Recombinant trichoderma reesei strain as well as construction method and application thereof

Abstract

The invention provides a recombinant trichoderma reesei strain and a construction method and application thereof, and the construction method of the recombinant trichoderma reesei strain comprises the following steps: directionally integrating a laccase gene LAC and a manganese peroxidase MnP gene to an extracellular protease gene SLP1 site and a uracil synthesis gene URA5 site on a trichoderma reesei genome respectively; and constructing the LAC / MnP co-expressed recombinant trichoderma reesei strain. The laccase and manganese peroxidase genes are co-expressed in the trichoderma reesei for the first time, a self-contained double-enzyme production system is constructed, the problems of enzyme source heterogeneity, mediator dependency and cost are fundamentally solved, and an efficient, economical and sustainable biological technical scheme is provided for printing and dyeing wastewater treatment.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial fermentation engineering and environmental governance, and in particular to a recombinant Trichoderma reesei strain and a construction method and use thereof. Background Art

[0002] With the acceleration of the global industrialization process, wastewater discharged from textile printing and dyeing, pharmaceutical, papermaking and other industries has become one of the main sources of water pollution. Although traditional physical and chemical treatment methods (such as adsorption, flocculation, and ozone oxidation) can partially remove dye pollutants, they have defects such as high treatment costs, secondary pollution (such as chemical sludge disposal), and high energy consumption, which makes it difficult to meet the needs of green and sustainable development. Therefore, it is urgent to carry out the treatment of printing and dyeing wastewater.

[0003] Wastewater treatment technology with laccase as the core has received great attention at home and abroad in recent years. Laccase (LAC, EC 1.10.3.2) is a type of polyphenol oxidase. As a multifunctional environmentally friendly catalyst, in addition to participating in the degradation of lignin, it can also catalyze the oxidation of a variety of phenolic and aromatic organic pollutants and their derivatives. However, there are still many difficulties in applying laccase to wastewater treatment. First, the traditional fungi (such as white rot fungi) have a long enzyme production cycle (10-15 days) and low yield (laccase activity is usually <100 U / L), which makes it difficult to apply on a large scale. Secondly, due to the low redox potential of laccase, small molecule mediators are required to mediate oxidation for some difficult-to-degrade dye pollutants. Mediators are a type of low molecular weight compound that acts as an electron transfer intermediate. In the catalytic process, they react with laccase quickly before the substrate, produce free radicals, and then oxidize the substrate, while being reduced themselves. Currently, the commonly used synthetic mediators have poor stability, are too expensive, and may cause secondary pollution to water bodies. Summary of the invention

[0004] In view of the above-mentioned shortcomings of the prior art, the purpose of the present invention is to provide a recombinant Trichoderma reesei and its construction method and use, which are used to solve the problems of high application cost of laccase, dependence on chemical mediators and high risk of secondary pollution in the existing printing and dyeing wastewater treatment technology.

[0005] To achieve the above-mentioned object and other related objects, the present invention provides a method for constructing a recombinant Trichoderma reesei strain, wherein the laccase gene LAC and the manganese peroxidase MnP gene are directionally integrated into the extracellular protease gene SLP1 site and the uracil synthesis gene URA5 site on the Trichoderma reesei genome, respectively, to construct a recombinant Trichoderma reesei strain that co-expresses LAC / MnP.

[0006] This application uses genetic engineering technology to Pleurotus ostreatus Laccase gene (LAC) and derived from Phanerodontia chrysosporiumThe manganese peroxidase (MnP) gene was integrated into the genome of Trichoderma reesei to construct a recombinant strain that can stably co-express two enzymes.

[0007] Preferably, the laccase gene LAC and the manganese peroxidase MnP gene are directionally integrated into the extracellular protease gene SLP1 site and the uracil synthesis gene URA5 site on the Trichoderma reesei genome, respectively, by using Agrobacterium-mediated homologous recombination technology; the strong promoter Pcbh1 and the terminator Tcbh1 are used to regulate the expression of the exogenous genes, and the recombinant Trichoderma reesei strain is obtained by double screening with hygromycin B and 5-fluoroorotic acid; the sequence of the strong promoter Pcbh1 is as shown in SEQ ID NO 1, and the sequence of the terminator Tcbh1 is as shown in SEQ ID NO 2.

[0008] The present application adopts a strong promoter Pcbh1 and a terminator Tcbh1 to regulate the expression of exogenous genes, which can ensure the efficient secretion of the dual enzymes during the fermentation process.

[0009] The present invention also provides a recombinant Trichoderma reesei strain obtained by the above construction method.

[0010] Preferably, the recombinant Trichoderma reesei strain is characterized in that: in the fermentation product obtained by fermenting the recombinant Trichoderma reesei strain at 28-32°C and 180rpm for 168 hours, the laccase activity reaches a peak value of 10.6 IU / mL at 96 hours, and the manganese peroxidase activity reaches a peak value of 2052.2U / L at 144 hours.

[0011] The present invention also provides a use of the above-mentioned recombinant Trichoderma reesei strain for dye decolorization. Preferably, the fermentation product obtained by the recombinant Trichoderma reesei strain under the conditions of 40°C and pH 5.0-5.5 has a 4-hour decolorization rate of 88.64% for malachite green and a 4-hour decolorization rate of 92.50% for reactive brilliant blue.

[0012] The present application can utilize the fermentation product of the above-mentioned recombinant Trichoderma reesei strain, and can achieve rapid decolorization of various dyes without adding chemical mediators, and has the characteristics of low cost, high efficiency, and environmental friendliness.

[0013] The present invention also provides a decolorizing composite bio-enzyme solution obtained by fermenting the above-mentioned recombinant Trichoderma reesei strain.

[0014] Preferably, the fermentation temperature is 28-32°C, the rotation speed is 180 rpm, and the fermentation time is 168 hours.

[0015] The present invention also provides a use of the above-mentioned decolorizing composite biological enzyme solution for decolorizing dyes.

[0016] Preferably, the decolorization composite bio-enzyme solution has a 4-hour decolorization rate of 88.64% for malachite green and a 4-hour decolorization rate of 92.50% for reactive brilliant blue.

[0017] As described above, the recombinant Trichoderma reesei strain of the present invention and its construction method and use have the following beneficial effects: (1) The present invention proposes for the first time to co-express laccase and manganese peroxidase genes in Trichoderma reesei to construct a self-sufficient dual-enzyme production system, fundamentally solving the problems of enzyme source heterogeneity, mediator dependence and cost, and providing an efficient, economical and sustainable biotechnology solution for the treatment of printing and dyeing wastewater; (2) The dual enzyme synergistic system can combine the advantages of LAC and MnP. The relevant technology is of great significance in promoting the large-scale application of biological enzymes in the biological treatment of polluted water bodies; (3) The present invention is applicable to the treatment of high-concentration dye wastewater in the printing and dyeing, papermaking, pharmaceutical and other industries, and has a significant treatment effect on wastewater containing difficult-to-degrade aromatic compounds. It can also be expanded to the fields of soil remediation and degradation of organic pollutants. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Shown is a schematic diagram of the LAC and MnP gene expression boxes.

[0019] Figure 2 Shown is the enzyme production process of recombinant Trichoderma reesei Tr_LAC / MnP.

[0020] Figure 3 Shown is the decolorization process of the dye malachite green by the recombinant LAC / MnP complex enzyme solution.

[0021] Figure 4 The figure shows the decolorization process of reactive brilliant blue by recombinant LAC / MnP complex enzyme solution. DETAILED DESCRIPTION

[0022] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0023] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0024] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0025] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the field of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields.

[0026] The culture medium used in the embodiment of the present invention is: The seed culture medium formula is: Glucose 20 g / L, yeast extract 9 g / L, (NH4)2SO4 5 g / L, KH2PO4 10 g / L, MgSO4·7H2O 1g / L, CaCl2 0.5 g / L, trace elements (FeSO4·7H2O 0.005 g / L, ZnSO4·7H2O 0.0014 g / L, MnSO4·H2O 0.0016 g / L, CoCl2·6H2O 0.0037 g / L), pH 4.8.

[0027] The fermentation medium formula is: Lactose 40 g / L, yeast extract 5 g / L, (NH4)2SO4 10 g / L, KH2PO4 10 g / L, CaCl2 0.5 g / L, CuSO4·5H2O 0.25 g / L, trace elements (FeSO4·7H2O 0.005 g / L, ZnSO4·7H2O 0.0014 g / L, MnSO4·H2O 0.0016 g / L, CoCl2·6H2O 0.0037 g / L), pH was adjusted to 5.4 with 6M NaOH solution, and 1 mM MnSO4 was additionally added to a final concentration of pH 4.8.

[0028] Example 1: Preparation of recombinant Trichoderma reesei Tr_LAC / MnP The LAC gene used in the present invention comes from Pleurotus ostreatus (GenBank: AQX45445.1), MnP gene from Phanerodontia chrysosporium (GenBank: AAA33743.1). This patent selects plasmid pCAMBIA1300 as the basic skeleton of the expression vector, and uses seamless cloning technology to insert the exogenous LAC gene between the Trichoderma reesei Pcbh1 promoter and the Tcbh1 terminator, and then connects the obtained expression cassette to the hygromycin B expression cassette (hph). Using the Trichoderma reesei RUT-C30 genomic DNA as a template, the primer pair SLP1-5′F / SLP1-5′R was used to amplify the upstream homologous sequence of the SLP1 gene with a theoretical size of about 1 kb, and the primer pair SLP1-3′F / SLP1-3′R was used to amplify the downstream homologous sequence of the SLP1 gene with a theoretical size of about 1 kb. The upstream and downstream homologous sequences were connected to the two ends of the PoLAC gene expression frame using a one-step cloning method, as shown below. Figure 1 The recombinant plasmid was introduced into Trichoderma reesei RUT-C30 using Agrobacterium-mediated technology, and the recombinant Trichoderma reesei Tr_LAC with the exogenous LAC gene integrated was obtained by screening with hygromycin B.

[0029] On this basis, the exogenous MnP gene was inserted between the Pcbh1 promoter and Tcbh1 terminator of Trichoderma reesei using seamless cloning technology. Using the genomic DNA of Trichoderma reesei RUT-C30 as a template, the primer pair URA5-5′F / URA5-5′R was used to amplify the upstream homologous sequence of the URA5 gene with a theoretical size of about 1.5 kb, and the primer pair URA5-3′F / URA5-3′R was used to amplify the downstream homologous sequence of the URA5 gene with a theoretical size of about 1.5 kb. The upstream and downstream homologous sequences were connected to the two ends of the PoLAC gene expression frame using a one-step cloning method, as shown in the following figure. Figure 1 The recombinant plasmid was introduced into the recombinant Trichoderma reesei Tr_LAC using Agrobacterium-mediated technology, and the recombinant Trichoderma reesei Tr_LAC / MnP with integrated LAC and MnP genes was obtained by 5-fluoroorotic acid screening.

[0030] The Pcbh1 promoter sequence is shown as SEQ ID NO 1: ACCTGTAAAGCCGCAATGCAGCATCACTGGAAAATACAAACCAATGGCTAAAAGTACATAAGTTAATGCCTAAAGAAGTCATATACCAGCGGCTAATAATTGTACAATCAAGTGGCTAAACGTACCGTAATTTGCCAACGGCTTGTGGGGTTGCAGAAGCAACGGCAAAGCCCCACTTCCCCACGTTTGTTTCTTCACTCAGTCCAATCTCAGCTGGTGATCCCCCAATTGGGTCGCTTGTTTGTTCCGGTGAAGTGAAAGAAGACAGAGGTAAGAATGTCTGACTCGGAGCGTTTTGCATACAACCAAGGGCAGTGATGGAAGACAGTGAAATGTTGACATTCAAGGAGTATTTAGCCAGGGATGCTTGAGTGTATCGTGTAAGGAGGTTTGTCTGCCGATACGACGAATACTGTATAGTCACTTCTGATGAAGTGGTCCATATTGAAATGTAAGTCGGCACTGAACAGGCAAAAGATTGAGTTGAAACTGCCTAAGATCTCGGGCCCTCGGGCCTTCGGCCTTTGGGTGTACATGTTTGTGCTCCGGGCAAATGCAAAGTGTGGTAGGATCGAACACACTGCTGCCTTTACCAAGCAGCTGAGGGTATGTGATAGGCAAATGTTCAGGGGCCACTGCATGGTTTCGAATAGAAAGAGAAGCTTAGCCAAGAACAATAGCCGATAAAGATAGCCTCATTAAACGGAATGAGCTAGTAGGCAAAGTCAGCGAATGTGTATATATAAAGGTTCGAGGTCCGTGCCTCCCTCATGCTCTCCCCATCTACTCATCAACTCAGATCCTCCAGGAGACTTGTACACCATCTTTTGAGGCACAGAAACCCAATAGTCAACCGCGGACTGCGCATC The Tcbh1 terminator sequence is shown as SEQ ID NO 2: AGCTCCGTGGCGAAAGCCTGACGCACCGGTAGATTCTTGGTGAGCCCGTATCATGACGGCGGCGGGAGCTACATGGCCCCGGGTGATTTATTTTTTTTGTATCTACTTCTGACCCTTTTCAAATATACGGTCAACTCATCTTTCACTGGAGATGCGGCCTGCTTGGTATTGCGATGTTGTCAGCTTGGCAAATTGTGGCTTTCGAAAACACAAAACGATTCCTTAGTAGCCATGCATTTTAAGATAACGGAATAGAAGAAAGAGGAAATTAAAAAAAAAAAAAAAACAAACATCCCGTTCATAACCCGTAGAATCGCCGCTCTTCGTGTATCCCAGTACCACGGCAAAGGTATTTCATGATCGTTCAATGTTGATATTGTTCCCGCCAGTATGGCTCCACCCCCATCTCCGCGAATCTCCTCTTCTCGAACGCGGTAGTGGCGCGCCAATTGGTAATGACCCATAGGGAGACAAACAGCATAATAGCAACAGTGGAAATTAGTGGCGCAATAATTGAGAACACAGTGAGACCATAGCTGGCGGCCTGGAAAGCACTGTTGGAGACCAACTTGTCCGTTGCGAGGCCAACTTGCATTGCTGTCAAGACGATGACAACGTAGCCGAGGACCGTCACAAGGGACGCAAAGTTGTCGCGGATGAGGTCTCCGTAGATGGCATAGCCGGCAATCCGAGAGTAGCCTCTCAACAGGTGGCCTTTTCGAAACCGGTAAACCTTGTTCAGACGTCCTAGCCGCAGCTCACCGTACCAGTATCGAGGATTGACGGCAGAATAGCAGTGG SLP1-5′F:CTATGACATGATTACGAATTCAATGCTGTGCACTTGTCTCGTG SLP1-5′R:ACCGTTATCTCGTGCTGCTCACACTCTAT SLP1-3′F:CCTAGGCGCAGCTCGACTAGTAGATGTAAGAGGGTTTCTTGAGGG SLP1-3′R:TGTCAAACACTGATAGTTTAAACGACGGCACCTGGTTGGATC URA5-5′F: CTATGACATGATTACGAATTCAGCCGGCACGGATCTGAG URA5-5′R: TGCGGCTTTACAGGTACGCGTTTCTGTTGGATTTGGATAGTGTCCTT URA5-3′F: CTAGGCGCAGCTCGACTAGTTTGAGGCGTTCAATGTCAGAAG URA5-3′R: GTCAAACACTGATAGTTTAAACCTTTGACGTCCACACCTTGCT.

[0031] Example 2: Preparation of recombinant LAC / MnP complex enzyme solution The recombinant Trichoderma reesei Tr_LAC / MnP test tube slopes were transferred into the seed culture medium in the shake flask, and cultured in a shaker at 30-32°C, 180rpm, for 40-60h. According to the inoculation amount of 5% (V / V), the liquid strain was inoculated into the fermentation medium, and the dual enzyme activity in the fermentation supernatant was tested every 24h at 28-32°C, 180rpm. The recombinant LAC / MnP complex enzyme liquid was obtained after a total of 168h of shaking culture. Figure 2 As shown, the recombinant MnP enzyme activity reached a maximum value of 2052.2 U / L at 144 h of shake flask fermentation, and the recombinant LAC enzyme activity reached a maximum value of 10.6 IU / mL at 96 h.

[0032] LAC enzyme activity assay method: Crude enzyme solution was prepared according to the above method. Laccase activity was assayed using the ABTS method (Bourbonnais R, Paice MG, Freiermuth B, et al. Reactivities of various mediators and laccases with kraft pulp and lignin model compounds [J]. Appliedandenvironmental microbiology, 1997, 63(12): 4627-4632), with 2,2-azino-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt (ABTS) as substrate. Take 50 μl of enzyme solution, add 950 μl of citric acid buffer solution (pH 4.0), then add 1 ml of ABTS solution (2 mM), react at 30 ºC for 2 min, and measure the change in absorbance at 420 nm over time. One international unit (IU) of laccase activity is defined as the amount of enzyme that consumes 1 μmol of ABTS per minute (ε=36000 L / mol·cm -1 ).

[0033] MnP enzyme activity determination method: using MnSO4 as substrate, aspirate 200 μL of diluted enzyme solution and add it to a quartz cuvette containing 1780 μL of 50 mM sodium malonate buffer (pH 4.5), place 20 μL of substrate MnSO4 (final concentration 1 mM) in a 1.5 mL centrifuge tube, place the cuvette and centrifuge tube in a 25 °C water bath for 5 min, then add the substrate to the reaction system, add 10 μL of H2O2 (final concentration 0.05 mM), mix quickly and thoroughly, and use a UV-visible spectrophotometer to measure the Mn at 270 nm within 4 min. 3+ -malonate complex formation. One unit of manganese peroxidase activity (U) is defined as the oxidation of 1 μmol Mn per minute. 2+ The amount of enzyme required.

[0034] Example 3: Degradation of the dye malachite green by recombinant LAC / MnP complex enzyme solution A 6 mL dye decolorization system was used, containing recombinant LAC / MnP complex enzyme (control MnP final enzyme activity of 0.02U / mL), MnSO4 (final concentration 1 mM), H2O2 (final concentration 0.1 mM), malachite green (final concentration 100 mg / L), 50mM sodium malonate buffer, pH 5.5. Decolorization was carried out in a 25 mL conical flask, and the test tube was placed in a 40°C water bath shaker for 4 hours. Samples were taken every 1 hour to detect the degradation of malachite green. The results are shown in Figure 3As shown, under the action of recombinant LAC / MnP complex enzyme solution, malachite green can quickly start the decolorization process, and the decolorization rate reaches 88.64% in 4 hours.

[0035] Malachite green content determination method: For the malachite green decolorized sample, first centrifuge the reaction solution at 12,000 rpm for 10 minutes to remove the precipitate, take the supernatant and filter it through a 0.45 μm water filter membrane, and dilute it to an appropriate concentration with 50 mM sodium malonate buffer. Use the blank reaction system without enzyme solution as the background control, and measure the absorbance value at the maximum absorption wavelength of 617 nm.

[0036] The remaining dye concentration in the sample was calculated using a pre-established malachite green standard curve (concentration range 5-100 mg / L). Where C0 is the concentration of malachite green before the degradation reaction, and C is the concentration of malachite green after the degradation reaction.

[0037] Example 4: Degradation of the dye Reactive Brilliant Blue by recombinant LAC / MnP complex enzyme solution A 6 mL dye decolorization system was used, containing recombinant LAC / MnP complex enzyme (control MnP final enzyme activity of 0.04U / mL), MnSO4 (final concentration 1 mM), H2O2 (final concentration 0.1 mM), reactive brilliant blue final concentration of 100 mg / L, 50mM sodium malonate buffer, pH 5.0. Decolorization was carried out in a 25 mL conical flask, and the test tube was placed in a 40℃ water bath shaker for 4 hours. Samples were taken every 1 hour to detect the degradation of reactive brilliant blue. The results are shown in Figure 4 As shown, under the action of recombinant LAC / MnP complex enzyme solution, the decolorization rate of active brilliant blue exceeded 80% in 3 hours and reached 92.50% in 4 hours.

[0038] Reactive brilliant blue content determination method: For the reactive brilliant blue decolorization sample, first centrifuge the reaction solution at 12,000 rpm for 10 minutes to remove the precipitate, take the supernatant and filter it through a 0.45 μm water filter membrane, and dilute it to an appropriate concentration with 50 mM sodium malonate buffer. Use the blank reaction system without enzyme solution as the background control, and measure the absorbance value at the maximum absorption wavelength of 591 nm. Calculate the remaining dye concentration in the sample using the pre-established malachite green standard curve (concentration range 5-100 mg / L). , where C0 is the concentration of reactive brilliant blue before the degradation reaction, and C is the concentration of reactive brilliant blue after the degradation reaction.

[0039] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by a person of ordinary skill in the art without departing from the spirit and technical concept disclosed by the present invention shall still be covered by the claims of the present invention.

Claims

1. A method for constructing a recombinant Trichoderma reesei strain, characterized in that: The laccase gene LAC and the manganese peroxidase MnP gene were directionally integrated into the extracellular protease gene SLP1 site and the uracil biosynthesis gene URA5 site on the Trichoderma reesei genome, respectively, to construct a recombinant Trichoderma reesei strain with LAC / MnP co-expression.

2. The construction method according to claim 1, characterized in that: Agrobacterium-mediated homologous recombination technology is used to directionally integrate the laccase gene LAC and the manganese peroxidase MnP gene into the extracellular protease gene SLP1 site and the uracil synthesis gene URA5 site on the Trichoderma reesei genome respectively; a strong promoter Pcbh1 and a terminator Tcbh1 are used to regulate the expression of the exogenous genes, and a recombinant Trichoderma reesei strain is obtained through double screening with hygromycin B and 5-fluoroorotic acid; the sequence of the strong promoter Pcbh1 is shown in SEQ ID NO 1, and the sequence of the terminator Tcbh1 is shown in SEQ ID NO 2.

3. A recombinant Trichoderma reesei strain obtained by the construction method according to claim 1 or 2.

4. The recombinant Trichoderma reesei strain according to claim 3, characterized in that: In the fermentation product obtained by fermenting the recombinant Trichoderma reesei strain at 28-32° C. and 180 rpm for 168 hours, the laccase activity reached a peak value of 10.6 IU / mL at 96 hours, and the manganese peroxidase activity reached a peak value of 2052.2 U / L at 144 hours.

5. Use of the recombinant Trichoderma reesei strain as claimed in claim 3 or 4 for decolorizing dyes.

6. The use according to claim 5, characterized in that: The fermentation product obtained by the recombinant Trichoderma reesei strain under the conditions of 40° C. and pH 5.0-5.5 has a 4-hour decolorization rate of 88.64% for malachite green and a 4-hour decolorization rate of 92.50% for reactive brilliant blue.

7. A decolorizing composite bio-enzyme solution, characterized in that: The product is obtained by fermenting the recombinant Trichoderma reesei strain according to claim 3.

8. The decolorizing composite bio-enzyme solution according to claim 7, characterized in that: The fermentation temperature is 28~32℃, the rotation speed is 180 rpm, and the fermentation time is 168 hours.

9. Use of the decolorizing composite bio-enzyme solution according to any one of claims 7 or 8 for decolorizing dyes.

10. The use according to claim 9, characterized in that: The decolorization composite biological enzyme solution has a decolorization rate of 88.64% for malachite green within 4 hours and a decolorization rate of 92.50% for reactive brilliant blue within 4 hours.

Images