Double-base pichia pastoris base editor and application

Abstract

The invention provides a double-base pichia pastoris base editor aiming at pichia pastoris, the double-base pichia pastoris base editor is a DNA molecular composition, the DNA molecular composition comprises a first expression plasmid containing a coding gene of nCas9 protein, a coding gene of pyrimidine deaminase and a coding gene of adenosine deaminase, and a second expression plasmid containing a coding gene of nCas9 protein, a coding gene of pyrimidine deaminase and a coding gene of adenosine deaminase, and a second expression plasmid containing gRNA, wherein the gRNA is a spacer sequence of a targeted target gene, and the length of the spacer sequence is 20 nt. The double-base editor can edit the base A and the base C at the same time, and an efficient and accurate tool basis is provided for the research fields of pichia pastoris-based recombinant protein evolution or chassis cell transformation and the like.

Description

Technical Field

[0001] The present invention discloses a base editor, and specifically relates to a DNA molecule composition with base editing function, belonging to the field of nucleic acid technology. Background Art

[0002] Pichia pastoris ( pichia pastoris ) is an excellent and regulatable host for heterologous protein expression. It can be fermented at high density and is mainly used for the production of biopharmaceuticals and industrial enzymes. However, there is a lack of gene editing tools for Pichia pastoris. The advent of CRISPR / Cas9 (CRISPR: clustered regularly interspaced short palindromic repeats; Cas9: CRISPR-associated protein 9) gene editing technology has promoted major progress in gene therapy, protein modification, gene function exploration and other fields. However, the mutations caused by CRISPR / Cas9 are usually insertions or deletions, which often lead to amino acid frameshift mutations and thus protein loss of function. This not only cannot solve problems such as genetic diseases caused by single-nucleotide variants (SNVs), but also cannot achieve protein engineering of new functional mutants by changing nucleotides.

[0003] In recent years, single-base editing tools developed based on CRISPR / Cas9 technology can edit specific bases in the genome and are considered to be effective tools for generating SNVs-related saturated mutation populations. The two early single-base editors are cytosine base editor (CBE) and adenine base editor (ABE), each of which performs a type of base editing, namely the conversion of base C to T or base A to G. Since the existing CBE and ABE editors can only perform one base editing function, there are certain limitations in their application. When there are multiple base editing requirements, the use of two editors at the same time is not only cumbersome, but there may also be competition or interference between them, affecting the editing efficiency.

[0004] The purpose of the present invention is to provide a base editor that can simultaneously edit pyrimidine and purine bases in Pichia pastoris, laying a tool foundation for the transformation of Pichia pastoris' own genome, the evolution of exogenous proteins expressed on the Pichia pastoris platform, and the screening and development of drugs for Pichia pastoris. Summary of the invention

[0005] Based on the above invention objectives, the present invention first provides a two-base Pichia base editor, which is a DNA molecular composition, comprising a plasmid expressing a CRISPR-associated protein nCas9, a pyrimidine deaminase, an adenosine deaminase, and a gRNA, and the DNA molecular composition constitutes a two-base editor for pyrimidine bases and purine bases, and the DNA molecular composition expresses the corresponding CRISPR-associated proteins, pyrimidine deaminase and adenosine deaminase proteins in host cells. When the base editor is used, the above proteins form a complex with the gRNA, and the complex targets a specific site of the genome under the guidance of the gRNA, deaminates the cytosine (cytosine, C) of the target sequence to form uracil (uracil, U), and then forms thymine (thymine, T) through an intracellular DNA repair mechanism, and the complex can also deaminate the adenine (adenine, A) of the target sequence to form guanine (guanine, G), and finally achieves the simultaneous conversion from C to T and A to G.

[0006] The sequence of the pyrimidine deaminase of the present invention is shown in SEQ ID NO.1, the amino acid sequence of adenosine deaminase is shown in SEQ ID NO.3, the CRISPR-associated protein is nCas9 with an amino acid sequence as shown in SEQ ID NO.5, which has a point mutation of D10A compared to the wild type, and the gRNA is an RNA molecule with a spacer sequence length of 20 nt targeting the target gene. In a specific embodiment of the present invention, the gRNA is from the genome of Pichia pastoris. XM_ 002489805.1 The gene was constructed by selecting a sequence rich in base A (20 nt).

[0007] Based on the working environment of the dual base editor of the present invention in yeast cells, without changing the amino acid sequence, the present invention optimizes the coding genes of the above-mentioned nCas9 protein, pyrimidine deaminase and adenosine deaminase. In a preferred embodiment, the sequence of the coding gene of pyrimidine deaminase in the first expression plasmid is shown as SEQ ID NO.2, the sequence of the coding gene of adenosine deaminase is shown as SEQ ID NO.4, and the sequence of the coding gene of nCas9 protein is shown as SEQ ID NO.6.

[0008] In a preferred embodiment, the coding gene of the pyrimidine deaminase, the coding gene of the adenosine deaminase and the coding gene of the nCas9 protein are fused and cloned in a first expression plasmid, the first expression plasmid expresses a fusion protein of CRISPR-associated protein, pyrimidine deaminase and adenosine deaminase, and the gRNA is cloned in a second expression plasmid. In a specific embodiment of the present invention, the first expression plasmid is pGAP. The second expression plasmid is pTEF.

[0009] In a preferred embodiment, the pyrimidine deaminase encoding gene and the adenosine deaminase encoding gene are fused to the two ends of the nCas9 protein encoding gene, that is, the pyrimidine deaminase encoding gene is located at the 5′ end of the nCas9 protein encoding gene and the adenosine deaminase encoding gene is located at the 3′ end of the nCas9 protein encoding gene; or, the adenosine deaminase encoding gene is located at the 5′ end of the nCas9 protein encoding gene and the pyrimidine deaminase encoding gene is located at the 3′ end of the nCas9 protein encoding gene.

[0010] In a specific embodiment of the present invention, the gene encoding adenosine deaminase is located at the 5′ end of the gene encoding nCas9 protein and is directly connected to the gene encoding nCas9 protein, and the 3′ end of the gene encoding nCas9 protein is connected to the gene encoding pyrimidine deaminase in the form of (GGGGS) 10 The coding gene of the adenosine deaminase is connected to the coding gene of the connecting peptide, wherein the 5′ end of the coding gene of the adenosine deaminase is provided with a nuclear localization signal peptide coding gene with a sequence as shown in SEQ ID NO.5, and the coding gene of the nCas9 protein is connected to the (GGGGS) 10 A nuclear localization signal peptide encoding gene having a sequence as shown in SEQ ID NO. 8 is arranged between the encoding genes of the connecting peptide. In the present invention, the technical solution is named "pACBE", and its polynucleotide sequence is shown in SEQ ID NO.9.

[0011] In a specific embodiment of the present invention, the pyrimidine deaminase encoding gene is located at the 5′ end of the nCas9 protein encoding gene and is ligated to the nCas9 protein with the sequence (GGGGS). 10 The 3′ end of the gene encoding the nCas9 protein is connected to the gene encoding the adenosine deaminase with the sequence (GGGGS) 10 The coding gene of the connecting peptide is connected, wherein the 3′ end of the coding gene of the nCas9 protein is connected to the (GGGGS) 10A nuclear localization signal peptide encoding gene with a sequence as shown in SEQ ID NO. 8 is arranged between the encoding genes of the connecting peptide. In the present invention, the technical solution is named "pCABE", and its polynucleotide sequence is shown in SEQ ID NO.10.

[0012] In another preferred embodiment, the gRNA is an RNA molecule with a spacer sequence length of 20 nt targeting the target editing gene. In a specific embodiment of the present invention, the target gene is XM_ 002489805.1 Gene, the DNA targeting sequence corresponding to the gRNA molecule is shown in SEQ ID NO.7.

[0013] Secondly, the present invention provides a host cell transfected by the above DNA molecule composition.

[0014] In a preferred embodiment, the host cell is Pichia pastoris.

[0015] Finally, the present invention provides a method for DNA base editing using the above-mentioned DNA molecular composition, the method comprising the following steps: (1) A first expression plasmid containing a gene encoding pyrimidine deaminase, a gene encoding adenosine deaminase and a gene encoding nCas9 and a second expression plasmid containing a gRNA are transformed into a host cell containing a target editing gene, wherein the gRNA is an RNA molecule with a spacer sequence length of 20 nt that targets the target gene.

[0016] (2) Screening positive clones in which the target gene has been specifically mutated.

[0017] In a specific embodiment of the present invention, the target gene is XM_ 002489805.1 Gene, the DNA targeting sequence corresponding to the gRNA molecule is shown in SEQ ID NO.7.

[0018] In a preferred embodiment, the gene encoding adenosine deaminase in the first expression plasmid is located at the 5′ end of the gene encoding nCas9 protein and is directly linked to the gene encoding nCas9 protein, and the 3′ end of the gene encoding nCas9 protein is linked to the gene encoding pyrimidine deaminase in the form of (GGGGS) 10 The coding gene of the adenosine deaminase is connected to the coding gene of the connecting peptide, wherein the 5′ end of the coding gene of the adenosine deaminase is provided with a nuclear localization signal peptide coding gene with a sequence as shown in SEQ ID NO.8, and the coding gene of the nCas9 protein is connected to the (GGGGS) 10A nuclear localization signal peptide encoding gene with a sequence as shown in SEQ ID NO.8 is arranged between the encoding genes of the connecting peptide, or The pyrimidine deaminase encoding gene in the first expression plasmid is located at the 5′ end of the nCas9 protein encoding gene and is ligated to the nCas9 protein with (GGGGS) 10 The 3′ end of the gene encoding the nCas9 protein is connected to the gene encoding the adenosine deaminase with the sequence (GGGGS) 10 The coding gene of the connecting peptide is connected, wherein the 3′ end of the coding gene of the nCas9 protein is connected to the (GGGGS) 10 A nuclear localization signal peptide encoding gene with a sequence as shown in SEQ ID NO.8 is arranged between the encoding genes of the connecting peptide.

[0019] Based on CRISPR / Cas9 technology, the present invention constructs two Pichia pastoris dual base editors (CABE / ACBE) by designing the relative position changes of the variant Cas9 (D10A) of the CRISPR-associated protein Cas9 and the cytidine deaminase PmCDA1 and adenosine deaminase ABE8e, and evaluates the base editing function of the dual base editors by using the target gRNA-AC rich in base A. In order to promote the base editing efficiency in yeast cells, the coding genes of cytidine deaminase PmCDA1, adenosine deaminase ABE8e and nCas9 in the dual base editors are artificially optimized, and the connection mode of cytidine deaminase PmCDA1, adenosine deaminase ABE8e, connecting peptide and nuclear localization signal sequence of the dual base editor is optimized and designed. The evaluation results show that ACBE and CABE can achieve a strain editing efficiency of up to 90%. Among them, the editing efficiency of base C in ACBE is higher than 30%, the editing efficiency of base A is higher than 80%, and the editing efficiency of base C and base A in CABE is about 50%. The present invention successfully constructed an efficient dual-base editor in Pichia pastoris, providing a tool for genetic engineering operations of Pichia pastoris. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 . The effect of linker length on base editors; Figure 2 . Schematic diagram of the pACBE and pCABE recombinant vector structures; Figure 3 . Identification of pACBE positive clones by colony PCR and agarose gel electrophoresis; Figure 4 . Identification of pCABE positive clones by colony PCR and agarose gel electrophoresis; Figure 5. After pACBE and pCABE were integrated into GS115, positive strains were identified by colony PCR and agarose gel electrophoresis; Figure 6 . The effect of the length of the spacer sequence of the gRNA targeting the target gene on the base editor; Figure 7 . Schematic diagram of the pTEF-AC vector structure; Figure 8 . After transformation with pTEF-AC recombinant vector, positive clones were identified by colony PCR and agarose gel electrophoresis; Fig. 9 . Sanger sequencing comparison results of pTEF-AC recombinant vector; Fig.10 . Sanger sequencing results of the target sequence after pTEF-AC was transferred into ACBE and CABE. DETAILED DESCRIPTION

[0021] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0022] Experimental materials used in this invention Pichia pastoris GS115 was preserved by our laboratory; Escherichia coli TOP 10 was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. YPD (1% yeast powder, 2% peptone, 2% glucose) medium was used for routine culture of yeast cells, YPDS (1% yeast powder, 2% peptone, 2% glucose, 1M sorbitol) medium and MD (2% glucose, 1.34% yeast nitrogen base (YNB)) medium were used for screening of yeast mutant strains. LB (0.5% yeast powder, 1% peptone, 1% sodium chloride) medium and LLB (0.5% yeast powder, 1% peptone, 0.5% sodium chloride) medium were used for the culture of Escherichia coli. Solid culture medium needs to be supplemented with 20 g / L agar powder as a screening marker, the concentration of ampicillin (A+) is 100 mg / L, and the concentration of zeocin (Z+) is 100 mg / L.

[0023] Restriction enzymes, ligases, and dephosphorylases were purchased from NEB; KOD FX Neo was purchased from TOYOBO; homologous recombination kits were purchased from Nanjing Novozyme Biotechnology Co., Ltd.; plasmid extraction kits were purchased from QIAGEN; nucleic acid gel recovery kits were purchased from Omega Bio-Tek; peptone and yeast powder were purchased from OXOID; agar powder was purchased from Beijing Solebow Co., Ltd.; agarose and sorbitol were purchased from SIGMA; ampicillin was purchased from SAITONC; bleomycin was purchased from Invitrogen; other chemical reagents were purchased from Sinopharm Chemical Reagent Co., Ltd. Electroporator (GenePulser Xcell) and PCR instrument (C1000 Touch) were purchased from Bio-Rad. Unless otherwise specified, gene sequence synthesis and sequencing were completed by Suzhou Jinweizhi Biotechnology Co., Ltd.

[0024] Example 1. Design and construction of the first expression plasmid 1. Design of the length of the linker peptide in the first expression plasmid We explored the length of the linker between pyrimidine deaminase PmCDA1 and nCas9 to obtain a flexible linker that can ensure protein functional independence in Pichia pastoris. GGGGS is an empirical linker system in this field. We used this system to construct four N-CBEs with different linker lengths ( Figure 1 ), respectively (GGGGS)2, (GGGGS)5, (GGGGS)8, (GGGGS) 10 The functional evaluation results showed that, except for (GGGGS)2, (GGGGS)5, (GGGGS)8, (GGGGS) 10 All of them showed base editing activity, indicating that the length of the connecting peptide between PmCDA1 and nCas9 has a great influence on the editor function. In addition, the editing efficiency of CBEs increases with the increase of the length of the connecting peptide (GGGGS)n (n=2, 5, 8, 10). This phenomenon shows that a longer connecting peptide is important to ensure the independence of the functions of PmCDA1 and nCas9. Therefore, (GGGGS) is preferred. 10 It is the connecting peptide of the Pichia pastoris dual base editor.

[0025] 2. Construction of the first expression plasmid (1) The first expression plasmid pGAP-ABE8e-nCas9-(GGGGS) 10 - Construction of PmCDA1 PmCDA1 is a cytidine deaminase from lamprey (GenBank: ABO15149.1), and its amino acid sequence is shown in SEQ ID NO.1. Based on the amino acid sequence, the present invention optimizes its coding sequence, which is conducive to its full biological activity in the yeast system. The optimized polynucleotide sequence is shown in SEQ ID NO.2. ABE8e is an artificially modified adenosine deaminase, and its amino acid sequence is shown in SEQ ID NO.3. Similarly, based on the amino acid sequence, the present invention optimizes its coding sequence, and the optimized polynucleotide sequence is shown in SEQ ID NO.4. (GGGGS) 10 The nCas9 coding sequence, the PmCDA1 coding sequence and the ABE8e coding sequence are connected by the flexible connecting peptide that can ensure the independence of the functional proteins of the two obtained in Example 1. nCas9 is a variant of Cas9, in which the aspartic acid at position 10 is mutated to alanine, the amino acid sequence is shown in SEQ ID NO.5, and the codon-optimized polynucleotide sequence is shown in SEQ ID NO.6.

[0026] We designed to connect ABE8e to the N-terminus of nCas9 and PmCDA1 to the C-terminus of nCas9, pGAP-ABE8e-nCas9-(GGGGS) 10 -PmCDA1, the structural diagram of which is shown in Figure 2 The synthesized plasmid was verified by PCR, and its agarose gel electrophoresis was as shown in Figure 3 As shown, the results showed that the ABE8e fragment was successfully inserted into the N-terminus of nCas9. pGAP-ABE8e-nCas9-(GGGGS) 10 -PmCDA1, referred to as pACBE recombinant vector, has a polynucleotide sequence as shown in SEQ ID NO.9. In pACBE, ABE8e and nCas9 are directly connected without adding a connecting peptide in the middle. 10 The N-terminus of the proteins was integrated with the nuclear localization signal sequence NLS (SEQ ID NO.8, PKKKRKV).

[0027] (2) The first expression plasmid pGAP-PmCDA1-(GGGGS) 10 -nCas9-(GGGGS) 10 - Construction of ABE8e Similarly, in order to reduce the impact of the spatial structure of ABE8e and PmCDA1, we designed to fuse PmCDA1 to the N-terminus of nCas9 and ABE8e to the C-terminus of nCas9. And compared with the construction in (1), we observed the effect of fusing different deaminases at both ends of nCas9 on base editing. pGAP-PmCDA1-(GGGGS) 10 -nCas9-(GGGGS) 10 -After the ABE8e plasmid was designed, it was directly handed over to the company for synthesis and its structural diagram was obtained as shown below Figure 2 The synthesized plasmid was verified by PCR, and its agarose gel electrophoresis was as shown in Figure 4 As shown, the target size band (1720 bp) was successfully amplified, proving that pGAP-PmCDA1-(GGGGS) 10 -nCas9-(GGGGS) 10 -ABE8e was successfully cloned and referred to as pCABE recombinant vector, and its polynucleotide sequence is shown in SEQ ID NO.10. When PmCDA1 and ABE8e were connected to nCas9 in pCABE, a connecting peptide (GGGGS) was added in the middle 10 . In (GGGGS) 10 The nuclear localization signal sequence NLS (SEQ ID NO.8, PKKKRKV) was incorporated into the N-terminus.

[0028] Example 2. Construction of dual base editor recombinant strains ACBE / GS115 and CABE / GS115 The first expression plasmid pGAP-ABE8e-nCas9-(GGGGS) constructed in Example 1 10 -PmCDA1 and pGAP-PmCDA1-(GGGGS) 10 -nCas9-(GGGGS) 10 -ABE8e were firstly cleaved by restriction endonuclease Nhe Ⅰ was digested with a single enzyme and purified and recovered. Then it was integrated into the genome of Pichia pastoris GS115 by electroporation transformation, and yeast colony PCR was performed using primers GAP-F / CYC-R (CGTCGCTGGCAATAATAGCG / CCTTCCTTTTCGGTTAGAGC) to identify positive clones. Figure 5 Agarose gel electrophoresis results showed that positive clones were initially identified, and subsequent Sanger sequencing (results not shown) indicated that the recombinant vector was successfully integrated to obtain ACBE / GS115 and CABE / GS115 recombinant strains.

[0029] In the present invention, pGAP-ABE8e-nCas9-(GGGGS)10 The recombinant strain constructed by -PmCDA1 recombinant vector was named ACBE / GS115, and pGAP-PmCDA1-(GGGGS) 10 -nCas9-(GGGGS) 10 The recombinant strain constructed with the -ABE8e recombinant vector was named CABE / GS115.

[0030] Example 3. Design and construction of the second expression plasmid pTEF-AC 1. Optimization of gRNA spacer length We selected N-CBE to evaluate the optimal length of the gRNA spacer sequence. XM_002490399.1 267-294 A C-rich sequence (AGCTTCCTCTCTCTCTCCCGCCACCTTC) was introduced into the universal vector, targeting the same site of the genome but with spacer sequences of 14 to 28 nt, as shown in Table 1. These 15 gRNA recombinant expression plasmids were electroporated into N-CBE respectively, and the Sanger sequencing results showed that when the length of the gRNA targeting sequence was equal to or less than 16 nt, N-CBE lost its editing activity; in the range of 17 nt to 28 nt, N-CBE had editing activity, and the editing efficiency at C18 was the highest. When the length of the gRNA targeting sequence was 20 nt, the average editing efficiency of N-CBE was the highest. Therefore, we set 20 nt as the optimal length of the targeting spacer sequence in the gRNA vector (see Figure 6 ).

[0031] Table 1 gRNAs with different targeting sequence lengths

[0032] 2. Construction of recombinant gRNA (pTEF-AC) vector The pTEF vector is used as the expression vector of gRNA, which contains the replicon of Escherichia coli, the bleomycin resistance gene and the gRNA expression cassette. The gRNA expression cassette is transcribed by the TEF promoter and is expressed in Afl Ⅱ Restriction enzyme site The target sequence (20nt) is added to the 5′ end of the gRNA scaffold (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC). The specific construction process is as follows: A 20 nt spacer rich in base A was selected in the Pichia pastoris genome ( XM_002489805.1 2745-2746 :ACACAACACACACACATTAG) to construct gRNA to evaluate the functions of ACBE and CABE dual base editors. The schematic diagram of its structure is shown in Figure 7 First, according to the target sequence, primers AC-F / AC-R (AGGACGAAACGAGTAAGCTCGTCTCAGATCACACAACACACACACATTAG / ATTTTAACTTGCTATTTCTAGCTCTAAAACCTAATGTGTGTGTGTTGTGT) with homology arms at both ends of the pTEF vector and the target sequence were synthesized, and the target fragment was amplified by primer overlap extension PCR. The pTEF vector was cleaved by restriction endonuclease Afl Ⅱ was linearized and purified, and then the target sequence was connected to the linearized pTEF vector by seamless cloning and transformed into E. coli. Positive clones were identified by colony PCR using primers 3-F / 3AOX (CTAATCTAAGGGGCGATCTG / GCAAATGGCATTCTGACATCC). Figure 8 The 260 bp fragment amplified by agarose gel electrophoresis indicated that a positive clone was preliminarily identified, and the positive clone was subsequently sent for sequencing. Fig. 9 The Sanger sequencing results showed that the second expression plasmid was successfully constructed, that is, the recombinant gRNA vector pTEF-AC, named gRNA-AC.

[0033] Example 4. Construction of the ACBE and CABE evaluation systems for dual-base editors gRNA-AC was transferred into ACBE / GS115 and CABE / GS115 competent cells by electroporation, and positive clones were screened on YPDS Z+ solid plates. Then 10 single clones were picked and the AC fragment containing the target sequence was amplified by primers AC-F2 / AC-R2 (AAGTCTTTGTTTCAGGTCGTC / CGGTGCTGAATAAGTCCCAA) and sent to Sanger sequencing to verify whether there was editing of bases A and C in the target. Through statistical analysis of the sequencing results, ACBE and CABE can edit A and C at the same time, and the editing efficiency is above 80%. Fig.10As shown in the figure, in the application of editing specific bases, the two base editors show different editing characteristics. When the editing efficiency of ACBE for base A is higher than 80%, the editing efficiency of base C is only less than 30%, indicating that ACBE is more suitable for editing base A. Among them, ACBE has the highest editing efficiency for A5, which is more than 90%, and the editing efficiency for A6 is also around 75%. In addition, ACBE's editing efficiency for adjacent A3 and A8 is significantly reduced, indicating that ACBE is suitable for efficient editing of the base positions of A5 and A6, and reduces the editing probability of adjacent base positions to a minimum (less than 35%), and is more suitable for site-specific modification of target genes and promoting gene expression and other technical means.

[0034] The editing efficiency of CABE for base C and base A is relatively close, at about 50%. Among them, CABE's editing efficiency for C4 is about 50%, and it also shows a high editing efficiency for A10 and A14 (between 40% and 50%), which is not available in ACBE, suggesting that CABE is more suitable for large-scale gene editing of target genes and technical means of silencing gene expression.

[0035] The different dual-base editing characteristics of the two editors show that the number and location of the linker peptides and the number and location of the nuclear localization signal sequence have an impact on base editing. For example, in ACBE, at the N-terminus of ABE8e and (GGGGS) 10 The N-terminus of ABE8e and -nCas9- is integrated with a nuclear localization signal sequence, and no connecting peptide is set between ABE8e and -nCas9-. In CABE, only (GGGGS) 10 The N-terminus of PmCDA1 and ABE8e is integrated with a nuclear localization signal sequence, but a connecting peptide is added in the middle when PmCDA1 and ABE8e are connected to nCas9. Different double-base structure designs can be selected according to different application requirements, which provides an efficient and accurate tool foundation for yeast genetic engineering operations.

Claims

1. A two-base Pichia pastoris base editor, characterized in that: The two-base Pichia base editor is A DNA molecule composition, comprising a first expression plasmid containing a gene encoding an nCas9 protein, a gene encoding a pyrimidine deaminase and a gene encoding an adenosine deaminase, and a second expression plasmid containing a gRNA, wherein the sequence of the gene encoding the pyrimidine deaminase in the first expression plasmid is shown as SEQ ID NO.2, the sequence of the gene encoding the adenosine deaminase is shown as SEQ ID NO.4, the sequence of the gene encoding the nCas9 protein is shown as SEQ ID NO.6, and the gRNA is a spacer sequence with a length of 20 nt that targets the target gene.

2. The two-base Pichia base editor according to claim 1, characterized in that The genes encoding pyrimidine deaminase and adenosine deaminase in the first expression plasmid are fused to the two ends of the gene encoding the nCas9 protein, respectively.

3. The two-base Pichia base editor according to claim 2, characterized in that The adenosine deaminase coding gene in the first expression plasmid is located at the 5′ end of the nCas9 protein coding gene and is directly connected to the nCas9 protein coding gene. The 3′ end of the nCas9 protein coding gene is connected to the pyrimidine deaminase coding gene in the form of (GGGGS) 10 The coding gene of the adenosine deaminase is connected to the coding gene of the connecting peptide, wherein the 5′ end of the coding gene of the adenosine deaminase is provided with a nuclear localization signal peptide coding gene with a sequence as shown in SEQ ID NO.8, and the coding gene of the nCas9 protein is connected to the (GGGGS) 10 A nuclear localization signal peptide encoding gene with a sequence as shown in SEQ ID NO.8 is arranged between the encoding genes of the connecting peptide.

4. The two-base Pichia base editor according to claim 3, characterized in that The polynucleotide sequence of the segment from the gene encoding adenosine deaminase to the gene encoding pyrimidine deaminase in the first expression plasmid is shown as SEQ ID NO.

9.

5. The two-base Pichia base editor according to claim 2, characterized in that The pyrimidine deaminase encoding gene in the first expression plasmid is located at the 5′ end of the nCas9 protein encoding gene and is ligated to the nCas9 protein with (GGGGS) 10 The 3′ end of the gene encoding the nCas9 protein is connected to the gene encoding the adenosine deaminase with the sequence (GGGGS) 10 The coding gene of the connecting peptide is connected, wherein the 3′ end of the coding gene of the nCas9 protein is connected to the (GGGGS) 10 A nuclear localization signal peptide encoding gene with a sequence as shown in SEQ ID NO.8 is arranged between the encoding genes of the connecting peptide.

6. The two-base Pichia base editor according to claim 5, characterized in that The polynucleotide sequence of the segment from the gene encoding pyrimidine deaminase to the gene encoding adenosine deaminase in the first expression plasmid is shown as SEQ ID NO.

10.

7. A Pichia pastoris host cell transfected with the two-base Pichia base editor of any one of claims 1-6.

8. A method for DNA base editing using the two-base Pichia base editor according to any one of claims 1 to 6, characterized in that: The method comprises the following steps: (1) A first expression plasmid containing a gene encoding pyrimidine deaminase, a gene encoding adenosine deaminase ABE8e, and a gene encoding nCas9 protein and a second expression plasmid containing gRNA are transformed into Pichia pastoris containing a target editing gene, wherein the gRNA is a 20 nt spacer sequence targeting the target gene; (2) Screening positive clones in which the target gene has been specifically mutated.

9. The method according to claim 8, characterized in that The adenosine deaminase coding gene in the first expression plasmid is located at the 5′ end of the nCas9 protein coding gene and is directly connected to the nCas9 coding gene. The 3′ end of the nCas9 protein coding gene is connected to the pyrimidine deaminase coding gene in the form of (GGGGS) 10 The coding gene of the adenosine deaminase is connected to the coding gene of the connecting peptide, wherein the 5′ end of the coding gene of the adenosine deaminase is provided with a nuclear localization signal peptide coding gene with a sequence as shown in SEQ ID NO.8, and the coding gene of the nCas9 protein is connected to the (GGGGS) 10 A nuclear localization signal peptide encoding gene with a sequence as shown in SEQ ID NO.8 is arranged between the encoding genes of the connecting peptide.

10. The method according to claim 8, characterized in that The pyrimidine deaminase encoding gene in the first expression plasmid is located at the 5′ end of the nCas9 protein encoding gene and is ligated to the nCas9 protein with (GGGGS) 10 The 3′ end of the gene encoding the nCas9 protein is connected to the gene encoding the adenosine deaminase with the sequence (GGGGS) 10 The coding gene of the connecting peptide is connected, wherein the 3′ end of the coding gene of the nCas9 protein is connected to the (GGGGS) 10 A nuclear localization signal peptide encoding gene with a sequence as shown in SEQ ID NO.8 is arranged between the encoding genes of the connecting peptide.

Images