Disease-resistant grass carp sex molecular marker as well as development method and application thereof

Abstract

The invention discloses a molecular marker for genetic sex of disease-resistant grass carp, the DNA sequence of the molecular marker is shown as NO: 1, and the invention provides two pairs of primers for identifying male and female genetic sex: the primer pair 1 is as follows: a forward primer 1 is GCATACGCACAGTAGGTGAG; the reverse primer 1 is GAAACACAAGATGGTGCCAAATA, and the reverse primer 2 is The primer pair 2 is as follows: a forward primer 2 is TCAGTGACTGGGAGACTTGGATA, and a reverse primer 2 is And the reverse primer 2 is AATTTTCCTCTGAGCTTCACACACCC. Compared with the prior art, the method has the advantages that 1, the method for screening the male specific fragment is simple to operate and widely applicable; 2, an efficient technical approach is provided for unisexual breeding of disease-resistant grass carps; 3, all-female disease-resistant grass carp groups with various excellent characters can be prepared, and the culture benefits can be remarkably improved.

Description

Technical Field

[0001] The invention relates to the technical field of disease-resistant grass carp sex molecular markers, and in particular to a disease-resistant grass carp sex molecular marker and a development method and application thereof. Background Art

[0002] Grass carp belongs to the genus Grass Carp of the family Cyprinidae in the order Cypriniformes. It is one of the four important freshwater farmed fish in China. Grass carp is mainly distributed in the Yangtze River, Pearl River and Heilongjiang River systems in China. In 2020, China's annual grass carp production was 5.5711 million tons. Due to various reasons such as the degradation of grass carp germplasm and weak disease resistance, the germplasm resources of grass carp are seriously threatened. Therefore, the team of Academician Liu Shaojun of the State Key Laboratory of Freshwater Fish Developmental Biology, jointly established by the province and the ministry of Hunan Normal University, has developed disease-resistant grass carp with fast growth and strong disease resistance using gynogenetic technology. Disease-resistant grass carp is produced by inducing gynogenetic offspring produced by female grass carp with inactivated sperm of male koi, and then backcrossing with male grass carp. The cultivation of disease-resistant grass carp can provide strong support for the sustainable development of the aquaculture industry by improving breeding efficiency and reducing drug dependence.

[0003] Sex molecular markers are effective tools for distinguishing the genetic sex of fish based on the identification of sex-determining regions in the whole genome. Sex determination is a relatively conservative trait, but the sex determination mechanism of fish is very diverse compared to that of mammals and birds, including genetic determination and environmental regulation. Some hermaphroditic fish, such as bluehead carp and clownfish, can undergo bidirectional sex changes during their life cycle, but the sex of carp is determined by genetics and the influence of environmental factors is limited. Therefore, the development of sex molecular markers for disease-resistant grass carp can stably and efficiently distinguish its genetic sex.

[0004] Controlling the sex ratio of fish is very important in the aquaculture industry. In some fish, such as the yellow catfish, the male and female dimorphism is significant. Single-sex group culture can improve the breeding efficiency and control the reproduction rate. Most fish grow faster before sexual maturity. Since male grass carp mature earlier than female grass carp, male grass carp individuals are usually smaller than female grass carp. Therefore, the use of sex molecular markers combined with breeding technology can produce all-female disease-resistant grass carp groups with multiple excellent traits, which can significantly improve the benefits of aquaculture. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a disease-resistant grass carp sex molecular marker and a development method and application thereof in view of the deficiencies raised in the above-mentioned background technology.

[0006] In order to solve the above technical problems, the technical solution provided by the present invention is: a molecular marker for the genetic sex of disease-resistant grass carp, whose DNA sequence is shown in NO: 1, and the present invention provides two pairs of primers for identifying the genetic sex of male and female:

[0007] Primer pair 1 is:

[0008] Forward primer 1: GCATACGGACAGTACAGGTGAAG;

[0009] Reverse primer 1: GAAACACAAGATGGTGCCAAATA;

[0010] Primer pair 2 is:

[0011] Forward primer 2: TCAGTGACTGGGAGACTTGGATA;

[0012] Reverse Primer 2: AATTTTCCTTGAGCTTCACACC.

[0013] A method for developing a molecular marker for the genetic sex of disease-resistant grass carp. The specific steps for developing the molecular marker for the genetic sex of disease-resistant grass carp are as follows:

[0014] Step 1: Determine the sex of 2-year-old disease-resistant grass carp by measuring the length of the pectoral fin and the results of gonadal section, select 5 healthy male and female individuals with normal appearance, cut the tail fin and store them in a 1.5 ml EP tube filled with 95% ethanol;

[0015] Step 2: Use Ezup Column Animal Genomic DNA Purification Kit (SangonBiotech NO.B518251, China) to extract genomic DNA according to the manufacturer's instructions;

[0016] Step 3: The concentration of genomic DNA was detected using a NanoDrop ND2000 spectrophotometer (Thermo Scientific, Wilmington, DE), and the genomic DNA was stored at −80°C for subsequent Illumina whole genome resequencing;

[0017] Step 4: After obtaining the whole genome resequencing reads, the male-specific fragments were identified through bioinformatics analysis, including: using BWA mem 0.7.18 (r1243) to align the male and female resequencing reads with the male grass carp reference genome [GCA_029834665.1] to generate bam files, using Samtools 1.18 to sort, merge, filter, and remove duplicates of the bam files in sequence, and then using PSASS 3.1.0 to generate a stacked file from the deduplicated bam files, and calculating the total sequencing depth of males and females with a 1kb sliding window. By screening the male fragment sequencing depth greater than more than half of the total sequencing depth and the female fragment sequencing depth less than 5, the Y-linked specific fragments were determined, and male-specific primers were designed based on the Y-linked specific fragments.

[0018] Step 5. Two pairs of male-specific primers were screened out, which had 353 and 463 bp bands in male disease-resistant grass carp, but no bands in females. The universality of the sex molecular marker was verified in two populations.

[0019] An application of a molecular marker for genetic sex of disease-resistant grass carp, the specific steps are as follows:

[0020] Step 1: Select large, healthy and disease-free individuals from the disease-resistant grass carp pond;

[0021] Step 2: Screening out female disease-resistant grass carp through the constructed sex molecular markers;

[0022] Step 3, then artificial insemination is performed with the sex-reversed pseudo-male disease-resistant grass carp (XX);

[0023] Step 4: Prepare an all-female disease-resistant grass carp population with strong disease resistance.

[0024] After adopting the above method and application, the present invention has the following advantages: 1. The present invention uses bioinformatics methods to statistically analyze the differences in sequencing depth between male and female individuals, and can quickly screen male-specific Y-linked specific fragments. The method for screening male-specific fragments is simple to operate and widely applicable.

[0025] 2. The sex molecular marker of the present invention is dominant in male disease-resistant grass carp. The male-specific primers designed based on the molecular marker can stably and efficiently identify the genetic sex of disease-resistant grass carp. It can also identify the sex in a gynogenetic disease-resistant grass carp population. If it is an all-female population, it further confirms that the disease-resistant grass carp is female isogametic (XX), providing an efficient technical approach for the unisexual breeding of disease-resistant grass carp.

[0026] 3. The sex molecular marker of the present invention can identify the genetic sex of disease-resistant grass carp. Combined with disease resistance screening and sex reversal technology, an all-female disease-resistant grass carp population with multiple excellent traits can be prepared, which can significantly improve breeding efficiency and is of great significance in the aquaculture industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a schematic diagram of molecular markers for the genetic sex of disease-resistant grass carp.

[0028] Figure 2 This is a schematic diagram of molecular markers for the genetic sex of disease-resistant grass carp. DETAILED DESCRIPTION

[0029] The present invention is further described in detail below in conjunction with the accompanying drawings.

[0030] Combined with Figure 1-2, identify all-female disease-resistant grass carp and improve breeding efficiency, and provide a gender molecular marker for disease-resistant grass carp. The present invention uses whole genome resequencing technology to identify male-specific DNA fragments of disease-resistant grass carp through genome-wide association analysis (GWAS). Sex-specific primers designed based on male-specific fragments and PCR based on sex-specific primers can effectively distinguish the genetic sex of disease-resistant grass carp. This molecular marker has universality among populations.

[0031] In order to solve the above technical problems, the technical solution proposed by the present invention is:

[0032] The invention provides a molecular marker for genetic sex of disease-resistant grass carp, and its DNA sequence is shown as NO:1.

[0033] The present invention provides two pairs of primers for identifying the genetic sex of males and females:

[0034] Primer pair 1 is:

[0035] Forward primer 1: GCATACGGACAGTACAGGTGAAG;

[0036] Reverse primer 1: GAAACACAAGATGGTGCCAAATA;

[0037] Primer pair 2 is:

[0038] Forward primer 2: TCAGTGACTGGGAGACTTGGATA;

[0039] Reverse Primer 2: AATTTTCCTTGAGCTTCACACC.

[0040] The above sex-specific primers were amplified by PCR and subjected to nucleic acid electrophoresis. The results showed that there were specific bands in males and no bands in females. The specific steps for developing sex molecular markers for disease-resistant grass carp are as follows:

[0041] Step 1: Determine the sex of 2-year-old disease-resistant grass carp by measuring the length of the pectoral fin and the results of gonadal section, select 5 healthy male and female individuals with normal appearance, cut the tail fin and store them in a 1.5 ml EP tube filled with 95% ethanol;

[0042] Step 2: Use Ezup Column Animal Genomic DNA Purification Kit (SangonBiotech NO.B518251, China) to extract genomic DNA according to the manufacturer's instructions;

[0043] Step 3: The concentration of genomic DNA was detected using a NanoDrop ND2000 spectrophotometer (Thermo Scientific, Wilmington, DE), and the genomic DNA was stored at −80°C for subsequent Illumina whole-genome resequencing;

[0044] Step 4: After obtaining the whole genome resequencing reads, the male-specific fragments were identified through bioinformatics analysis, including: using BWA mem 0.7.18 (r1243) to align the male and female resequencing reads with the male grass carp reference genome [GCA_029834665.1] to generate bam files, using Samtools 1.18 to sort, merge, filter, and remove duplicates of the bam files, and then using PSASS 3.1.0 to generate a stacked file from the deduplicated bam files, and calculating the total sequencing depth of males and females with a 1kb sliding window. By screening the male fragment sequencing depth greater than half of the total sequencing depth and the female fragment sequencing depth less than 5, the Y-linked specific fragments were determined, and male-specific primers were designed based on the Y-linked specific fragments;

[0045] Step 5. Two pairs of male-specific primers were screened out, which had 353 and 463 bp bands in male disease-resistant grass carp, but no bands in females. The universality of the sex molecular marker was verified in two populations.

[0046] The present invention provides an application of a sex molecular marker in preparing a disease-resistant grass carp population with multiple excellent traits. The specific steps are as follows:

[0047] Step 1: Select large, healthy and disease-free individuals from the disease-resistant grass carp pond;

[0048] Step 2: Screening out female disease-resistant grass carp through the constructed sex molecular markers;

[0049] Step 3: then artificially inseminating with the sex-reversed pseudo-male disease-resistant grass carp (XX);

[0050] Step 4: Prepare an all-female disease-resistant grass carp population with strong disease resistance.

[0051] The male-specific DNA sequence of disease-resistant grass carp is as follows:

[0052] DNA sequence length: 7052bp

[0053] AACAATTTTTAACAGCATGGGATTGTAAATAACACAATTTAAGTAAAAGTCAGTGAC

[0054] TGGGAGACTTGGATATTTTATTGAAAATCATGTACATTTGAAAAACAGCCACAGGTAAAT

[0055] TTCCAATCCAACATGGTTCTTACCTGGAGACTGTTGTGCAGAAAATGGCACAAGCATATT

[0056] AACAGAAGTATGTGGTCGTCAAAATTGCCATATCTGTAGCACTGTTTGATATACACTGAA

[0057] ATTCCTGCCAAAAGCAAGTAAAGGGGTTACAGTTTTTCTGTCACTGCTAAACTGTACAA

[0058] CCCTACTAAAATGAGTACATGAAGATATTAATAAGCCTACAAATGGAAAGGAAGACCCT

[0059] GATAATCATGGCCATCAAATGTTGAATTAATGACAAATTTAAAGAAACACAACAAACCGT

[0060] CAGGTTTTTGGCTGTTGAAGTGATGATCAAGGATTCAGTTAGTGGAGTTACCACTGAAC

[0061] TCAAAGGCTTCAGATGGTGTGAAGCTCAGAGGAAAATTATAGTGTTTCACACATCTGAG

[0062] GGGAAGACCGCAAGTAGTTTCTTTTTAACATAGATGTACCTAACCATCCGAGACAGATTC

[0063] TGGCCTTCGTGGTACTAGGCACCTTCCTCTTCCTCAAAACCTTCCACATCAATGGAAAAT

[0064] GTGTAATTCTCTCTGGTTTTCTGGAAGAGTGCCCTGTCCACTTCAAATAAGTGCCACTTT

[0065] GCAACATTTTTATTGTTTAAAGGGGTGATTATGATTTGACTTTTTTAACTTTTAGTTAGTGT

[0066] GTAATGTTGCTGTTTGAACATAAACAACATCTGCAAAGTTACAACGCTCAAAGTTCAATG

[0067] CAAAAAGAGATATTTTCTTTTACAGAATTCTGTTTAAGGACTACAACAAACGGCTGGTAG

[0068] GGACTACAACAAGCTTCTTCCTGGGTTAGTGACATCACTAAAGCTCTGGGTATATTTCGG

[0069] CTGTCCGCGTTTGTGCACTGTCCGCATGACGTAATTTTCCCATCCGCATGCATCCCAACTT

[0070] TCGAGACCGTGCGTACGGATGCGCGGGCGCGATTGCGCGCGAGATGTGTCCGGGCACG

[0071] GAAAGTGACGTATACCCGGGGCTTAACCCTAAAATTTACATAAACCCCATGTTGGGCTGC

[0072] TTTAGAGAGAGAGAAAGAGTTGTTGTAGAGTGATGTTGTCATTTTACCACAACCTGTAAGT

[0073] ATGTTTTATTCATTGTTAATGTGTTTTCCATTGATAGTTTCTATAGTTATTTTTTATGTTGTA

[0074] GAAAAGACGTAAACAAAGGGCAATGGCTCCACTATCCAGTTACCTAAATGCTAATTAAA

[0075] ACTTATCTGACAAACACCTACAAACTGTAGTCTGCAGTCTGTAATCAAATAATCCCTTCA

[0076] AGGAATGTAGTATCATTTGTTAGAACAATTATATGAAATGCATGGATATATTTTGCATGTAT

[0077] GAAGCTTTGTTTCCATGGTCTTCTGATTAATATCCAGTAATTCAGTTTTTTTTTTTTTTTTT

[0078] GTAAAAATAGTCCAAGATTAAACTATGTTCCGTTAATAGACAAGCACTGTTGTTACTGCT

[0079] ATAAAATTGCAATGTTATATAATGCAATCATGTATTATGCTGTAATAAAGCTTATTAAGGAT

[0080] AAAACCGTATATTAAAACTTAACATAAACAGCAGCAGTATTTACAAATAACAGTATCTAA

[0081] AAAATATGATACAACTACAAACAAAAAAACATACCAATTTGAGAGATCCTGTAAGAGTC

[0082] GTGCTTGCACAGGTTCTGCTCGATCCTTTTCAATATTCTCTGGGTCTGAATCGAGCTCAA

[0083] ATTGATAAGGCAATATTGACGCCATTGTTTACAATACACCGGAGCACATAACTGTAATGAT

[0084] AAGGGTTGTGAAGTTATGGGAGCTTCACAACACATAGCCAATCAACCAATCTGAGCCC

[0085] TTTGTGTATTTCTGAGGGAGGGGCTTATAGAGGCACACATATCTTCAGGTCAGGACTGTA

[0086] ATAAAACATGTGAAGTTTGAGGCAGATCAGACATTGTATGCCCGAGTTACAACAACTTC

[0087] CTTTTCCTGGTGAAACATCAGACTTGGTTCAGGCTGCCACAGACACGTCCTTCAGTGAA

[0088] AACTCAAGATCTACTCAATTTAATGTCGCAAACCTTTAAATTAGACTGACCAAATATGAC

[0089] ATTGATCTGATTAAAGCTCTAGGAGGAGTTCGTTAAAGTACAACGCATGGAAATGGCAA

[0090] AAACTGCACAAAATTTTGCAGAGAAAATTAAAATATCTCATTTCCTGTTGGGTTTTAAAT

[0091] TTTGCACCCAGGGGCTTTTTCGTAGGTATTGGGCTGCTACATGTGTGTACTGAATTTCATA

[0092] CTTGTATGTGAAAGGTAGAGCGAGTGGCGCTTTATTGAAATTTTGTAGGTGGTGCGTGTG

[0093] CAAAGTTTCATGAGTTTGAGTATATTTATGCTTCAGAAATGAGAGAAGAATTGACCGAAC

[0094] AATAACAATAGGGTCCTCACACCATCAGTGCTTGGGCTCTAAGTTTTTACGTTAACAAAC

[0095] ATTTCATGATTACAGGAGTCATATGAATGATACTTTTATGGTGCTTTTGTGTCCTTTTTAAA

[0096] GCATATTCACAATGCTTTGTGTTCCAGAGAGAAAGAAGGTCATACAGGTTTGGAACAACAT

[0097] GAAGCTTATTGAAACATTTGTTTGTTTTTCATTGCCTGCTTCATTCTCTCTCTCTCTCTCTCTC

[0098] CTCTCTCTCTCTCTCTCTCTCTGTGTGTGTGTGTGTGTCAGATGTGAACGAGTGTTCAGA

[0099] GGAACTAAATACTAAATGCCTTGTGAAAGGGACTGCAATGGTCTGGAATGCTTGATTCTG

[0100] ATTGTGTGACAGAGGGTGTTTATAAGTTGTTTGCACATTGCTGTGGTGCGAAATGCGGCTG

[0101] GAGGGCAGGGAGTGATTTTTCTGAATCGCTATTCACAAACTCAAAATTCCTATGTTTTGCG

[0102] TTGTTTATGGTTGCTCAGTAGAATTCCGTTTACAATGTTGATCTGGTTACTGTGAGAACA

[0103] GTGTCACGCTCTGTTGCTTCAGCCATCATGTGGTTGAAAATGTCCAAATAAAAAAGTGTT

[0104] CAACAAGTTGACAGAAGTCGATCCATTTTTTTTTTTTTTTTTGTTGGAAGGGTGTAAATG

[0105] TAACTGTAGTTTTAATGTTGTCTTTGTAAATATTCACTTTCCCATATGGCCTCGGAGGGGC

[0106] ATTCAGCAGACAGTCACCGACGCACTGTATTTTTGTATTTCAATAAATGACAACCAAAAT

[0107] CAAACCCATAGAAGAGACTTGAAACTTTGAGGGATGGTAGTACTCATACCGCCTACAAC

[0108] ATCACCAAGGCTTGCTCCGATCGGCCTGACAGGGGCGCTACAGCGGTCAAAAGTACGA

[0109] AATAGCTCATAACTCCTGAGCCATTAGGCCCAGGCTCAAGTGTCTTATATCCTTGGAATC

[0110] CTTGGCTCAAGGCGTAATTTTCGACAGTTTTCACCCGATCAAACCCAAACCAGTACAGA

[0111] AATTTTCTTTGGCATCTGAATATCAATAATTATAAAAAAAAGTTGAAATTTTGATTCACGG

[0112] TCGCTAAGGGGCGCCAAAACGTACGATGAGGGTAGAGCCACTTTTGCTAAAAATGTCTA

[0113] TAACTCGAGAACAATTGAGATATTTGCACCAAACTCGGTACACATGTGTATGGGCTCAA

[0114] TCTTTGGTCACGATAAAATAATCATGTCGATTGGCCACTAGTTGGCGCTATAACTTGAAA

[0115] AAACATGAAAACAGCTCTAACTATGCAACCGTTAGTCCGATCGACTTGAAATTTGGCATG

[0116] CAGTGTCTTGGTCCAAGGGGGCATGATGGTCTATGAGGACATTGGTGTATCTCAAAAAA

[0117] CATGGCCGCCACTGGCCAATGAAATTTGAGCACCTCTTAGACAAGGTCAGTGGAGGCCA

[0118] ATCAGAATGAAACTGGTGGGCATGTTCGACTCATGGTCCTAGAGGTCTGTAAGAATTTTG

[0119] AAAAGAAATCGGCCACAAGTTGGTGCTAACGAGTTTTTACACCTCAGTAATCACGTGGTGT

[0120] TTCACAGGATCACAAAATATGCATATCATTTGATAGATCTCCTCATGCTGAACAACTTTGC

[0121] CTCAAGAACTAATGCTGTCAATTAAACTGTTCATTAATTATTTGAGAATATTTGAAAAACA

[0122] TACTTTTGCRAACTAGTCCTAGGTTTTTCGCCCAATCGGAACGAAACCAGTGCAGGACA

[0123] ATTCTCTGGACTCTCTAGATCAATAATTATCAACAAAAGTTGAACTTTATCATTTGAGTCG

[0124] TTATAACTGGGCCATTTAGAAAATGGGCATGGCTAAATATACCCAAAAGCCTATAAAACC

[0125] TAAACAAAAACTCAGAACTTCACGAAAATAGGTGAGCAGATGCAAGATATAAATCTAAA

[0126] GAAGCACACCAATTTTTGTGCAGATCGGACCATAGTTGGCGCTATAACTGTTAAAAAAA

[0127] ACTTTAAAAAACATAAGTTTTTAACAGTTTTGGATGAAAATGTGTGTAATTTTGTGTGTG

[0128] GTTAACTTATTTTCACGGGAGTCTTGCCAGGTTACGGCTTATGATTTGTGATACGTTGTGA

[0129] TTTAGTGCTTTAAAAACTTTTGCGAATGTCATCGAAACCGTTAGTCCGATCGAGACAAAA

[0130] CCACCGTAGGAAACACGGAACCTAAGTTGATTAATGTCAAAATTTTGATAGGAAGTGGC

[0131] AAAAAAATCCAATCAAAGATGTTCTTAAAGTTACAATATGTAATAATTTTGGTGCTAGAG

[0132] GTCAATACAAAGGCGTAGCTTGATGACGCCAAGATTTAGAGCGGAATCTTGGGACATGT

[0133] GGTCTCCATCTCAATGGTAGGTGGATAATAACAGGGATAGGACTCGGGAAGAAATCATG

[0134] CTCATGGATGCGATTATTAATGTTATTGTAGTATGAAGCAGAGCAGGACCGAGTGTTGTG

[0135] GGAGCTGAACGAGGCCGCTGGAGCGATTGCGCAACACACGCCTCAAAAGCAGCGGGA

[0136] CCTTTATTATGACACAGTCGCCGGCGCTGCTTCCGCTTTTCCGGTCATGAGTATGAGGTA

[0137] ACGTAGCTCTGTTTATCATATTAGATACATTTGAGAGTGTTGAAAATGATGTTATAACGTT

[0138] ACTCTGTGCATTCGTTCGGCGGCTGCTGTGAGACACTGTTACACACTGCAGTAAGATCTT

[0139] TAGAATATCATATTAAATGCTGGATGGCTTGAGTTGATAAATGACATGCAATTCATTTTAA

[0140] AACGTATTGTATGATGGAGAAAATGCTGTATTACTGTTACTAAAAATAAAGCTGCATCTGA

[0141] TTATGCTATGTTAACTACTTGACAAAATAGTGTTTTTCTCTGAGGCATGGTAAAGCATAGT

[0142] ACTCGCAAAAAATCAAGAAAATTAGATTTAAACAATAAGACTAAACGTGTTGAGCTATAT

[0143] AACAACAATTAGTTTTTCTGTCTATAAATATATCAAAACAGTTGTTCCCTTGTCTATTAAAC

[0144] ATGTAAATATTAAAGTGTCTTTGGTGTTTCCATGGTTTCTACAAAACAAAACCTGAACCC

[0145] AAGGGTAACGCGGGTATGACGCCATTGACAGGCGACTCCTTGCAATTTTCTCACGATTTA

[0146] CAAATAGTTGGAAACATTTGGGTACTCAAGTGAACAAAATATATAACACTGGCCTAGTGG

[0147] GTTTTTTTTAAATATTTTACTGCAGAAATATTACATATTGCACCTTTAAGTCGTTTTTTTTA

[0148] AATGTACGTCAATGAGCTAGAACTTTAAGTGACATATCAACAAACCTCATAAAACAGTTT

[0149] GGAACACATTAGGGTGATTAAATGATGACATAATTTGAATATTTTTTAATCTTTTCTCTTA

[0150] CTCCCATTCTGAACCAGCTGCAGTTACACAGGAAAATGTACTTTTAGATATAATTGCAC

[0151] TGATTTGTCAAAGGGCCTTGGTCTCTTGATAATTGAAGCAAAAACACTGAATTATCTCTT

[0152] TATGGGACAATCTAAATGTTTATGTCTGGTTGGCACACATTAAGAGAAGATTCTGGGAAG

[0153] AGAAAAGGGAGTAGAACACCTGCACCCCCCCCCCCCCATCTCTCTCACCCTCCCTCACTT

[0154] CAAATCTGAGCTAGTACAGTGAAACTAACCACGGTCGACCCATCTTCAATGTTTCATCTA

[0155] AAAATCATTTTGCATAAAGTCTGGAGAAGTTTGACAATTAATGAGTTATCAGAGGATCAA

[0156] ATAAACATCTGTGGTGAAGTCAATGATGGACGATAAAGAGCTAAAGAAGAAGAAGAA

[0157] AAGGCAGCAATGGAACGTTTCTGTGTTTTTTAGATCTTTTTTATTTAATTTGATAATTATAT

[0158] GATCATGAAGGATTCATGTTGTTTTCATTAATATTTTATATCAGGGATTCCCTATCCTGCTC

[0159] CTGGAGATCTATCTTCCTGCAGAGCATATCAACCCTGATATTTCATATACTGCTGGTCATG

[0160] AAACACTGTGCTTTTTCCATGTGAGTTGGTTAACTCCAAATTAACATACAATGTTCAAAA

[0161] AATTCCTCAGTCTTCATATTCTGCCATGTCTCATCAGTTGTATCGGTCAGCAGTTTGGAT

[0162] GGATGCATACGGACAGTACAGGTGAAGGAATAAAATCAGTCAATTCATAAAATAAACAC

[0163] AATCTAATGTGATTCTTAATTCATTGTCATGTAAAACATCTGGGATCTGAACACAAGTTTC

[0164] TCCATGACTTCACGTTAAGGGTCTTTATATTCCACACTATTTATAAAGTATCAAAGTACAG

[0165] AGGAAATCCATTAGATAATACAGCGTTCAGAGGTCAAATACTTCTGAATAATGACAATAA

[0166] CTGCATCTGTACAATAGACTGCTGCAACTTTCAGCTCTCTTGAATTATTCTGTGGTCTCAC

[0167] TCTCACTTTACACAAACACAAGTTAGGAAAAATATTTGGCACCATCTTGTGTTTCAGACT

[0168] AGCAGTTACAGAGGTTGCAGAGCTAATGATGTGATACTTCAATAAGCAAATTATTACTGT

[0169] AATCAAAAATATGCAATGCTTTATTAAACAGTTTTATATGTTACATGCAGTTACTATAGTAT

[0170] TAATTATACATTATGCATAATTGTA

[0171] The present invention and its implementation methods are described above, and such description is not restrictive, and the actual structure is not limited thereto. In short, if a person skilled in the art is inspired by it, and does not deviate from the purpose of the invention, and does not creatively design a structure and implementation method similar to the technical solution, they should all fall within the protection scope of the present invention.

Claims

1. A molecular marker for genetic sex of disease-resistant grass carp, characterized in that: Its DNA sequence is shown in NO:

1. The present invention provides two pairs of primers for identifying the genetic sex of male and female: Primer pair 1 is: Forward primer 1: GCATACGGACAGTACAGGTGAAG; Reverse primer 1: GAAACACAAGATGGTGCCAAATA; Primer pair 2 is: Forward primer 2: TCAGTGACTGGGAGACTTGGATA; Reverse Primer 2: AATTTTCCTTGAGCTTCACACC.

2. The method for developing a molecular marker for genetic sex of disease-resistant grass carp according to claim 1, characterized in that: The specific steps for developing molecular markers for sex of disease-resistant grass carp are as follows: Step 1: Determine the sex of 2-year-old disease-resistant grass carp by measuring the length of the pectoral fin and the results of gonadal section, select 5 healthy male and female individuals with normal appearance, cut the tail fin and store them in a 1.5 ml EP tube filled with 95% ethanol; Step 2: Use Ezup Column Animal Genomic DNA Purification Kit (Sangon Biotech NO. B518251, China) to extract genomic DNA according to the manufacturer's instructions; Step 3: The concentration of genomic DNA was detected using a NanoDrop ND2000 spectrophotometer (Thermo Scientific, Wilmington, DE), and the genomic DNA was stored at −80°C for subsequent Illumina whole genome resequencing; Step 4: After obtaining the whole genome resequencing reads, the male-specific fragments were identified through bioinformatics analysis, including: using BWA mem 0.7.18 (r1243) to align the male and female resequencing reads with the male grass carp reference genome [GCA_029834665.1] to generate bam files, using Samtools 1.18 to sort, merge, filter, and remove duplicates of the bam files in turn, and then using PSASS 3.1.0 to generate a stacked file from the deduplicated bam files, and calculating the total sequencing depth of males and females with a 1kb sliding window; by screening the male fragment sequencing depth greater than half of the total sequencing depth and the female fragment sequencing depth less than 5, the Y-linked specific fragments were determined, and male-specific primers were designed based on the Y-linked specific fragments; Step 5. Two pairs of male-specific primers were screened out, which had 353 and 463 bp bands in male disease-resistant grass carp, but no bands in females. The universality of the sex molecular marker was verified in two populations.

3. The use of a molecular marker for genetic sex of disease-resistant grass carp according to claim 1, characterized in that: The specific steps are as follows: Step 1: Select large, healthy and disease-free individuals from the disease-resistant grass carp pond; Step 2: Screening out female disease-resistant grass carp through the constructed sex molecular markers; Step 3, then artificial insemination is performed with the sex-reversed pseudo-male disease-resistant grass carp (XX); Step 4: Prepare an all-female disease-resistant grass carp population with strong disease resistance.

Images