Construction method and application of liver cancer mouse model
Through the method of conditional knockdown of SMC6 gene in hepatocytes, the SMC6flox/flox:Alb-cre+ mouse model was constructed, which solved the problems of low success rate and slow modeling speed of existing HBV-related mice. It achieved 100% liver cancer incidence and rapid pathological simulation, providing an ideal model for research and drug screening.
Patent Information
- Application Number
- CN202311454078.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-02
- Publication Date
- 2025-05-06
AI Technical Summary
The success rate of existing HBV-related mouse liver cancer models is low and the modeling speed is slow, making it difficult to effectively simulate the mechanism of liver cancer caused by HBV infection.
By conditional knockdown of SMC6 gene by hepatocytes, gRNA was designed using the CRISPR/Cas9 system and homologous recombination was carried out, SMC6flox/flox:Alb-cre+ mouse model was constructed to achieve specific knockdown of SMC6 gene and promote the occurrence of liver cancer.
The incidence of liver cancer of 100% was achieved, and the pathological status of liver cancer caused by HBV infection was quickly and efficiently simulated, providing an ideal animal model for studying the mechanism of cirrhosis and liver cancer and screening drugs.
Smart Images
Figure CN119932103A_ABST
Abstract
Description
Technical field:
[0001] The invention belongs to the field of bioengineering and relates to a mouse model, in particular to a construction method and application of a liver cancer mouse model. Background technology:
[0003] It is generally believed that the occurrence of tumors is a complex process, and changes in multiple factors, such as immune disorders and the accumulation of gene mutations, lead to the formation of tumors. High-risk factors for liver cancer include viruses, aflatoxin and alcohol. Diethylnitrosamine (DEN) can induce liver cancer in rats. Rats were given 0.2% diethylnitrosamine (DEN) by gavage, 10 mg / kg of body weight, 5 times a week. After 14 weeks, all experimental rats developed hepatocellular carcinoma. DEN was injected intraperitoneally, carbon tetrachloride (CCl4) was gavaged, and water containing 9% ethanol was given for drinking. After 20 weeks, the success rate of inducing cancer was 78.9%. Giving 0.05% DEN free drinking water for 12 weeks can also successfully induce cirrhosis and liver cancer in rats. This shows that DEN can induce liver cancer in rats.
[0004] However, epidemiological surveys have shown that chemical carcinogenesis is not the main cause of liver cancer in the population, and hepatitis B virus (HBV) infection is the most important factor causing liver cancer. After chronic HBV infection, patients will gradually develop from chronic hepatitis to cirrhosis and eventually liver cancer. The mechanism by which HBV causes liver cancer is still not completely clear. It is known that the X protein (HBx) encoded by the HBV gene is an important factor in the occurrence of liver cancer. 80% of HBx transgenic male mice can develop liver cancer in about 10 months. However, the success rate of this model is lower than that of the DEN model, and the modeling speed is slower.
[0005] SMC6 is a protein for structural maintenance of chromosomes 6. (NCBI reference sequence Gene ID: 67241 is the reference sequence).
[0006] HBx can regulate HBV viral transcription by degrading the SMC6 protein of host liver cells. SMC6 can form a complex with SMC5 and participate in a variety of cell division-related regulatory processes, including cell senescence, positive regulation of chromosome separation, and maintenance of telomeres through recombination. Summary of the invention:
[0007] In view of the above-mentioned technical problems in the prior art, the present invention provides a method for constructing a liver cancer mouse model and its use. The method for constructing a liver cancer mouse model and its use can solve the technical problems of low success rate and slow modeling speed of HBV-related mouse liver cancer models in the prior art.
[0008] The present invention provides a method for constructing a liver cancer mouse model, and the liver cancer mouse model is obtained by conditionally knocking out the SMC6 gene in liver cells.
[0009] Furthermore, the model mice are achieved by the following steps:
[0010] 1) Includes a preparation of SMC6 flox / flox The steps of transgenic mice are as follows: exons 4 to 10 of the SMC6 gene are selected as conditional gene knockout regions; a gRNA is designed at each end of exons 4 to 10 of the SMC6 gene based on the CRIPR / Cas9 system; the gRNA action site sequence of the SMC6 gene is as follows:
[0011] gRNA1: AGGCAGTGATAACACCGGAA (SEQ ID NO.5);
[0012] gRNA2: GTTACCGGTAATATGGCTGC (SEQ ID NO.6);
[0013] The SMC6 gene was modified with Flox in vitro to obtain the SMC6 gene recombinant fragment SMC6-eCKO1, which includes a 5' homology arm, Loxp, a flox region, Loxp, a 3'
[0014] Homology arms, forming donor vectors for homologous recombination;
[0015] Cas9 mRNA, gRNA and donor vector were microinjected into fertilized eggs of C57BL / 6 mice, and the surviving fertilized eggs were transplanted into pseudopregnant female mice to produce mice, namely F0 generation SMC6 flox / flox Transgenic mice;
[0016] 2) SMC6 flox / flox The transgenic mice were crossed with the Alb-cre transgenic mice to obtain F1 mice, which were self-fertilized and identified to have the genotype SMC6. flox / flox :Alb-cre + mice (hereinafter referred to as conditional knockout mice, or SMC6 Alb- / - mice).
[0017] The present invention also provides a liver cancer mouse model, wherein SMC6 flox / flox The transgenic mice were crossed with the Alb-cre transgenic mice to obtain F1 mice, which were self-fertilized and identified to have the genotype SMC6. flox / flox :Alb-cre + of mice.
[0018] The present invention also provides a use of a liver cancer mouse model, including for the study of the mechanism of liver cancer, for the study of the mechanism of cirrhosis, for screening and evaluating or treating drugs for liver cancer, and for screening and evaluating or treating drugs for cirrhosis.
[0019] The conditional knockout technology used in the present invention specifically knocks out the gene of HBx downstream target protein SMC6 in mouse hepatocytes, thereby establishing a mouse pathological model of primary liver cancer.
[0020] The present invention selects exons 4 to 10 of the SMC6 gene as conditional gene knockout regions. gRNA1 and gRNA2 are designed in the intron regions at both ends of the exon for CRISPR / Cas9 gene editing. After in vitro transcription, gRNA1 and gRNA2 are co-injected into fertilized egg cells with Cas9 mRNA and a plasmid containing loxP sites. Cas9 cuts the target fragment by recognizing the gRNA leading strand, and then loxP is inserted into the cutting sites at both ends of the exon region.
[0021] The injected fertilized oocytes were transplanted into C57BL / 6 female mice to obtain offspring mice. The offspring mice were sequenced and the mice with the loxP site successfully introduced were SMC6 flox / flox Mice (F0 generation). Commercially available mice with cre recombinase inserted downstream of the albumin (Alb) promoter were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. (Cat. No.: T003814).
[0022] The two mice were crossed for two generations to obtain SMC6 flox / flox :Alb-cre + Mouse. The Cre enzyme in the mouse catalyzes the recombination of two loxP sites, cutting out exons 4 to 10 of SMC6, thereby knocking out the SMC6 gene. Because the expression of Alb is hepatocyte-specific, the Cre enzyme downstream of its promoter is only expressed in hepatocytes, and SMC6 gene knockout also occurs only in hepatocytes.
[0023] This process of the present invention is different from HBx degradation of SMC6 protein. Instead, it completely deletes the expression of SMC6 at the gene level, so it can quickly and efficiently promote the occurrence of liver cancer. 100% liver cancer can be achieved in male mice aged 4 to 9 months. The conditional mice spontaneously develop the morphological and pathological characteristics of cirrhosis and liver cancer, and are ideal animal models for studying the mechanism of cirrhosis and liver cancer and screening candidate drugs for liver cancer.
[0024] Compared with the existing technology, the technical effect of the present invention is positive and obvious. The present invention obtains a rapid and 100% success rate primary liver cancer mouse model by specifically knocking out the SMC6 gene in mouse liver cells. The model simulates the process of HBx degradation of SMC6, stably and realistically reflects the pathological state of liver cancer caused by HBV infection, and can be used to screen candidate drugs for liver cancer. Description of the drawings:
[0025] Figure 1 For SMC6 flox / flox :Alb-cre + Schematic diagram of the conditional mouse construction process.
[0026] Figure 2 The map of plasmid pT3-EFIaH-PIK3CA H1047R.
[0027] Figure 3 This is the result of gene identification of conditional knockout mice (F2 generation).
[0028] Figure 4 Comparison of the appearance of the liver of conditional knockout mice at different time points.
[0029] Figure 5 The results of the detection of liver cancer marker AFP in the serum of conditional knockout mice.
[0030] Figure 6 HE staining of the liver of conditional knockout mice.
[0031] Figure 7 This is a Masson staining image of the liver of conditional knockout mice.
[0032] Figure 8 This is the Sirius red staining image of the liver of conditional knockout mice. Specific implementation method:
[0033] Example 1: Preparation of mice with conditional knockout of SMC6 gene in the liver
[0034] A method for constructing a liver cancer mouse model using liver-specific knockout technology of the present invention is as follows:
[0035] 1. SMC6 flox / flox Transgenic mice were obtained by CRISPR / Cas9 gene editing strategy.
[0036] 1. Select exons 4 to 10 of the SMC6 gene (NCBI reference sequence Gene ID: 67241 as the reference sequence) as the conditional gene knockout region.
[0037] 2. Based on the CRIPR / Cas9 principle, a gRNA was designed at each end of exons 4 to 10 of the SMC6 gene. The gRNA action site sequence of the SMC6 gene is shown in Table 1.
[0038] Table 1 gRNA action sites
[0039] Sequence (5'—3') gRNA1 aggcagtgataacaccggaa(SEQ ID NO.5) gRNA2 gttaccggtaatatggctgc(SEQ ID NO.6)
[0040] 3. According to the principle of homologous recombination, the SMC6 gene was modified with Flox in vitro to obtain the SMC6 gene recombinant fragment SMC6-eCKO1 (the fragment includes a 1.0 kb 5' homology arm, Loxp, a 0.7 kb flox region, Loxp, and a 1.0 kb 3' homology arm connected in sequence), which was connected to the vector plasmid by enzyme digestion to construct a donor vector for homologous recombination. Its main components are shown in Table 2. The vector plasmid map used for homologous recombination (pT3-EFIaH-PIK3CA H1047R purchased from Addgene, catalog number #69992) is shown in Figure 2 shown.
[0041] Table 2 Main components of donor vector
[0042] element name 5'arm 5' homology arm. Flox region Flox area. 3'arm 3' homology arm. LoxP Connected to the 5' homology arm and Flox region, and the 3' homology arm and Flox region; two in total.
[0043] 4. Cas9 mRNA (purchased from GenScript Biotech Co., Ltd., catalog number #CS2325. (SEQ ID NO.7)), gRNA and donor vector were microinjected into fertilized eggs of C57BL / 6 mice (commercially available mice, purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.), and the surviving fertilized eggs after injection were transplanted into pseudo-pregnant female mice. Mice were born in about 20 days, namely F0 generation SMC6 flox / flox Transgenic mice.
[0044] 2. Preparation of mice with conditional knockout of SMC6 gene in liver
[0045] 1. Alb-cre transgenic mice were obtained by inserting the cre gene downstream of the albumin Alb promoter. The mice were commercially available and purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. (Cat. No.: T003814).
[0046] 2. SMC6 flox / flox The transgenic mice were crossed with the Alb-cre transgenic mice to obtain F1 mice, and the F1 mice were self-fertilized to obtain F2 mice, which were identified and the genotype was SMC6. flox / flox :Alb-cre + mice, hereinafter referred to as conditional knockout mice, or SMC6 Alb- / - Mice, such as Figure 1 shown.
[0047] 3. The identification method of F2 generation mice is as follows: collect tissues of 1-2 week old mice (tail or toe tissues); lyse the tissues and extract the genome; use specific primers for target gene for PCR amplification and electrophoresis detection to screen out the offspring with SMC6-flox positive homozygotes and Alb-cre positive target genotypes ( Figure 3 ).
[0048] The PCR procedure was performed as follows:
[0049] 95°C for 5 minutes;
[0050] 20 cycles of 95°C for 10 s, 65°C for 30 s (0.5°C decrease per cycle), and 72°C for 40 s;
[0051] 20 cycles of 95°C for 10 s, 55°C for 30 s, and 72°C for 40 s;
[0052] 72°C for 5 minutes.
[0053] The upstream primer of SMC6-flox identification PCR is: T026245-F, tgtttagcctgcatgtgtgtctg (SEQ ID NO.1); the downstream primer is: T026245-R, gcctctgtaagttgtcctctgatc (SEQ ID NO.2);
[0054] The electrophoresis band size of SMC6-flox positive homozygotes was 447 bp, the size of SMC6-flox negative band was 341 bp, and the heterozygotes had both 447 bp and 341 bp bands.
[0055] The upstream primer of Alb-cre identification PCR is: H11-tF, gggcagtctggtacttccaagct (SEQ ID NO.3); the downstream primer is: Alb-tR, tagctacctatgcgatccaaacaac (SEQ ID NO.4);
[0056] The electrophoresis band size of Alb-positive samples was 340bp, and no band could be amplified from Alb-negative samples.
[0057] Example 2: Identification of liver cancer model mice
[0058] In this example, the SMC6 constructed in Example 1 Alb- / - The mice were raised in an SPF animal room until they were 4 to 10 months old.
[0059] The mice were killed by cervical dislocation, and their livers were taken out and photographed. It was found that obvious lesions and nodules appeared in the livers of mice from the age of 4 months. Over time, the livers of mice proliferated significantly and the lesions worsened. Figure 4 ).
[0060] The eyeballs were removed to collect blood, and then centrifuged at 10,000 rpm for 10 minutes to obtain serum. Mouse alpha-fetoprotein (AFP) ELISA kit (purchased from Wuhan Cloud-Clone Technology Co., Ltd.) was used to detect liver cancer indicators. The test was performed according to the instructions and the OD450 value was read. The results showed that compared with wild-type mice, SMC6 Alb- / - AFP in mice increased significantly ( Figure 5 ).
[0061] Mouse livers were removed and fixed in 4% paraformaldehyde, then embedded in paraffin, and tissue sections were cut for HE staining: hematoxylin staining solution stained the liver cell nuclei purple-blue; eosin staining was used to stain the cytoplasm and extracellular matrix red. The results showed that compared with wild-type mice, SMC6 Alb- / - The mouse liver tissue has incomplete lobular structure, disordered cell arrangement, polymorphic nuclei, increased nuclear-cytoplasmic ratio, vacuolar degeneration structure and other hepatocellular carcinoma-like lesions ( Figure 6 ).
[0062] Example 3: Detection of liver cirrhosis in model mice
[0063] In this example, the paraffin sections of the mouse liver tissue obtained in Example 2 were subjected to Masson staining and Sirius red staining.
[0064] Masson staining collagen fibers are blue and cytoplasm is red. The staining steps are as follows: dewax the paraffin sections to water, wash with tap water and distilled water for five minutes, stain the nuclei with Regaud's hematoxylin staining solution for 5-10 minutes, wash with distilled water, dissolve with Masson Ponceau acid red solution for 5-10 minutes, soak with 2% glacial acetic acid aqueous solution, differentiate with phosphomolybdic acid aqueous solution for 3-5 minutes, stain with aniline blue or light green solution for 5 minutes, soak with 0.2% glacial acetic acid aqueous solution, 95% alcohol, anhydrous alcohol, transparent xylene, and seal with neutral glue.
[0065] Sirius red staining collagen fibers red, background yellow. The staining steps are as follows: paraffin sections are dewaxed to water, and the sections are sequentially placed in xylene I for 20 minutes-xylene II for 20 minutes-anhydrous ethanol I for 10 minutes-anhydrous ethanol II for 10 minutes-95% alcohol for 5 minutes-90% alcohol for 5 minutes-80% alcohol for 5 minutes-70% alcohol for 5 minutes-distilled water for washing, and the sections are placed in saturated withered garlic Sirius red staining solution for 8 minutes, and the sections are rinsed in anhydrous alcohol for several minutes, and the sections are placed in a 60° oven to dry and then transparent in xylene for 5 minutes, and sealed with neutral gum.
[0066] Masson staining showed that obvious blue collagen fibers appeared in the liver tissue of the model mice ( Figure 7 ), Sirius red staining also observed red collagen fibers ( Figure 8 ), the model mice developed severe liver cirrhosis.
[0067] The above description is only a partial embodiment of the present invention, and does not limit the implementation mode and protection scope of the present invention. For those skilled in the art, it should be realized that all solutions obtained by equivalent substitution and obvious changes made by using the description and illustrations of the present invention should be included in the protection scope of the present invention. The above description is only a partial embodiment of the present invention, and does not limit the implementation mode and protection scope of the present invention. For those skilled in the art, it should be realized that all solutions obtained by equivalent substitution and obvious changes made by using the description and illustrations of the present invention should be included in the protection scope of the present invention.
Claims
1. A method for constructing a liver cancer mouse model, characterized in that: A liver cancer mouse model was obtained by conditional knockout of the SMC6 gene in hepatocytes.
2. The method for constructing a liver cancer mouse model according to claim 1, characterized in that The steps include: 1) Includes a preparation of SMC6 flox / flox The steps of transgenic mice are as follows: exons 4 to 10 of the SMC6 gene are selected as conditional gene knockout regions; a gRNA is designed at each end of exons 4 to 10 of the SMC6 gene based on the CRIPR / Cas9 system; the gRNA action site sequence of the SMC6 gene is as follows: gRNA1: AGGCAGTGATAACACCGGAA; gRNA2:GTTACCGGTAATATGGCTGC; The SMC6 gene was modified with Flox in vitro to obtain the SMC6 gene recombinant fragment SMC6-eCKO1. The fragment SMC6-eCKO1 includes a 5' homology arm, Loxp, a flox region, Loxp, and a 3' homology arm connected in sequence to form a donor vector for homologous recombination; Cas9 mRNA, gRNA and donor vector were microinjected into fertilized eggs of C57BL / 6 mice, and the surviving fertilized eggs were transplanted into pseudopregnant female mice to produce mice, namely F0 generation SMC6 flox / flox Transgenic mice; 2) SMC6 flox / flox The transgenic mice were crossed with the Alb-cre transgenic mice to obtain F1 mice, which were self-fertilized and identified to have the genotype SMC6. flox / flox :Alb-cre + of mice.
3. A liver cancer mouse model, characterized in that: SMC6 flox / flox The transgenic mice were crossed with the Alb-cre transgenic mice to obtain F1 mice, which were self-fertilized and identified to have the genotype SMC6. flox / flox :Alb-cre + of mice.
4. The uses of the liver cancer mouse model according to claim 3 include research on the mechanism of liver cancer, research on the mechanism of liver cirrhosis, screening and evaluating or treating drugs for liver cancer, and screening and evaluating or treating drugs for liver cirrhosis.