Growth and development gene of gossypium hirsutum and application thereof
By mining the upland cotton growth and development gene Gohir.A08G240900, and using reverse transcription and virus-induced gene silencing technology, cotton plant height was regulated, solving the problem of unsuitable cotton plant height, improving yield and quality, and reducing harvesting costs.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NANTONG UNIV
- Filing Date
- 2025-02-25
- Publication Date
- 2026-04-24
AI Technical Summary
In existing technologies, unsuitable cotton plant height leads to insufficient sunlight, lodging, and reduced fiber quality, affecting cotton yield and the cost of mechanized harvesting, and there is a lack of effective gene regulation methods.
By mining the growth and development gene Gohir.A08G240900 of upland cotton, and using reverse transcription and virus-induced gene silencing technology, plant height can be regulated, and recombinant vectors can be provided for gene editing to increase or decrease plant height.
This has enabled effective control of upland cotton plant height, improved cotton yield and fiber quality, reduced harvesting costs, and provided a new foundation for genetic breeding.
Smart Images

Figure CN119932048B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetics, specifically to a growth and development gene of upland cotton and its application. Background Technology
[0002] Cotton is the second largest crop after grain, and its yield is directly related to the stable development of society and the economy. With the growth of the global population and the acceleration of urbanization, land resources for agricultural production are becoming increasingly scarce. How to increase cotton production on limited land resources is an important way to meet the growing demand for cotton and ensure the sustainable development of the cotton industry.
[0003] The height of cotton plants directly affects their growth and development. If the plants are too short, the leaves may shade each other, leading to insufficient sunlight, affecting photosynthetic efficiency, and thus limiting the growth rate and yield of cotton. Simultaneously, too short a plant height reduces the number of fruiting branches and bolls, impacting yield. If cotton plants grow too tall, they tend to have too many branches, resulting in weak overall seedlings and a tendency to lodging, further affecting yield, reducing fiber quality, hindering mechanized harvesting, and increasing harvesting costs.
[0004] Therefore, it is necessary to further study the genes that affect cotton plant height, understand their regulatory mechanisms, and use these genes to breed tall cotton varieties, select cotton varieties with appropriate plant height, and improve cotton yield. These are urgent technical problems that need to be solved. Summary of the Invention
[0005] In view of the problems existing in the prior art, the present invention provides a growth and development gene of upland cotton and its application.
[0006] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution: a growth and development gene for upland cotton, wherein the nucleotide sequence of the upland cotton growth and development gene Gohir.A08G240900 is shown in SEQ ID No.1.
[0007] Furthermore, the nucleotide sequences of the upstream and downstream primers for amplifying the growth and development gene Gohir.A08G240900 are shown in SEQ ID No.2 and SEQ ID No.3, respectively.
[0008] Furthermore, the present invention also provides an application of the aforementioned upland cotton growth and development gene Gohir.A08G240900 in improving the height of upland cotton plants.
[0009] Furthermore, the present invention also provides a recombinant vector containing the aforementioned growth and development gene Gohir.A08G240900.
[0010] Furthermore, the present invention also provides an application of the recombinant carrier described above in improving the growth rate of upland cotton plants.
[0011] Compared with existing technologies, this invention has the following beneficial effects: This invention, through reverse transcription of upland cotton RNA, identifies the gene Gohir.A08G240900, which is related to growth and development. This gene can affect the plant height of upland cotton, and its expression level is high in tall upland cotton plants, while its expression level is significantly reduced in short upland cotton plants. Simultaneously, through virus-induced gene silencing (VIGS) experiments, it was found that silencing the Gohir.A08G240900 gene leads to impaired plant growth and development, thus affecting plant growth and resulting in a significantly shorter plant height phenotype. This indicates that the Gohir.A08G240900 gene is a potential target for regulating plant height, providing a new genetic basis for improving upland cotton plant height. Attached Figure Description
[0012] Figure 1 A schematic diagram showing the expression levels of the growth and development gene Gohir.A08G240900 in different varieties of upland cotton;
[0013] Figure 2 This is a schematic diagram showing the expression level of the growth and development gene Gohir.A08G240900 after VIGS silencing.
[0014] Figure 3 A statistical comparison of plant height in upland cotton after three weeks of expression and inhibition of the growth and development gene Gohir.A08G240900;
[0015] Figure 4 This is a comparison of the expression and suppression of the growth and development gene Gohir.A08G240900 in upland cotton. Detailed Implementation
[0016] The technical solution of the present invention will be further explained and described below with reference to the accompanying drawings.
[0017] Arabinogalactanpeptides (AGPs) are widely distributed in plants and participate in various biological processes, including growth, development, cell division, and even reproductive development. To further confirm the role of AGP genes in upland cotton in regulating growth and development, two naturally tall lines (Sumian 30 and Jinxiumian 1) and two naturally short lines (Xinluzhong 21 and Xinluzao 74) were selected. RT-qPCR analysis was used to determine significant differences in the expression of certain members of the AGP family in upland cotton plants of different heights. It was found that only one gene, Gohir.A08G240900, showed a significantly higher level in the taller lines. Therefore, this invention provides a growth and development gene for upland cotton. The nucleotide sequence of the upland cotton growth and development gene Gohir.A08G240900 is shown in SEQ ID No. 1. This growth and development gene Gohir.A08G240900 can directly affect the morphology of upland cotton plants.
[0018] To further confirm whether the growth and development gene Gohir.A08G240900 can affect the growth and development of upland cotton and even the plant type, two tall upland cotton varieties, Su Mian 30 and Jinxiu Mian 1, and two short varieties, Xinluzhong 21 and Xinluzao 74, were selected. The terminal buds with cotyledons not fully unfolded and less than 1 cm in length were taken for RNA extraction. The RNA was extracted using a polysaccharide and polyphenol RNA extraction kit (Tiangen). The cDNA was obtained by reverse transcription using the HiScriptIII RT SuperMix for qPCR (+gDNAWiper) kit (Vazyme, Nanjing, China). The expression level of the Gohir.A08G240900 gene was then analyzed by RT-qPCR. Real-time quantitative PCR analysis was performed using the ChamQSYBR qPCRMaster Mix (LowROX Premixed) kit (Vazyme, Nanjing, China). Primers for the gene Gohir.A08G240900 were designed using Primer 6.0. The nucleotide sequence of the upstream primer for Gohir.A08G240900 is shown in SEQ ID No. 2: 5'-GTCATTGTGGCGTTGTTGTTC-3', and the nucleotide sequence of the downstream primer for Gohir.A08G240900 is shown in SEQ ID No. 3: 5'-CAATCGCAGCACCGTCATT-3'. The reaction volume was 20 μL, and the amplification program was: 95℃ pre-denaturation for 30 seconds, 95℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, for 40 cycles. Each gene was biologically replicated three times and technically replicated three times. Figure 1 The expression levels of the growth and development gene Gohir.A08G240900 in different upland cotton varieties were compared. It can be seen that the expression levels of the growth and development gene Gohir.A08G240900 in the four upland cotton varieties are from high to low as follows: Jinxiu Cotton No. 1, Su Cotton No. 30, Xinluzao 74 and Xinluzhong 21. This indicates that the growth and development gene Gohir.A08G240900 has a higher expression level in tall upland cotton varieties.
[0019] To further investigate the role of the gene Gohir.A08G240900 in the growth and development of upland cotton, a VIGS vector silencing the growth and development gene Gohir.A08G240900 in the upland cotton variety "Su Mian 30" was constructed through virus induction. Specifically:
[0020] (1) Using Su Mian 30 as experimental material, whole and similar seeds were soaked in carbendazim for disinfection, and then planted in flower pots mixed with nutrient soil and vermiculite, with a mass ratio of nutrient soil to vermiculite of 3:1; the greenhouse temperature was kept at 25℃, and the light and dark time was set to 16 hours and 8 hours, and light and dark were given alternately.
[0021] (2) When the cotyledons of SuMian 30 are fully expanded and the first true leaf has just appeared, the virus-induced gene silencing VIGS experiment is carried out. Since the gene Gohir.A08G240900 is relatively short, its full-length sequence is ligated into the pTRV2 vector for the VIGS experiment: In the VIGS experiment, the upstream primer sequence of the gene Gohir.A08G240900 is shown in SEQ ID No.4: ATGAGTTCAATAAAGGTGCATG, and the downstream primer sequence is shown in SEQ ID No.5: ATGGATGAGGTAAGTAATTGCCAA; the gene is amplified by PCR, and the target gene sequence is inserted into the pTRV2 vector. The vector pTRV2:Gohir.A08G240900 is constructed by treating it with EcoR1 and BamH1 enzymes. Then, the vector pTRV2:Gohir.A08G240900 was transformed into Agrobacterium tumefaciens (GV3101). After screening for positive clones, the bacterial solution was injected into the cotyledons of Sumian 30 seedlings using a sterile syringe, completing the infection before the first true leaf fully unfolded. After 24 hours of dark treatment, the seedlings were transferred to an artificial climate chamber. Approximately two weeks after Agrobacterium infection, the true leaves of the positive control TRV2:CLA1 showed a distinct whitening phenotype; by the third week post-infection, the true leaves of TRV2:CLA1 were observed to be completely white, as shown in the image. Figure 2 As shown in the left figure, this study demonstrates that VIGS can effectively silence the target gene.
[0022] The GhCLA (cloroplastos alterados) used in this study is a homolog of AtCLA1, a gene in Arabidopsis thaliana responsible for chloroplast development; therefore, its mutant (CLA1) exhibits an albino phenotype. TRV belongs to the genus Tobravirus (family Virgaviridae). TRV vectors have been shown to be effective in silencing the chloroplast alterados 1 (CLA1) gene in G. hirsutum and G. barbadense. Therefore, the silencing of the GhCLA gene demonstrates that the VIGS procedure used in this study is correct and effective.
[0023] like Figure 2 The right image and Figure 3 Compared with the untreated control group TRV2:00, the plant height of the silenced pTRV2:Gohir.A08G240900 group of Sumian 30 was significantly reduced. RNA was extracted from the second true leaf of both TRV2:Gohir.A08G240900 and TRV2:00 groups, and the expression level was measured to verify the gene silencing effect. RT-qPCR analysis showed that when comparing the silenced plants with the control plants, as... Figure 4 It can be seen that the expression of the Gohir.A08G240900 gene in the virus-induced gene silencing plant pTRV2:Gohir.A08G240900 is almost zero, that is, the expression level of the Gohir.A08G240900 gene in the silenced plant is significantly suppressed. This result proves that the gene silencing effect is successful.
[0024] Therefore, silencing the Gohir.A08G240900 gene leads to impaired plant growth and development, resulting in a significantly shorter plant height. This indicates that the Gohir.A08G240900 gene is a potential target for regulating plant height, providing a new genetic basis for improving upland cotton plant height. For upland cotton plants with excessively short plant height, promoting the expression of the growth and development gene Gohir.A08G240900 can increase plant height; conversely, for upland cotton plants with excessively tall plant height, gene editing and other methods can be used to suppress the expression of the Gohir.A08G240900 gene, thereby reducing plant height. Therefore, by regulating the growth and development gene Gohir.A08G240900, upland cotton can achieve an appropriate plant height, thus increasing cotton yield.
[0025] This invention identifies the gene Gohir.A08G240900, which is related to growth and development, through reverse transcription of upland cotton RNA. This gene affects the plant height of upland cotton, with higher expression levels in taller plants and significantly lower expression levels in shorter plants. Furthermore, a virus-induced gene silencing (VIGS) experiment revealed that silencing Gohir.A08G240900 affects plant height, indicating that Gohir.A08G240900 is a potential target for regulating plant height, providing a new genetic basis for improving upland cotton plant height.
[0026] The above are merely preferred embodiments of the present invention. The scope of protection of the present invention is not limited to the above embodiments. All technical solutions falling within the scope of the present invention's concept are within the scope of protection of the present invention. It should be noted that for those skilled in the art, any improvements and modifications made without departing from the principles of the present invention should be considered within the scope of protection of the present invention.
Claims
1. A method for silencing growth and development genes in upland cotton Delayed.A08G240900 Its application in reducing the height of upland cotton plants is characterized by, The growth and development genes of upland cotton Delayed.A08G240900 nucleotide sequences such as SEQ ID No.1 As shown.