R: 5'-TTACCATTTCATTGGGACTCA-3'.

[0028] (3) The PCR amplification results were detected by agarose gel electrophoresis, and an amplified band was found at approximately 1500 bp.

[0029] (4) Use a DNA recovery kit to recover PCR products.

[0030] (5) Connect the recovered PCR product to the pMD19-T vector.

[0031] (6) The ligation product was transformed into Escherichia coli DH™ 5α competent cells by heat shock method, positive colonies were detected by PCR, and the plasmids of positive colonies were extracted for DNA sequencing.

[0032] 2. Prediction of sequence conserved domains Obtained by sequencing NtMYB-like The CDS sequence of the gene was submitted to CD Search (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) for conservative domain analysis. Figure 1 As shown, the cloned tobacco NtMYB-likeThe gene encodes 450 amino acids and 1 stop codon, and has a conserved MYB DNA-binding domain. It is speculated that the gene belongs to the plant-specific SANT family member.

[0033] Example 2, ordinary tobacco NtMYB-like Analysis of gene tissue expression characteristics The common flue-cured tobacco variety Cuibi No. 1 was cultivated to the six-leaf stage. The roots, stems, leaves, stem epidermis and peeled stems of the tobacco seedlings were collected to extract total RNA from the samples and synthesize cDNA by reverse transcription. Primer 5.0 software was used to design real-time fluorescence quantitative (qRT) PCR primers. NtL25 As an internal reference gene, qRT-PCR analysis was performed NtMYB-like The qRT-PCR reaction was performed on a LightCycler® 480 II fluorescent quantitative PCR instrument according to 2 −ΔΔCT Formula calculation NtMYB-like Relative expression of genes.

[0034] The primers for qRT-PCR amplification are: NtMYB-like- F: 5'-TATGGCCCTCAGAATTGGAAC-3'; NtMYB-like -R: 5'-AATCTATGTGCTGCCATTAGTCTTT-3'; NtL25 -F: 5'-CCCCTCACCACAGAGTCTGC-3'; NtL25 -R: 5'-TTCTAACTCCTGTTGTTGTGGGAA-3'.

[0035] qRT-PCR reaction system: 2.0 μL cDNA, 10.0 μL AceQ Universal SYBR qPCR MasterMix (Vazyme, China), 1.0 μL each of F / R primers, and 6 μL ddH2O.

[0036] qRT-PCR reaction program: 95°C for 10 min; 95°C for 10 s, 60°C for 30 s, 35 cycles.

[0037] The results are as follows Figure 2 As shown, NtMYB-like The gene was expressed at the highest level in the stem epidermis, at lower levels in the roots, stems and leaves, and not in the peeled stems. NtMYB-likeGenes that are dominantly expressed in the epidermis.

[0038] Example 3, ordinary tobacco NtMYB-like Obtaining gene knockout plants To further study tobacco NtMYB-like The function of the gene, in this case, in tobacco NtMYB-like The gene is knocked out to construct a gene knockout strain. The specific steps are as follows: 1. Construction of knockout vector According to tobacco NtMYB-like The genomic sequence of gRNA was designed and synthesized (TCCTATGAGTTCTACTTCAA TGG , the underlined area is marked as PAM region, completed by Hangzhou Biotech Co., Ltd.).

[0039] Oligo dimer and CRISPR / Cas9 vector ligation reaction system: CRISPR / Cas9 vector 2.0 μL, Oligo dimer 1.0 μL, Enzyme Mix 1.0 μL, ddH2O 6 μL. The ligation product was transformed into E. coli DH™ 5α competent cells by heat shock method, and the positive plasmid was extracted for DNA sequencing and screening. NtMYB-like -knock out gene editing vectors.

[0040] 2. NtMYB-like -Knock out gene editing vector to transform Agrobacterium (1) Take about 500 ng NtMYB-like The knock-out plasmid was added to the Agrobacterium GV3101 competent cells and mixed well, placed on ice for 30 min, quickly frozen in liquid nitrogen for 8 min, and immediately placed in a 37°C water bath for heat shock for 5 min.

[0041] (2) After heat shock, place the competent cells on ice for 5 min, add 500 μL YEB medium, and activate the cells by shaking at 28°C and 160 rpm for 2 h.

[0042] (3) Spread the bacterial solution on a YEB plate containing Kan resistance and culture for 2 days, then screen the positive colonies by PCR.

[0043] 3. Obtaining gene knockout tobacco plants The leaves of common flue-cured tobacco variety Cui Bi No. 1 were genetically transformed by Agrobacterium infection, and the transformed leaves were placed on a differentiation medium containing 30 mg / L hygromycin for screening.

[0044] 4. NtMYB-like Screening of mutant plants DNA from leaves of positive transgenic plants was extracted, and detection primers (F: 5'-TGGGATTGAGGATTTTCTGTTAG-3', R: 5'-CTGCTTCATCTAAACTCTGAGAA-3') were designed on both sides of the gene knockout target site. The PCR reaction conditions were: 95°C for 5 min; 95°C for 50 s, 56°C for 50 s, 72°C for 40 s, 35 cycles; 72°C for 10 min. The PCR amplified bands were recovered and purified and then connected to the pMD19-T cloning vector. The positive clones were screened to extract the plasmids and sent to BGI for DNA sequencing.

[0045] The sequencing results are as follows Figure 3 As shown, there are two NtMYB-like Sequence type, by obtaining two homozygous mutants (M) with mutations in both sequence types, among which the first sequence type (M1-Ⅰ) of the M1 plant had a mutation before the SG sequence (C-TTCTACT), the CA in the SG sequence mutated to GG, and two point mutations (AT and TC) occurred after the SG sequence; the second sequence type (M1-Ⅱ) of the M1 plant had a T inserted in the SG sequence, causing a frameshift mutation; the first sequence type (M2-Ⅰ) of the M2 plant had a 31-base deletion near the SG sequence, causing a frameshift mutation; the second sequence type (M2-Ⅱ) of the M2 plant had five bases inserted in the SG sequence (TACTT), causing a frameshift mutation.

[0046] Embodiment 4: NtMYB-like Epidermal morphological identification and leaf chemical composition analysis of mutants 1. Epidermal morphology identification The common flue-cured tobacco variety Cuibi No. 1 was used as a control, and the recombinant NtMYB-like The mutant plants were used as the test group, and the tobacco seedlings were cultured to the six-leaf stage, and the morphology of the leaf epidermis was observed. The specific operation steps are as follows: Select a 20-day-old leaf from the same position and take a 1 cm section from the middle of the sixth to seventh vein on the right side of the leaf. 2 The leaves were placed in 2.5% glutaraldehyde fixative at room temperature for 2 h and then stored at 4°C.

[0047] Observation of wax morphology: The samples were fixed, dehydrated, dried and gold-sprayed in sequence, and the wax morphology of the leaf epidermis was observed using a scanning electron microscope.

[0048] Observation of epidermal morphology: The samples were fixed, dehydrated at room temperature, embedded in epoxy resin, polymerized, ultrathinly sectioned, stained with uranyl acetate and lead citrate, and the epidermal morphology was observed using a transmission electron microscope.

[0049] The results are as followsFigure 4 Compared with the control, the two NtMYB-like The veins of the mutant (M) leaves are clearly visible and the color is a richer green; the surface of the leaves is covered with a complete layer of wax, which enhances its protective effect; in addition, the thickness of the leaf epidermis has increased and the cuticle has become thicker, making the overall structure clearer.

[0050] 2. Analysis of leaf chemical composition The common flue-cured tobacco variety Cuibi No. 1 was used as a control, and the recombinant NtMYB-like The mutant plants were used as the test group, and the tobacco seedlings were cultured to the six-leaf stage, and the leaf surface components were determined. The specific operation steps are as follows: Select 20 leaf discs (10 cm in diameter) from the same position with a leaf age of 20 days and calculate the total leaf area S. The leaf discs were successively soaked in 500 mL of chloroform for 1 min, and 0.5 mL of C 24 Internal standard, concentrated and blown dry. Add 500 μL pyridine to dissolve the wax, add the derivatization agent BSTFA at a ratio of 1:1 (V:V), and derivatize in a 70°C water bath for 1 h. After the derivatization reaction, blow dry with nitrogen, add 1.5 mL chloroform, and perform qualitative and quantitative analysis of the chemical composition by GC / MS. The compound composition is determined by searching the spectral library (NIST08), and the area of ​​the corresponding peak curve and baseline of each substance is integrated to obtain the specific value.

[0051] The results are as follows Figure 5 As shown, tobacco leaf wax content is rich, among which straight-chain alkanes content is the highest, followed by branched alkanes content, and primary alcohols and triterpenoids content is relatively low. NtMYB-like The contents of straight-chain alkanes, branched-chain alkanes, primary alcohols and triterpenoids in the mutant (M) were significantly increased; NtMYB-like The total wax content of the mutant (M) was significantly higher than that of the control.

[0052] The above results prove that NtMYB-like It can negatively regulate the development of tobacco leaf epidermis. Its research on the molecular regulatory network of plant cuticle formation is of great significance for the research on plant cuticle development regulation, crop stress resistance quality improvement and fruit and vegetable preservation.

[0053] Although some preferred embodiments of the present application have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present application.

[0054] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the inventive concept. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. A plant epidermal regulatory gene NtMYB-like , whose nucleotide sequence is shown in SEQ ID NO.

1.

2. The plant epidermal regulatory gene according to claim 1 NtMYB-like The encoded protein has an amino acid sequence as shown in SEQ ID NO.

2.

3. A biological material containing the plant epidermal regulatory gene according to claim 1 NtMYB-like or fragments thereof.

4. The biomaterial according to claim 3, characterized in that The biological material is recombinant DNA, expression box, plasmid vector, virus vector or engineering bacteria.

5. The plant epidermal regulatory gene according to claim 1 NtMYB-like , Use of the encoded protein according to claim 2 or the biological material according to claim 3 in any of the following (1) to (7): (1) Application in negatively regulating the thickness of plant epidermis or in preparing reagents for negatively regulating the thickness of plant epidermis; (2) Application in negatively regulating the thickening of plant cuticle or in preparing reagents for negatively regulating the thickening of cuticle; (3) Application in negatively regulating the wax content of plant leaves or in preparing reagents for negatively regulating the wax content of plant leaves; (4) Application in negatively regulating the content of plant leaf components or in preparing a method for negatively regulating the content of plant leaf components, wherein the leaf component is at least one of a straight-chain alkane, a branched-chain alkane, a primary alcohol, and a triterpenoid compound; (5) Application in the construction of transgenic plants with thickened epidermis, cuticle and / or wax layer or in the breeding of new varieties / lines; (6) Application in improving plant stress resistance or preparing reagents for improving plant stress resistance; (7) Application in improving the preservation performance of fruits and vegetables or in the preparation of reagents for improving the preservation performance of fruits and vegetables.

6. The use according to claim 5, characterized in that: Knock out or down-regulate the expression of the plant epidermal regulatory gene NtMYB-like .

7. The use according to claim 5, characterized in that: The plants include tobacco.

8. A method for cultivating stress-resistant tobacco, characterized in that: The following steps are involved: (1) Design based on conservative sequences sgRNA Primers, construct the plant epidermal regulatory gene MYB-like Gene editing vectors; (2) Transforming the gene editing vector into recipient tobacco and cultivating the recipient tobacco to obtain transgenic tobacco with thickened epidermis, cuticle and / or wax layer.

Images