Application of expression inhibitor of HAS2 in preparation of medicine for treating ovulation disorder of polycystic ovarian syndrome

Abstract

The invention provides application of an expression inhibitor of HAS2 in preparation of a medicine for treating ovulation disorder of polycystic ovarian syndrome. Experiments show that HAS2 is highly expressed in ovaries and / or granular cells of patients suffering from ovulation disorder of polycystic ovarian syndrome and animal models, and further show that ovarian polycystic change can be reversed by adding hydroxymerocoumarin to inhibit expression of HAS2, the number of sinus follicles and atresia follicles is reduced, and ovarian ovulation disorder can be inhibited. The quantity of corpus luteum, the quantity of oocytes and the mature oocyte rate are increased, so that the expression inhibitor of the HAS2 can be used for preparing the medicine for treating the ovulation disorder of the polycystic ovarian syndrome.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to application of a HAS2 expression inhibitor in the preparation of a drug for treating ovulation disorders in polycystic ovary syndrome. Background Art

[0002] Polycystic ovary syndrome (PCOS) is a common reproductive endocrine metabolic disease, with a prevalence of 8% to 13% in women of childbearing age. It is often manifested as ovulatory disorders, insulin resistance, hyperinsulinemia, obesity, hyperandrogenism, infertility, polycystic ovarian changes, and increased cardiovascular risk. Due to its unclear pathogenesis, the clinical treatment of PCOS is mainly symptomatic and adopts an individualized treatment plan. For PCOS patients with fertility requirements, the treatment methods mainly include lifestyle adjustment, adjustment of menstrual cycle, and relief of hyperandrogenism symptoms. If pregnancy is still unsuccessful after the above treatment, patients can choose to use ovulation induction and assisted reproductive technology treatment, but the treatment results are still affected by many factors. Therefore, exploring the pathogenesis and molecular pathways of PCOS is of great significance for finding its therapeutic targets.

[0003] Granulosa cells (GC) are the most important cell type in the ovary besides oocytes and play an important role in maintaining ovarian function. Granulosa cells (GC), cumulus cells (CC), oocytes, macrophages and follicular fluid form the follicular microenvironment that promotes oocyte maturation and ovulation. Studies have shown that GC apoptosis can lead to the loss of biological function of follicles in PCOS patients and the imbalance of regulation between cells in the follicles, eventually leading to follicular atresia. Therefore, the destruction of the balance of the follicular microenvironment caused by various reasons can cause further abnormalities in follicular development, resulting in follicular atresia and ultimately leading to ovulatory dysfunction.

[0004] Therefore, there is an urgent need to develop effective drug treatment targets for PCOS ovulatory disorders and drugs for the treatment of PCOS ovulatory disorders. Summary of the invention

[0005] The purpose of the present invention is to provide the use of HAS2 as a target in the preparation of a drug for treating ovulatory disorders in polycystic ovary syndrome. The present invention has found through experiments that HAS2 is highly expressed in the ovaries and granulosa cells of polycystic ovary syndrome ovulatory disorders, and further found that adding hydroxymethylcoumarin to inhibit the expression of HAS2 can reverse the polycystic changes in the ovaries, reduce the number of antral follicles and atretic follicles, and increase the number of corpora lutea, the number of oocytes and the rate of mature oocytes. Therefore, the expression inhibitor of HAS2 can be used to prepare a drug for treating ovulatory disorders in polycystic ovary syndrome.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] In a first aspect of the present invention, there is provided the use of HAS2 as a target in screening drugs for alleviating and / or treating ovulation disorders in polycystic ovary syndrome, wherein the screening method comprises screening substances capable of inhibiting the expression of the HAS2 gene.

[0008] In a second aspect of the present invention, provided is the use of an expression inhibitor of HAS2 in the preparation of a drug for treating ovulation disorders caused by polycystic ovary syndrome.

[0009] Furthermore, the HAS2 expression inhibitor comprises at least one of the following components:

[0010] HAS2 inhibitors;

[0011] Knockout reagent for HAS2.

[0012] Furthermore, the HAS2 inhibitor includes hydroxymethylcoumarol.

[0013] Furthermore, the drug for treating ovulation disorder caused by polycystic ovary syndrome is a drug that improves neurological damage and brain edema in SAH mice and reduces lipid peroxidation damage.

[0014] In a third aspect of the present invention, a drug for treating ovulation disorders in polycystic ovary syndrome is provided, wherein the drug comprises at least one of a HAS2 inhibitor and a HAS2 knockout agent. The HAS2 inhibitor comprises hydroxymethylcoumarin (4-MU). The HAS2 knockout agent comprises: shRNA and / or gRNA targeting a target gene.

[0015] The drug also includes pharmaceutically acceptable excipients. The excipients include at least one of a filler, a disintegrant, a binder, an excipient, a diluent, a lubricant, a sweetener or a colorant. The dosage form of the drug includes at least one of granules, tablets, pills, capsules, injections or dispersants.

[0016] In a fourth aspect of the present invention, there is provided the use of HAS2 as a molecular marker in the preparation of a diagnostic and / or prognostic product for a drug for ovulation disorders in polycystic ovary syndrome.

[0017] Furthermore, the detection reagent of HAS2 is used in the preparation of diagnostic and / or prognostic products for polycystic ovary syndrome ovulation disorder drugs.

[0018] Furthermore, the HAS2 detection reagent includes a HAS2 protein detection reagent (such as an ELISA detection kit). In other embodiments, the HAS2 detection reagent also includes a HAS2 detection primer or an immunohistochemical detection reagent.

[0019] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0020] The present invention provides the use of HAS2 as a target in the preparation of a drug for treating ovulation disorders in polycystic ovary syndrome. The present invention finds through research that HAS2 is highly expressed in drugs for ovulation disorders in polycystic ovary syndrome and can induce ovulation disorders. It is further found that adding hydroxymethylcoumarin to inhibit the expression of HAS2 can eliminate ovarian polycystic changes, reduce the number of antral follicles and atretic follicles, increase the number of corpora lutea, and increase the number of oocytes and the rate of mature oocytes. These results indicate that HAS2 is a new target for drug treatment of ovulation disorders in polycystic ovary syndrome. It indicates that the knockout reagent of HAS2 or / and the HAS2 inhibitor is a potential new drug for drug treatment of ovulation disorders in polycystic ovary syndrome. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0022] Figure 1:The expression of HAS2 in PCOS granulosa cells and ovaries increases, and the expression of IFN-γ in PCOS ovaries increases and can induce the increase of HAS2 expression. (A) The expression of HAS2 at the mRNA level in ovarian granulosa cells of PCOS patients, KGN cells in the DHT group, and ovarian granulosa cells of DHEA-induced PCOS mouse models. *** indicates P < 0.001, **** indicates P < 0.0001. (B) The expression of HAS2 at the protein level in ovarian granulosa cells of PCOS patients, KGN cells in the DHT group, and ovarian granulosa cells of DHEA-induced PCOS mouse models. (C) The expression of IFN-γ at the mRNA level in ovarian granulosa cells of PCOS patients, KGN cells in the DHT group, and ovarian granulosa cells of DHEA-induced PCOS mouse models. ** indicates P < 0.01. (D) The expression of HAS2 at the mRNA and protein levels in KGN cells after LPS and IFN-γ intervention. ** indicates P < 0.01, *** indicates P < 0.001. (E): ELISA results of the culture supernatant of KGN cells after LPS and IFN-γ intervention, including the results of HA and PGE2. **** indicates P < 0.0001. (F): ELISA results of IFN-γ in the culture supernatant of primary ovarian granulosa cells, the culture supernatant of KGN cells treated with DHT, and the serum of DHEA-induced PCOS mouse model. *** indicates P < 0.001, **** indicates P < 0.0001.

[0023] Figure 2 :Inhibition of HAS2 can inhibit the related indicators of ovulation disorder in granulosa cells. (A): Expression of HAS2 at the mRNA level in KGN cells treated with 4-MU after intervention with LPS+IFN-γ. ** indicates P < 0.01.

[0024] (B): Expression of HAS2 at the protein level in KGN cells after LPS+IFN-γ treatment and 4-MU treatment. (C): ELISA results of culture supernatant in KGN cells after LPS+IFN-γ treatment and 4-MU treatment, including the results of HA and PGE2.

[0025] Figure 3 :Schematic diagram of mouse modeling and superovulation experiment.

[0026] Figure 4:The expression of HAS2 in the ovaries of PCOS mice increases, and inhibition of HAS2 can inhibit the related indicators of ovulatory disorders; (A): Vaginal images and estrous cycle diagram of DHEA-induced PCOS mouse model and DHEA and 4-MU co-induced PCOS mouse model. (B): Schematic diagram of HE staining of ovaries in DHEA-induced PCOS mouse model and DHEA and 4-MU co-induced PCOS mouse model. (C): Schematic diagram of the number of primordial follicles, primary follicles, secondary follicles, antral follicles, atretic follicles, and corpus luteum in ovaries in DHEA-induced PCOS mouse model and DHEA and 4-MU co-induced PCOS mouse model. * indicates P < 0.05, ** indicates P < 0.01, and **** indicates P < 0.0001. (D): Schematic diagram of ovarian immunohistochemistry in DHEA-induced PCOS mouse model and DHEA and 4-MU co-induced PCOS mouse model. (E): Expression of HAS2 at the mRNA and protein levels in ovarian granulosa cells in DHEA-induced PCOS mouse model and DHEA and 4-MU co-induced PCOS mouse model. * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001. (F): Expression of HA serum ELISA level in DHEA-induced PCOS mouse model and DHEA and 4-MU co-induced PCOS mouse model. * indicates P < 0.05, ** indicates P < 0.01.

[0027] Figure 5 :The mouse model confirmed that inhibiting HAS2 can reverse PCOS ovulation disorder, and HAS2 is related to ovulation function. (A): Pictures of superovulated oocytes in PCOS mice and PCOS mice treated with 4-MU. (B): Counts of oocytes recovered after superovulation in PCOS mice and PCOS mice treated with 4-MU. indicates P<0.05, ** indicates P<0.01. (C): Mature oocyte rate after superovulation in PCOS mice and PCOS mice treated with 4-MU, *** indicates P<0.001. DETAILED DESCRIPTION

[0028] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0029] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0030] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.

[0031] The application of HAS2 as a target in the preparation of a drug for treating ovulation disorders in polycystic ovary syndrome will be described in detail below in combination with examples and experimental data.

[0032] Example 1: Increased expression of HAS2 in PCOS granulosa cells

[0033] 1. Research objects and materials

[0034] 1. Research subjects: PCOS patients (n=37) and non-PCOS patients (n=42) who visited the Reproductive Center of Wuhan University Renmin Hospital from March to June 2022 were collected. The PCOS group was diagnosed according to the 2003 Rotterdam criteria and met at least two of the following three symptoms: decreased ovulation or anovulation, clinical and / or biochemical signs of hyperandrogenism, and polycystic ovaries after excluding other causes. The control group consisted of women whose infertility was mainly caused by pure male factors. This study has been approved by the Ethics Committee of Wuhan University Renmin Hospital, and all patients were aware of and signed informed consent.

[0035] 2. Collection of follicular fluid (FF): Follicular fluid of 76 patients was obtained from follicular aspirates collected at the time of oocyte retrieval after superovulation stimulation protocol.

[0036] 2. Experimental Methods

[0037] 1. Extraction and culture of primary human granulosa cells

[0038] (1) Extraction of GC: FF was centrifuged at 1500 rpm for 10 minutes, and the supernatant was discarded. The precipitate was suspended in PBS (Gibco, Invitrogen Life Technologies), Ficoll (Sigma) was slowly added to the cell suspension at a ratio of 1:1, and centrifuged at 1800 rpm for 20 minutes. The middle white granular cell layer was aspirated with a Pasteur pipette, incubated with red blood cell lysis buffer (Biosharp) for 5 minutes, and washed with PBS.

[0039] (2) GC culture: The washed GCs were cultured in 6-well plates (5×10 5 cells / well).

[0040] 2. Culture and treatment of human ovarian granulosa cell carcinoma cell line (KGN cell line)

[0041] (1) KGN cells were purchased from Procell Life Science Co., Ltd. (Wuhan, China).

[0042] (2) KGN cell culture: The culture method was consistent with that of primary granulosa cells. KGN cells were cultured in 6-well plates (5×10 5 cells / well).

[0043] 3. Treatment of KGN cells: LPS and IFN-γ drug powders were prepared into drug solutions using 1×PBS. KGN cells were induced with LPS and IFN-γ and divided into control group, LPS group, IFN-γ group and LPS+IFN-γ group. Cells were treated with PBS, 1ng / μl LPS, 100ng / ml IFN-γ, and 1ng / μl LPS+100ng / ml IFN-γ for 24h. In addition, before LPS+IFN-γ co-induction of KGN cells, KGN cells were pretreated with 4-MU (50μM) for 1 hour, recorded as LPS+IFN-γ+4-MU group.

[0044] 4. Construction of PCOS mouse model

[0045] Forty 21-day-old female ICR mice were housed in an SPF animal facility in a standard environment (22-24°C and 60-70% relative humidity) with free access to food and water. The mice were randomly divided into three groups: control group, PCOS group, and PCOS+4-MU group. The control group was injected with olive oil and gavaged with normal saline every day. The PCOS group was injected with dehydroepiandrosterone (DHEA) (240 mg DHEA dissolved in 1 ml olive oil, 40 μl / mouse / day) and gavaged with normal saline every day.

[0046] The PCOS+4-MU group was injected with DHEA and intraperitoneally with 4-MU (dissolved in saline, 150 μL / mouse / day). During the treatment period, all animals were weighed once a day, and vaginal smears were collected daily from the 10th day of the first DHEA injection until the end of the experiment. Mice were killed 21 days after the first injection. Blood was collected and centrifuged after an overnight fast, and serum samples were collected and stored at -80°C for further analysis. One ovary was dissected for PCR or western blot analysis, while the other ovary was fixed in 10% paraformaldehyde solution for sectioning, staining, and other experiments. All protocols and experiments were approved by the Animal Care and Use Committee of Wuhan University (Ethics Approval No.: WDRY2018-K009).

[0047] 5. Extract RNA and reverse transcribe RNA to synthesize cDNA, and perform real-time PCR to detect the expression of the target gene at the mRNA level.

[0048] Granulosa cells were extracted from the patients' follicular fluid, KGN cells were intervened with LPS+IFN-γ, and PCOS mouse models were induced by DHEA. Then, RNA was extracted from granulosa cells, KGN cells and mouse ovaries, and RNA was reverse transcribed into cDNA. Real-time PCR was used to detect the expression level of HAS2 mRNA.

[0049] Human HAS2 gene target sequence:

[0050] F: TCCTGGATCTCATTCCTCAGC (SEQ ID NO.1),

[0051] R: TGCACTGAACACACCCAAAATA (SEQ ID NO. 2).

[0052] Mouse HAS2 gene target sequence:

[0053] F: CATCTGTGGAGATGGTGAAGGTC (SEQ ID NO.3),

[0054] R: AGCCATCCAGTATCTCACGCTG (SEQ ID NO. 4).

[0055] 3. Experimental Results

[0056] The results are as follows Figure 1 As shown in (A) and (B), compared with the control group, the expression of HAS2 mRNA and protein levels in ovarian granulosa cells of PCOS patients, KGN cells treated with LPS+IFN-γ, and ovarian granulosa cells of DHEA-induced PCOS mouse model were increased.

[0057] Example 2: Increased expression of IFN-γ in PCOS ovaries can induce increased expression of HAS2

[0058] 1. Detection of IFN-γ mRNA expression level

[0059] Granulosa cells were extracted from the patients' follicular fluid, KGN cells were intervened with dehydroepiandrosterone (DHEA) (500nM, treatment for 24 hours), and PCOS mouse model was induced by DHEA. Then, RNA from granulosa cells, KGN cells and PCOS mouse ovaries was extracted, RNA was reverse transcribed to synthesize cDNA, and real-time PCR was used to detect the expression level of IFN-γ mRNA.

[0060] Human IFN-γ gene target sequence:

[0061] F: GTGGAGACCATCAAGGAAGACA, R: GCGACAGTTCAGCCATCACT.

[0062] Mouse IFN-γ gene target sequence:

[0063] F: TCAGCAACAGCAAGGCGAAA, R: CTGGTGGACCACTCGGATGA.

[0064] The results are as follows Figure 1 As shown in (C), compared with non-PCOS patients, the expression level of IFN-γ mRNA in granulosa cells of follicular fluid of PCOS patients was increased; the expression level of IFN-γ mRNA in KGN was increased after DHT treatment, and the expression level of IFN-γ mRNA in mouse ovaries was increased after DHEA treatment.

[0065] 2. RNA was extracted from the KGN cells in the control group, LPS group, IFN-γ group and LPS+IFN-γ group cultured in vitro, the RNA was reverse transcribed to synthesize cDNA, and real-time PCR was used to detect the expression levels of HAS2 mRNA and protein in the KGN cells in the control group, LPS group, IFN-γ group and LPS+IFN-γ group.

[0066] Human HAS2 gene target sequence:

[0067] F: TCCTGGATCTCATTCCTCAGC, R: TGCACTGAACACACCCAAAATA.

[0068] Mouse HAS2 gene target sequence:

[0069] F: CATCTGTGGAGATGGTGAAGGTC, R: AGCCATCCAGTATCTCACGCTG.

[0070] The results are as follows Figure 1 (D) shows that compared with the control group, the expression levels of HAS2 mRNA and protein in KGN cells in the LPS and IFN-γ groups were significantly increased, and the increase in the expression levels of HAS2 mRNA and protein in KGN cells in the LPS+IFN-γ group was more obvious. Figure 1 (D) show.

[0071] 3. Detection of HA and PGE2 levels in KGN cells in the control group, LPS group, IFN-γ group and LPS+IFN-γ group

[0072] The culture supernatant of KGN cells in the control group, LPS group, IFN-γ group and LPS+IFN-γ group was taken, and the levels of HA and PGE2 in the supernatant were detected by ELISA.

[0073] The results are as follows Figure 1 As shown in (E), compared with the control group, the levels of HA and PGE2 in the supernatant of KGN cells in the LPS group and IFN-γ group were increased, and the increase of HA and PGE2 in the supernatant of KGN cells in the LPS+IFN-γ group was more significant.

[0074] 4. Take the supernatant of primary ovarian granulosa cell culture medium, the supernatant of dihydrotestosterone (DHT)-intervened KGN cell culture medium, and DHEA mouse serum, and detect the IFN-γ level by ELISA.

[0075] The results are as follows Figure 1 As shown in (F), compared with the control group, the IFN-γ level in the supernatant of the culture medium of primary ovarian granulosa cells, the supernatant of the culture medium of DHT-treated KGN cells, and the serum of DHEA mice was increased.

[0076] Example 3: Inhibition of HAS2 can inhibit granulosa cell ovulation disorder-related indicators

[0077] 1. Use hydroxymethylcoumarin to inhibit the expression of HAS2

[0078] KGN cells were induced with LPS and IFN-γ and divided into control group, LPS group, IFN-γ group and LPS+IFN-γ group. Cells were treated with PBS, 1ng / μl LPS, 100ng / ml IFN-γ, 1ng / μl LPS+100ng / ml IFN-γ for 24h. Before LPS+IFN-γ co-induction of KGN cells, KGN cells were pretreated with hydroxymethylcoumarin (50μM) for 1 hour, recorded as LPS+IFN-γ+4-MU group.

[0079] The results are as follows Figure 2 As shown in (A) and (B), compared with KGN cells after LPS+IFN-γ intervention, the expression levels of HAS2 mRNA and protein were significantly decreased in KGN cells treated with 4-MU, and the expression level of HAS2 protein was also decreased after KGN cells were treated with 4-MU alone.

[0080] 2. Detection of HA and PGE2 levels

[0081] After LPS+IFN-γ intervention of KGN cells, 4-MU was used to extract the supernatant of KGN cell culture medium from the control group, LPS+IFN-γ group, and LPS+IFN-γ+4-MU group, and the levels of HA and PGE2 in the supernatant were detected by ELISA.

[0082] The results are as follows Figure 2 As shown in (C), the levels of HA and PGE2 in the supernatant of KGN cells in the LPS+IFN-γ group were significantly increased, while those in the LPS+IFN-γ+4-MU group were significantly decreased.

[0083] 3. Detection of related indicators of granulosa cell ovulation disorder

[0084] The mice in the control group, DHEA group, and DHEA+4-MU group underwent vaginal smears and observed their estrous cycles for 14 consecutive days.

[0085] The results are as follows Figure 4 As shown in (A), compared with the control group, the estrous cycle of PCOS mice was disrupted, while after PCOS mice were treated with 4-MU, the estrous cycle of the mice returned to normal.

[0086] The ovaries of the mice in the control group, DHEA group, and DHEA+4-MU group were stained with HE. The results showed that the ovaries of PCOS mice showed polycystic changes. After the PCOS mice were treated with 4-MU, the polycystic changes in the ovaries of the mice disappeared. Figure 4 (B) shown.

[0087] Ovarian sections of mice in the control group, DHEA group, and DHEA+4-MU group were taken, and the follicles of all levels in the ovarian sections were counted. The results showed that compared with the control group, the number of antral follicles and atretic follicles in PCOS mice increased, and the number of corpora lutea decreased. After PCOS mice were treated with 4-MU, the number of antral follicles and atretic follicles in PCOS mice decreased significantly, and the number of corpora lutea increased significantly. Figure 4 (C) shown.

[0088] Ovarian sections of mice in the control group, DHEA group, and DHEA+4-MU group were taken for immunohistochemistry. Figure 4 (D) The expression of HAS2 at the mRNA and protein levels in ovarian granulosa cells of DHEA-induced PCOS mouse model and DHEA and 4-MU-induced PCOS mouse model. Figure 4 (E) As shown. The serum of mice in the control group, DHEA group, and DHEA+4-MU group was collected, and the levels of HA and PGE2 in the serum were detected by ELISA. The results showed that the levels of HA and PGE2 in the serum of mice in the DHEA group increased, while the levels of HA and PGE2 in the serum of mice in the DHEA+4-MU group decreased significantly. Figure 4 (F) shown.

[0089] 4. Mouse modeling and superovulation experiments

[0090] Mice were superovulated by intraperitoneal injection of PMSG (5 IU / mouse) and 48 hours later by intraperitoneal injection of HCG (5 IU / mouse). 16 h after HCG injection, cumulus-oocyte complexes (COCs) were collected from the oviduct. Oocytes were released from the cumulus cells by digestion with 0.1% hyaluronidase (Vitrolife, Frolunda, Sweden) for 5 min. Oocytes reaching the MII stage were recorded and photographed under a microscope. Figure 5 As shown in (A), the mature oocyte rate was calculated simultaneously.

[0091] The results showed that compared with the control group, the number of oocytes and the rate of mature oocytes in PCOS mice were significantly reduced, while after PCOS mice were treated with 4-MU, the number of oocytes and the rate of mature oocytes in PCOS mice were increased. Figure 5 As shown in (B) and (C).

[0092] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0093] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0094] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. The use of HAS2 as a target in screening drugs for alleviating and / or treating ovulation disorders in polycystic ovary syndrome, characterized in that: The screening method includes screening substances that can inhibit the expression of HAS2 gene.

2. Application of HAS2 expression inhibitor in the preparation of drugs for treating ovulation disorders caused by polycystic ovary syndrome.

3. The use according to claim 2, characterized in that: The HAS2 expression inhibitor comprises at least one of the following components: HAS2 inhibitors; Knockout reagent for HAS2.

4. The use according to claim 3, characterized in that: The HAS2 inhibitor includes a protein that specifically binds to HAS2, a small interfering molecule that specifically interferes with the expression and processing of the HAS2 gene, or a recombinant vector containing the small interfering molecule that specifically interferes with the expression and processing of the HAS2 gene.

5. The use according to claim 3, characterized in that: The HAS2 inhibitors include hydroxymethylcoumarin.

6. The use according to claim 2, characterized in that: The drug for treating ovulation disorder caused by polycystic ovary syndrome is a drug that reverses polycystic changes in the ovaries, reduces the number of antral follicles and atretic follicles, and increases the number of corpora lutea, the number of oocytes and the rate of mature oocytes.

7. A drug for treating ovulation disorders in polycystic ovary syndrome, characterized in that: The drug includes at least one of a HAS2 inhibitor and a HAS2 knockout agent.

8. Application of HAS2 as a molecular marker in the preparation of diagnostic and / or prognostic products for polycystic ovary syndrome ovulatory disorders.

9. Application of HAS2 detection reagent in the preparation of diagnostic and / or prognostic products for polycystic ovary syndrome ovulation disorder drugs.

10. The use according to claim 9, characterized in that: The HAS2 detection reagent includes a HAS2 detection primer or an immunohistochemical detection reagent.

Images