Preparation method and application of fibrotic nucleus pulposus cell targeting anti-FAP scFv engineered exosome loaded SKI mRNA delivery system

Abstract

The invention discloses a preparation method and application of a fibrotic nucleus pulposus cell targeting anti-FAP scFv engineered exosome loaded SKI mRNA delivery system, and an active preloading method is used to construct two recombinant plasmids for co-transfection so as to construct the anti-FAP scFv engineered exosome loaded SKI mRNA delivery system. The SKI mRNA is efficiently delivered through the targeted membrane protein FAP to achieve SKI overexpression, so that a TGF-beta pathway is inhibited, nucleus pulposus fibrosis is reversed, and the purpose of improving intervertebral disc degeneration is achieved. The invention provides a new strategy for realizing accurate and efficient inhibition of nucleus pulposus fibrosis clinically in the future, so that the treatment direction of intervertebral disc degeneration is developed. The invention develops an engineered exosome for efficient overexpression of SKI based on targeted membrane protein FAP so as to inhibit nucleus pulposus fibrosis and achieve the purpose of improving intervertebral disc degeneration. The invention provides a new strategy for realizing accurate and efficient inhibition of nucleus pulposus fibrosis clinically in the future, so that the treatment direction of intervertebral disc degeneration is developed.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology and provides a fibrotic nucleus pulposus cell-targeted anti-FAP scFv engineered exosome negative

[0002] Preparation method and application of SKI mRNA delivery system. Background Art

[0003] Intervertebral disc degeneration is a common orthopedic disease that affects the health of all mankind. Intervertebral disc degeneration can lead to a decline in quality of life, reduced work efficiency, and cause serious socioeconomic burdens. Currently, clinical treatment is mainly conservative treatment or surgical treatment. However, these treatments cannot reverse the progression of intervertebral disc degeneration. Nucleus pulposus fibrosis is a characteristic manifestation of intervertebral disc degeneration and a key factor in aggravating intervertebral disc degeneration. Nucleus pulposus fibrosis is mainly manifested by extracellular matrix remodeling of nucleus pulposus cells, decreased nucleus pulposus elasticity, irreversible and severe tissue remodeling, and abnormal collagen matrix deposition, which ultimately leads to severe clinical symptoms. So far, there are few effective anti-fibrotic treatments in clinical practice to alleviate intervertebral disc degeneration. Effective inhibition of nucleus pulposus fibrosis is a potential treatment direction for the treatment of intervertebral disc degeneration.

[0004] TGF-β signaling is a classic cell proliferation and differentiation-related signaling pathway. The TGF-β signaling pathway is involved in the development and homeostasis of skeletal muscle tissue, but abnormally activated TGF-β signaling pathway is considered to be an important cause of matrix remodeling in fibrotic lesions. During intervertebral disc development, TGF-β guides matrix development in the notochord. At the same time, TGF-β is indispensable for the synthesis and secretion of extracellular matrix in the intervertebral disc. However, excessive activation of the TGF-β signaling pathway may lead to the occurrence of intervertebral disc degeneration.

[0005] The proto-oncogene SKI (Cellular Sloan-Kettering Institute) is a transcriptional regulator and a classic antagonist of the TGF-β signaling pathway. SKI has been shown to inhibit pulmonary, skin, kidney, and myocardial fibrosis. These results suggest that SKI may have the potential to treat nucleus pulposus fibrosis. However, most of the SKI gene therapy methods reported so far for fibrosis rely on virus-mediated overexpression, which has the potential to induce inflammation and toxic reactions, which may affect its therapeutic effect, and virus-mediated overexpression may lead to viral integration into the genome.

[0006] Exosomes (Exos) are lipid nanovesicles secreted by cells with a size of 30-150 nm. In recent years, exosomes have been widely used as potential nano-delivery systems for drug therapy. Exosomes can carry a variety of biomolecules, including proteins, nucleic acids, and metabolites, and achieve effective delivery of these molecules through interactions with receptor cells. mRNA can be directly used for protein synthesis through intracellular RNA translation, which has the advantage of transient expression. However, mRNA delivery needs to overcome the limitations of the extracellular barrier to avoid degradation by RNA hydrolases in extracellular serum. The specific lipid components of Exos can increase its stability, thereby helping to avoid mRNA degradation by the extracellular barrier and reducing recognition of mononuclear phagocytosis. mRNA can be loaded into Exos secreted by living cells by active preloading, passive preloading, and postloading. On this basis, the modification of antibody fragments, oligonucleotides, peptides, small molecule compounds, etc. on the surface of Exos gives Exos the ability to target specific cells or specific cell surface proteins. Therefore, using Exos as a delivery carrier can effectively target SKI to fibrotic nucleus pulposus cells, thereby promoting the precise treatment of nucleus pulposus fibrosis.

[0007] Single chain antibody fragment (scFv) is composed of the variable region of the heavy chain (VH) and the variable region of the light chain (VL) of the antibody connected by a short peptide of 10 to 20 amino acids. It is the smallest form of recombinant antibody (about 27kDa). It contains a complete antigen binding site and can bind to specific antigens with similar affinity to its parent monoclonal antibody. During the process of intervertebral disc degeneration, the fibrosis marker fibroblast activation protein (FAP) is upregulated. By using the specific FAP recognition ability of FAP-scFv to transform exosomes, SKI-mRNA can be targeted and transported to fibrotic nucleus pulposus cells that highly express FAP, thereby improving its therapeutic efficiency. Summary of the invention

[0008] In view of this, the purpose of the present invention is to provide an anti-FAP scFv engineered exosome loading targeting fibrotic nucleus pulposus cells

[0009] Preparation method and application of SKI mRNA delivery system.

[0010] To achieve the above object, the present invention provides the following technical solutions:

[0011] The present invention provides a method for preparing a fibrotic nucleus pulposus cell-targeted anti-FAP scFv engineered exosome-loaded SKI mRNA delivery system, firstly, Lamp2b gene (specific lysosome-associated membrane protein 2 on the exosome membrane, lysosomalassociated

[0012] membrane protein 2) and FAP scFv gene were inserted into the vector GV712: CMV enhancer-MCS-SV40-puromycin to obtain the gene rLamp2b (ins scFv mFAP)-MS2 protein. The recombinant plasmid was named FAP-scFv-Lamp2b-MS2;

[0013] Insert SKI mRNA (NM_001100715.1) and GFP gene into vector KV222:CMV

[0014] enhancer-EGFP-MCS-SV40-Neomycin, gene NM_001100715.1-3utr-MS2 stemloop was obtained, and the recombinant plasmid was named SKI-mRNA-MS2Bs; then FAP-scFv-Lamp2b-MS2 and SKI-mRNA-MS2Bs plasmids were co-transfected into 293T cells, and the cell culture supernatant was subjected to gradient centrifugation to obtain exosomes EX ski+scFv .

[0015] Preferably, the nucleotide sequence of the Lamp2b gene is shown in SEQ ID NO.1.

[0016] ATGCGCTCCTCTCTCCGGTTACGGGCTCGAAGCTCGTCCTGCTCTTTCTGTTCCTG

[0017] GGAGCAGTTCGGTCCGATGCATTGAAACTTAATTTGACAGATTCAAAGGGTACTTGCCTT

[0018] TATGCTCGACAGGTGCAGCTGAAGCAGAGCGGAGCTGAGCTGGTGAAGCCAGGTGCTA

[0019] GCGTGAAGCTGAGTTGTAAGACCAGCGGCTACACATTCACAGAGAACATTATCCACTGG

[0020] GTGAAGCAGAGGAGCGGCCAGGGCCTGGAGTGGATCGGCTGGTTTCATCCTGGCTCAG

[0021] GCTCTATTAAATACAACGAGAAGAAGGATAAGGCCACCCTGACAGCTGATAAGTCCAGC

[0022] TCTACAGTGTACATGGAGCTGAGCAGGCTGACTTCAGAGGACAGCGCCGTGTATTTCTG

[0023] CGCCCGGCATGGGGGCACCGGCCGGGGAGCTATGGACTACTGGGGCCAGGGCACCTCC

[0024] GTGACCGTGAGCTCTGGCGGAGGCGGATCTGGGGGCGGAGGGAGCGGAGGGGGCGGG

[0025] AGCGACATCCTGATGACCCAGTCCCCTGCCTCCTCTGTGGTGAGCCTGAGCGGCCAGAG

[0026] GGCTACAATCAGTTGCAGGGCTAGCAAAAGCGTGTCAACCAGCGCCTATTCCTACATGC

[0027] ATTGGTACCAGCAGAAGCCTGGGCAGCCTCCTAAGCTGCTGATCTATCTGGCTTCCAACC

[0028] TGGAGTCCGGCGTGCCTCCCAGATTCAGCGGCAGCGGCAGCGGCACCGATTTCACCCTC

[0029] AACATCCACCCTGTCGAGGAGGAGGATGCCGCCACATACTACTGTCAGCACAGCAGGG

[0030] AGCTGCCATACACTTTTGGCGGCGGCACTAAGCTGGAGATCAAGTCCGGAGGTGCAGAA

[0031] TGGGAGATGAATTTCACAATAACATATGAAGCTCTAAAAGTCAATGAAACTGTAACCATT

[0032] ACAGTGCCTGACAAGGTGACATACAATGGAAGCAGTTGTGGCGATGATAAGAATGGTGC

[0033] CAAAATAATGATACAATATGGATCCACTCTCTCTTGGGCTGTGAATTTCACCAAGGAAGC

[0034] ATCTCAGTATTTTATTAACAACATCACGCTTTCTTACAACACTAATGATACCAAAACATTT

[0035] CCTGGTGCTGTACCTAAAGGAATCCTTACTGTTATCATTCCTGTGGGATCCCAGCTTCCAT

[0036] TGGGTGTCATCTTTAAGTGCAGTAGTGTTTTAACTTTCAACCTGAGTCCTGTTGTTCAGC

[0037] ACTATTGGGGCATTCACCTGCAAGCTTTTGTCCAAAATGGTACAGTGAGTAAACATGAA

[0038] CAAGTGTGTAAGGAGGACAAAACTGCTACCACTGTAGCACCCATCATTCACACCACCGT

[0039] GCCATCGCCTACTACGACACTCACTCCAACTTCAATACCCGTTCCAACTCCAACGGTTGG

[0040] AAACTACACCATTTCTAATGGCAATGCTACCTGTCTGCTGGCTACCATGGGGCTGCAGCT

[0041] GAACATCACCGAGGAGAAGGTGCCTTTCATTTTTAACATCAACCCTGCCATAACCAACTT

[0042] CACCGGCAGCTGTCAGCCCCAAACAGCTCAACTTAGGCTGAACAACAGCCAAATTAAG

[0043] TATCTCGACTTTATCTTTGCTGTGAAAAATGAAAAACGGTTCTATCTGAAGGAAGTGAAT

[0044] GTCAACATGTATTTGGCTAATGGCTCAGCTTTCCATGTTTCAAATAACAACCTTAGCTTCT

[0045] GGGATGCTCCTCTGGGAAGTTCTTATATGTGCAACAAAGAGCAGGTGGTTTCCGTGTCT

[0046] CGAACATTTCAGATAAATACCTTTAACCTGAAGGTGCAACCTTTTAATGTGACGAAAGG

[0047] AGAGTATTCTACAGCCCAGGAGTGTTCGCTGGATGATGACACCATTCTAATACCAATTAT

[0048] AGTTGGTGCTGGTCTTTCAGGCTTGATTATCGTTATAGTGATTGCTTACCTAATTGGCAGA

[0049] AGAAAGACTTATGCTGGATATCAGACTCTGGGAGGGGGAGGCTCAGGAGGGGGTGGCA

[0050] GTGGAGGAGGAGGAAGTGCTTCAAACTTTACTCAGTTCGTGCTCGTGGACAATGGTGG

[0051] GACAGGGGATGTGACAGTGGCTCCTTCTAATTTCGCTAATGGGGTGGCAGAGTGGATCA

[0052] GCTCCAACTCACGGAGCCAGGCCTACAAGGTGACATGCAGCGTCAGGCAGTCTAGTGC

[0053] CCAGAAGAGAAAGTATACCATCAAGGTGGAGGTCCCCAAAGTGGCTACCCAGACAGTG

[0054] GGCGGAGTCGAACTGCCTGTCGCCGCTTGGAGGTCCTACCTGAACATGGAGCTCACTAT

[0055] CCCAATTTTCGCTACCAATTCTGACTGTGAACTCATCGTGAAGGCAATGCAGGGCTCCT

[0056] CAAAGACGGTAATCCTATCCCTTCCGCCATCGCCGCTAACTCAGGTATCTACAGCGCTTAA, as shown in SEQ ID NO.1.

[0057] Preferably, the nucleotide sequence of the FAP scFv gene is shown in SEQ ID NO.2.

[0058] CAGGTGCAGCTGAAGCAGAGCGGAGCTGAGCTGGTGAAGCCAGGTGCTAGCGTGAAGCTGAGTTGTAAGACCAGCGGCTACACATTCACAGAGAACATTATCCACTGGGTGAAGCAGAGGAGCGGCCAGGGCCTGGAGTGGATCGGCTGGTTTCATCCTGGCTCAGGCTCTATTAAATACAACGAGAAGAAGGATAAGGCCACCCTGACAGCTGATAAGTCCAGCTCTACAGTGTACATGGAGCTGAGCAGGCTGACTTCAGAGGACAGCGCCGTGTATTTCTGCGCCCGGCATGGGGGCACCGGCCGGGGAGCTATGGACTACTGGGGCCAGGGCACCTCCGTGACCGTGAGCTCTGGCGGAGGCGGATCTGGGGGCGGAGGGAGCGGAGGGGGCGGGAGCGACATCCTGATGACCCAGTCCCCTGCCTCCTCTGTGGTGAGCCTGAGCGGCCAGAGGGCTACAATCAGTTGCAGGGCTAGCAAAAGCGTGTCAACCAGCGCCTATTCCTACATGCATTGGTACCAGCAGAAGCCTGGGCAGCCTCCTAAGCTGCTGATCTATCTGGCTTCCAACCTGGAGTCCGGCGTGCCTCCCAGATTCAGCGGCAGCGGCAGCGGCACCGATTTCACCCTCAACATCCACCCTGTCGAGGAGGAGGATGCCGCCACATACTACTGTCAGCACAGCAGGGAGCTGCCATACACTTTTGGCGGCGGCACTAAGCTGGAGATCAAG, as shown in SEQ ID NO.2.

[0059] Preferably, the vector GV712 is CMV enhancer - MCS - SV40 - puromycin, purchased from Shanghai GeneChem Co., Ltd.

[0060] Preferably, the sequence of SKI mRNA is as shown in SEQ ID NO.3.

[0061]

[0062] Preferably, the nucleotide sequence of the GFP gene is as shown in SEQ ID NO.4.

[0063] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA, as shown in SEQ ID NO.4.

[0064] Preferably, the vector KV222 is CMV enhancer-EGFP-MCS-SV40-Neomycin, purchased from Shanghai Genechem Co., Ltd.

[0065] Preferably, the specific method of post-treatment is: 293T cells are cultured in DMEM without FBS for 2 days to transfect FAP-scFv-Lamp2b-MS2 plasmid and SKI-mRNA-MS2Bs plasmid; after transfection, 293T cells are cultured for 3 days using DMEM supplemented with FBS pre-removed from exosomes, the culture fluid is collected, centrifuged at 500×g for 10 min, 2000×g for 30 min to remove dead cells and debris, and centrifuged at 10000×g for 1 h to remove large vesicles; the supernatant is collected and ultracentrifuged at 100000×g at 4°C for 70 min using a 70Ti rotor; and the exosomes are finally collected with 5 μl PBS.

[0066] Preferably, the exosomes are stored at -80°C.

[0067] Preferably, the specific steps are as follows:

[0068] Step 1: Using rat cDNA as a template, PCR amplification was used to obtain the Lamp2b fragment, and PCR purification was performed to obtain the Lamp2b gene (XM_006257486.5);

[0069] Step 2: insert the Lamp2b gene and FAP scFv gene into the vector GV712:CMV enhancer-MCS-SV40-puromycin to obtain the gene rLamp2b (ins scFv mFAP)-MS2 protein, named FAP-scFv-Lamp2b-MS2 plasmid;

[0070] Step 3: Insert SKI mRNA (NM_001100715.1) and GFP gene into vector KV222: CMV enhancer-EGFP-MCS-SV40-Neomycin to obtain gene NM_001100715.1-3utr-MS2 stem loop, named SKI-mRNA-MS2Bs plasmid;

[0071] Step 4: FAP-scFv-Lamp2b-MS2 and SKI-mRNA-MS2Bs plasmids were co-transfected into 293T cells (Punoxay, China);

[0072] Step 5: 293T cells were cultured in DMEM without FBS (Thermo Fisher Scientific, USA) for 2 days to transfect FAP-scFv-Lamp2b-MS2 plasmid and SKI-mRNA-MS2Bs plasmid; after transfection, 293T cells were cultured in DMEM supplemented with exosome-removed FBS (Vivacell, China) for 3 days, the culture medium was collected, centrifuged at 500×g for 10 min, 2000×g for 30 min to remove dead cells and debris, and centrifuged at 10000×g for 1 h to remove large vesicles;

[0073] Step 6: Collect the supernatant and ultracentrifuge at 100,000 × g at 4 °C for 70 min in a 70Ti rotor; finally, collect the exosomes with 5 μl PBS (containing 135 mM NaCl, 4.7 mM KCl, 10 mM Na2HPO4, 2 mM NaH2PO4, pH 7.3 ± 0.1), named EX ski+scFv .

[0074] Preferably, in step one, the PCR conditions are: pre-denaturation at 98°C for 5 minutes; denaturation at 98°C for 10 seconds; annealing at 60°C for 15 seconds; extension at 72°C for 120 seconds; final extension at 72°C for 5 minutes; end at 4°C and store; the PCR primer sequences are K24K0364-wf3: GTGTCTCGAACATTTCAGAT (5'-3'); pcDNA-SEQR: TTATTAGGAAAGGACAGTGGG (5'-3').

[0075] Preferably, in step six, the centrifuge tube material used for centrifugation is transparent polypropylene, and the exosomes are stored at -80°C.

[0076] The present invention also provides a fibrotic nucleus pulposus cell-targeted anti-FAP scFv engineered exosome-loaded SKI mRNA delivery system, which is obtained by the aforementioned preparation method.

[0077] The present invention also provides the use of the aforementioned fibrotic nucleus pulposus cell-targeted anti-FAP scFv engineered exosome-loaded SKImRNA delivery system in the preparation of a drug for alleviating intervertebral disc degeneration.

[0078] Preferably, the exosomes specifically target fibrotic nucleus pulposus cells and inhibit the TGF-β pathway by overexpressing SKI, thereby improving the fibrotic changes of nucleus pulposus cells and relieving intervertebral disc degeneration.

[0079] The beneficial effects of the present invention are:

[0080] The present invention uses an active preloading method to construct two recombinant plasmids for co-transfection to construct an anti-FAPscFv engineered exosome-loaded SKI mRNA delivery system. The present invention efficiently delivers SKI mRNA by targeting the membrane protein FAP to achieve overexpression of SKI, thereby inhibiting the TGF-β pathway, reversing nucleus pulposus fibrosis, and further improving intervertebral disc degeneration. The present invention provides a new strategy for the future clinical realization of accurate and efficient inhibition of nucleus pulposus fibrosis, thereby opening up a treatment direction for intervertebral disc degeneration. The present invention has developed engineered exosomes that efficiently overexpress SKI based on the targeted membrane protein FAP to inhibit nucleus pulposus fibrosis and achieve the purpose of improving intervertebral disc degeneration. The present invention provides a new strategy for the future clinical realization of accurate and efficient inhibition of nucleus pulposus fibrosis, thereby opening up a treatment direction for intervertebral disc degeneration. The specific analysis is as follows:

[0081] 1. mRNA can directly encode the translation instructions of the target protein, utilize the intracellular protein synthesis pathway, and has the advantage of transient expression. The key is that the viral vector gene needs to enter the cell nucleus to achieve the translation and expression of the antigen, which may cause the viral genome to integrate into the host genome and cause mutations. mRNA can be quickly synthesized through in vitro transcription, and by expressing various functional proteins, it can achieve the purpose of overexpression, activation, inhibition and deletion of target genes. This makes mRNA drugs highly efficient, economical, and fast in action. They have been successfully used in vaccines and have shown great potential in the diagnosis and treatment of tumors, cardiovascular and neurological diseases.

[0082] 2. Exos are lipid nanovesicles secreted by cells, with a size distribution of 30-150nm. Exosomes have many advantages as drug carriers: (1) The specific lipid composition of exosomes can make them very stable, thus helping to avoid the possibility of degradation by the extracellular barrier; (2) The characteristics of nanosize and composition can reduce the recognition of the mononuclear phagocytic system; (3) The properties derived from the cells themselves can reduce the activation of the adaptive immune system by exosomes; (4) They can be modified to have intrinsic cell and tissue targeting properties.

[0083] 3. scFv is composed of the variable region of the heavy chain (VH) and the variable region of the light chain (VL) of the antibody connected by a short peptide of 10 to 20 amino acids. It is the smallest form of recombinant antibody (about 27kDa). The smaller molecular size of scFv brings advantages such as strong penetration into tumors, rapid degradation in the blood, and small negative feedback in the human body, which also lays the foundation for the application of scFv. The above advantages of single-chain antibodies have made it one of the most popular genetically engineered antibody molecules.

[0084] Other advantages, objectives and features of the present invention will be described in the following description to some extent, and to some extent, will be obvious to those skilled in the art based on the following examination and study, or can be taught from the practice of the present invention. The objectives and other advantages of the present invention can be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0085] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below in conjunction with the accompanying drawings, wherein:

[0086] Figure 1 The map of the engineered plasmid vector is shown in Figure 1. Among them, a is the map of the rLamp2b (ins scFv mFAP)-MS2 protein vector, and b is the map of the NM_001100715.1-3utr-MS2 stem loop vector.

[0087] Figure 2 Figure 1 is the identification diagram of engineered exosomes. Among them, a is the analysis of the number and size distribution of exosomes by nanoparticle tracking analysis, and b is the identification of exosome morphology by exosome electron microscopy.

[0088] Figure 3 Figure 1 is a rat tail intervertebral disc X-ray. a is a rat tail X-ray, b is a rat tail X-ray DHI% statistical chart, n=3, *** indicates P<0.01, * indicates P<0.5. DHI% represents the change in DHI value before and after induction and treatment.

[0089] Figure 4 The intervertebral disc of rat tail is stained. Among them, a is HE staining of intervertebral disc, b is Safranin O fast green staining of intervertebral disc, and c is histological statistical analysis, n=3, *** indicates P<0.01.

[0090] Figure 5 The fiber staining of rat tail intervertebral disc. Among them, a is the intervertebral disc Sirius red staining (white light), b is the intervertebral disc Sirius red staining (polarized light), and c is the statistical analysis of the thickness of Sirius red stained fibers. DETAILED DESCRIPTION

[0091] The present invention will be further described below in conjunction with specific implementation modes.

[0092] Reagents and instruments used in the examples: clean bench was from Wuxi Yijing Company, small animal-specific inhalation anesthesia machine VMR was from Matrx Company of the United States, microinjector was from Hamilton Company of Switzerland. Fluorescence inverted microscope was from Olympus Company of Japan, optical microscope was from Leica Company of Germany, nanoparticle tracking analysis was from nanoosight NS300 instrument from Malvern Company of the United Kingdom, transmission electron microscope was from G2 Spirit FEI electron transmission microscope from Tecnai Company of the United States, all antibodies were purchased from Proteintech Company, and other reagents were commercially available biological grade products.

[0093] The substantive content of the present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods without specifying specific conditions in the following examples are usually carried out under conventional conditions or according to the conditions recommended by the manufacturer.

[0094] Example 1

[0095] The present invention provides a technical solution: preparation of an exosome drug delivery system targeting fibrotic nucleus pulposus, which part involves EX ski+scFv The preparation comprises the following preparation steps:

[0096] Step 1: Using rat cDNA as a template, PCR amplification was used to obtain the Lamp2b fragment. The PCR conditions were pre-denaturation at 98°C for 5 minutes; denaturation at 98°C for 10 seconds; annealing at 60°C for 15 seconds; extension at 72°C for 120 seconds; final extension at 72°C for 5 minutes; end at 4°C and store. The PCR primer sequences were K24K0364-wf3: GTGTCTCGAACATTTCAGAT (5'-3'); pcDNA-SEQR: TTATTAGGAAAGGACAGTGGG (5'-3'); PCR purification was performed to obtain the Lamp2b gene (XM_006257486.5);

[0097] Step 2: Insert the Lamp2b gene and FAP scFv gene into the vector GV712:CMV enhancer-MCS-SV40-puromycin to obtain the gene rLamp2b (ins scFv mFAP)-MS2 protein, and obtain the FAP-scFv-Lamp2b-MS2 plasmid.

[0098] Step 3: Insert SKI mRNA (NM_001100715.1) and GFP gene into vector KV222: CMV enhancer-EGFP-MCS-SV40-Neomycin to obtain gene NM_001100715.1-3utr-MS2 stem loop and obtain SKI-mRNA-MS2Bs plasmid.

[0099] Step 4: FAP-scFv-Lamp2b-MS2 ( Figure 1 a) and SKI-mRNA-MS2Bs plasmid ( Figure 1 Middle b) Co-transfected 293T cells.

[0100] Step 5: 293T cells were cultured in DMEM without FBS for 2 days to transfect FAP-scFv-Lamp2b-MS2 plasmid and SKI-mRNA-MS2Bs plasmid; after transfection, 293T cells were cultured in DMEM supplemented with FBS pre-removed from exosomes for 3 days. The culture medium was collected and centrifuged at 500×g for 10 minutes, 2000×g for 30 minutes to remove dead cells and debris, and 10000×g for 1 hour to remove large vesicles.

[0101] Step 6: Collect the supernatant and ultracentrifuge at 100,000 × g at 4°C for 70 min in a 70Ti rotor. Finally, collect the exosomes with 5 ul PBS and name them EX ski+scFv ,, Exosomes were stored at -80℃. ( Figure 2 )

[0102] Example 2

[0103] The present invention provides a technical solution: preparation of an exosome drug delivery system targeting fibrotic nucleus pulposus, which part involves EX ski The preparation comprises the following preparation steps:

[0104] Step 1: Insert SKI mRNA (NM_001100715.1) and GFP gene into vector KV222: CMV enhancer-EGFP-MCS-SV40-Neomycin to obtain gene NM_001100715.1-3utr-MS2 stem loop and obtain SKI-mRNA-MS2Bs plasmid.

[0105] Step 2: Transfect 293T cells with SKI-mRNA-MS2Bs plasmid.

[0106] Step 3: 293T cells were cultured in DMEM without FBS for 2 days to transfect SKI-mRNA-MS2Bs plasmid; after transfection, 293T cells were cultured in DMEM supplemented with FBS pre-removed from exosomes for 3 days, the culture medium was collected, centrifuged at 500×g for 10 min, 2000×g for 30 min to remove dead cells and debris, and centrifuged at 10000×g for 1 h to remove large vesicles.

[0107] Step 4: Collect the supernatant and ultracentrifuge at 100,000 × g at 4°C for 70 min in a 70Ti rotor. Finally, collect the exosomes with 5 ul PBS and name them EX ski , exosomes were stored at -80°C.

[0108] Example 3

[0109] The present invention provides a technical solution: preparation of an exosome drug delivery system targeting fibrotic nucleus pulposus, which part involves EX scFv The preparation comprises the following preparation steps:

[0110] Step 1: Insert Lamp2b gene and FAP scFv gene into vector GV712:CMV enhancer-MCS-SV40-puromycin to obtain gene rLamp2b (ins scFv mFAP)-MS2 protein and obtain FAP-scFv-Lamp2b-MS2 plasmid.

[0111] Step 2: Transfect 293T cells with FAP-scFv-Lamp2b-MS2 plasmid.

[0112] Step 3: 293T cells were cultured in DMEM without FBS for 2 days to transfect the FAP-scFv-Lamp2b-MS2 plasmid; after transfection, 293T cells were cultured in DMEM supplemented with FBS pre-removed from exosomes for 3 days, the culture medium was collected, centrifuged at 500×g for 10 min, 2000×g for 30 min to remove dead cells and debris, and centrifuged at 10000×g for 1 h to remove large vesicles.

[0113] Step 4: Collect the supernatant and ultracentrifuge at 100,000 × g at 4°C for 70 min in a 70Ti rotor. Finally, collect the exosomes with 5 ul PBS and name them EX scFv , exosomes were stored at -80°C.

[0114] The size and morphology of exosomes were detected by G2 Spirit FEI transmission electron microscope (Tecnai, USA). The number and size distribution of exosomes were analyzed by nanoparticle tracking analysis, and the average diameter of exosomes was about 150nm. Nanoparticle tracking analysis was performed using nanoosight NS300 instrument (Malvern, UK) and polystyrene microspheres (100nm) for calibration. Exosome electron microscopy showed that the exosomes were round or oval in shape and had a classic double-layer structure. The above results show that the engineered exosomes have typical exosome characteristics ( Figure 2 ).

[0115] All animal experiments were approved by the Ethics Committee of the Second Affiliated Hospital of Army Medical University (SCXK2022-0011) and were performed in accordance with the principles and procedures of the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals and the Guide for Animal Treatment of Army Medical University. All animals were housed under pathogen-free conditions at 26-28°C and 50-65% humidity with a 12-h day-night cycle.

[0116] Eight-week-old female SD rats (Army Medical University Experimental Animal Center) were anesthetized with a ketamine-xylazine mixture (30 mg / kg ketamine, 12 mg / kg xylazine). The rats were divided into a control group, a TGF-β-induced group, and a TGF-β+EX group. scFv Group, TGF-β+EX ski Group, TGF-β+EX ski+scFv Group. TGF-β and exosomes were injected into the rat tails at the same time, TGF-β was injected 5ul (10nM), and exosomes were injected 5ul. Four weeks later, the rat tails were taken and X-ray examination of the rat tails was performed. The results showed that after TGF-β induction, the intervertebral disc height decreased, but in EX ski+scFv After treatment, the intervertebral disc height was restored, and there was no significant difference between the other groups and the surgical group ( Figure 3 ). After the test, the rat tail skin, fascia, tendons and muscles were peeled off to expose the intervertebral disc. The intervertebral disc tissue was completely immersed in a universal tissue fixative for 3-5 days. After fixation, the intervertebral disc tissue was decalcified and embedded and sliced ​​after the tissue bone softened. The rat tail intervertebral disc sections were stained with HE, Safranin O fast green and Sirius red (white light, polarized light). Figure 4 As shown in the figure, the nucleus pulposus in the control group was oval, with a complete area and clear edges. Sirius red staining showed that the nucleus pulposus was mainly composed of green fine fibers. After TGF-β induction, the intervertebral disc tissue score increased significantly, the intervertebral space collapsed, the nucleus pulposus area decreased significantly and was covered by fibrous tissue, and the covered fibrous tissue was mainly red coarse fibers. ski+scFvAfter the combined treatment, the degeneration of the intervertebral disc and the fibrosis of the nucleus pulposus were improved, the histological score decreased, the intervertebral disc height was basically restored, the area of ​​the nucleus pulposus increased, and the fibers were mainly yellow medium fibers and green fine fibers. scFv After treatment, the histological score was not significantly different from that of the TGF-β-induced group, and the nucleus pulposus was still covered by coarse fibrous tissue, indicating poor therapeutic effect. ski After treatment, the histological score was reduced, the disc height was slightly restored, and the disc fibers were mainly yellow medium fibers. The treatment effect was better than EX ski+scFv Poor Figure 5 ). The above results indicate that engineered exosomes targeting fibrotic nucleus pulposus can effectively improve intervertebral disc degeneration and reverse nucleus pulposus fibrosis.

[0117] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution, which should be included in the scope of the claims of the present invention.

Claims

1. A method for preparing a fibrotic nucleus pulposus cell-targeted anti-FAP scFv engineered exosome-loaded SKI mRNA delivery system, characterized in that: First, the Lamp2b gene and FAP scFv gene were inserted into the vector GV712: CMV enhancer-MCS-SV40-puromycin to obtain the gene rLamp2b (ins scFv mFAP)-MS2 protein, and the recombinant plasmid was named FAP-scFv-Lamp2b-MS2; SKI mRNA and GFP genes were inserted into the vector KV222: CMV enhancer-EGFP-MCS-SV40-Neomycin to obtain the gene NM_001100715.1-3utr-MS2 stem loop, and the recombinant plasmid was named SKI-mRNA-MS2Bs; then the FAP-scFv-Lamp2b-MS2 and SKI-mRNA-MS2Bs plasmids were co-transfected into 293T cells, and the cell culture supernatant was subjected to gradient centrifugation to obtain exosomes EX ski+scFv .

2. The preparation method according to claim 1, characterized in that: The nucleotide sequence of the Lamp2b gene is shown in SEQ ID NO.

1.

3. The preparation method according to claim 1, characterized in that: The nucleotide sequence of the FAP scFv gene is shown in SEQ ID NO.

2.

4. The preparation method according to claim 1, characterized in that: The sequence of SKI mRNA is shown in SEQ ID NO.

3.

5. The preparation method according to claim 1, characterized in that: The nucleotide sequence of the GFP gene is shown in SEQ ID NO.

4.

6. The preparation method according to claim 1, characterized in that: The specific method of post-treatment is as follows: after 293T cells are transfected with FAP-scFv-Lamp2b-MS2 plasmid and SKI-mRNA-MS2Bs plasmid, they are cultured in DMEM medium supplemented with fetal bovine serum (FBS) that has been pre-removed of exosomes for 3 days; The culture medium was collected and centrifuged at 500 × g for 10 min, 2000 × g for 30 min to remove dead cells and debris, and 10,000 × g for 1 h to remove large vesicles; The supernatant was collected and ultracentrifuged at 100,000×g for 70 min at 4°C using a 70Ti rotor; exosomes were finally collected with 5 μl of PBS.

7. The preparation method according to claim 1, characterized in that: The specific steps are as follows: Step 1: Using rat cDNA as a template, amplify the fragment by PCR, purify by PCR, and obtain the Lamp2b gene; Step 2: Insert Lamp2b gene and FAP scFv gene into vector GV712:CMV enhancer-MCS-SV40-puromycin to obtain the gene rLamp2b (ins scFv mFAP)-MS2 protein, named FAP-scFv-Lamp2b-MS2 plasmid; Step 3: Insert SKI mRNA and GFP gene into vector KV222:CMV enhancer-EGFP-MCS-SV40-Neomycin to obtain gene NM_001100715.1-3utr-MS2 stemloop, named SKI-mRNA-MS2Bs plasmid; Step 4: Co-transfect 293T cells with FAP-scFv-Lamp2b-MS2 and SKI-mRNA-MS2Bs plasmids; Step 5: 293T cells were cultured in DMEM without FBS for 2 days to co-transfect FAP-scFv-Lamp2b-MS2 plasmid and SKI-mRNA-MS2Bs plasmid; after transfection, 293T cells were cultured in DMEM supplemented with FBS pre-removed from exosomes for 3 days, the culture medium was collected, centrifuged at 500×g for 10 min, 2000×g for 30 min to remove dead cells and debris, and centrifuged at 10000×g for 1 h to remove large vesicles; Step 6: Collect the supernatant and ultracentrifuge at 100,000 × g at 4 °C for 70 min in a 70Ti rotor; finally, collect the exosomes with 5 μl PBS and label them as EX ski+scFv .

8. Fibrotic nucleus pulposus cell-targeted anti-FAP scFv engineered exosome-loaded SKI mRNA delivery system, characterized in that: The invention is obtained by the preparation method according to any one of claims 1 to 7.

9. Use of the fibrotic nucleus pulposus cell-targeted anti-FAP scFv engineered exosome-loaded SKI mRNA delivery system according to claim 8 in the preparation of a drug for alleviating intervertebral disc degeneration.

Images