The role of LRRC46 gene in the regulation of bovine antral follicle number and its application

By detecting the expression of LRRC46 gene in the blood of cattle and screening donor cattle with high number of annesphalotype follicles, the problems of low efficiency and high cost of screening number of annesphalotype follicles in the prior art were solved, and the improvement of OPU efficiency and cost reduction were achieved.

CN119932208BActive Publication Date: 2025-08-29YANBIAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510429572.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-08
Publication Date
2025-08-29
Estimated Expiration
2045-04-08

AI Technical Summary

Technical Problem

The prior art cannot efficiently screen donor cattle with large number of sinusoid follicles, resulting in low efficiency and high cost of OPU and inability to achieve early predictions.

Method used

By detecting the expression of the LRRC46 gene, the expression level of the LRRC46 gene in the blood of cattle was detected by qPCR technology, and donor cattle with high antennium follicles were screened.

Benefits of technology

Early prediction of the number of sinusoid follicles is achieved, OPU efficiency is improved, cost is reduced, and the method is simple and easy to operate, non-invasive or minimally invasive.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119932208B_ABST
    Figure CN119932208B_ABST
Patent Text Reader

Abstract

The present invention discloses LRRC46 The invention discloses the role of genes in regulating the number of bovine antral follicles and their application, which belongs to the technical field of bovine in vitro embryo production. LRRC46 The gene plays a role in regulating the number of antral follicles in cattle. The expression level of the gene is significantly different between cattle with high antral follicle numbers and cattle with low antral follicle numbers. LRRC46 Gene is positively correlated with the number of bovine antral follicles; LRRC46 The gene expression level can realize the early prediction of the number of bovine antral follicles. The method is simple and easy to operate, low-cost, non-invasive or minimally invasive, and is of great significance for improving OPU efficiency and reducing costs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of bovine in vitro embryo production, in particular to LRRC46 The role of genes in the regulation of bovine antral follicle number and its application. Background Art

[0002] In vitro produced embryo production (IVP) in cattle is a technology that uses artificially controlled conditions to allow bovine eggs and sperm to combine and develop into embryos outside the body. Through embryo screening and transplantation, high-quality genetic embryos can be selected for transplantation, further improving the genetic quality of the offspring. It is a key tool for genetic improvement and efficient breeding in cattle. It can produce large quantities of high-quality embryos in a relatively short period of time, accelerating the process of breed improvement and selection. Combined with sex control techniques, it can significantly increase the proportion of offspring from high-quality cows and achieve large-scale production of embryos with controllable traits. Furthermore, through in vitro fertilization and embryo culture, the reproductive process can be controlled under laboratory conditions, improving reproductive efficiency and success rates.

[0003] Bovine in vitro embryo production specifically includes the following steps:

[0004] 1) Oocytes are collected; 2) Oocytes are cultured in a culture medium with specific ingredients until they mature; 3) Frozen semen is thawed and, after a series of treatments, high-quality sperm is selected; 4) The obtained high-quality sperm is co-incubated with oocytes in a specific culture medium to complete in vitro fertilization; 5) High-quality embryos are selected and transplanted into the uterus of the recipient cow to achieve pregnancy.

[0005] Currently, there are three main ways to collect oocytes: 1) Slaughterhouse ovary collection method, in which ovaries are removed from the body of slaughtered cows, washed with saline, and transported to the laboratory in a warm state. Follicles with a diameter of 3 to 10 mm on the surface of the ovaries are then aspirated using a syringe or vacuum pump; 2) In vivo oocyte collection (OPU) technology, in which the ovarian follicles are punctured through the vaginal wall with the help of an ultrasound detector or laparoscopy, and the follicular fluid is aspirated using an egg collection needle to separate the oocytes; 3) Superovulation fallopian tube flushing method, in which gonadotropins are injected to induce the cow to release more eggs. At a specific time after ovulation, the fallopian tubes are flushed surgically or non-surgically to collect the eggs.

[0006] Ovarian collection from slaughterhouses is low-cost, but it's difficult to select high-quality donors. Oviduct flushing after superovulation is complex and expensive, making it less commonly used. The OPU method not only provides oocytes significantly superior to those from slaughterhouses, but also allows for continuous oocyte collection from cows that respond poorly to superovulation, pregnant cows, older cows, and calves under breeding age (7-10 months), shortening the generation interval by more than a year.

[0007] Antral follicles are the primary target of OPU. Antral follicles represent a critical stage in oocyte development before maturation, typically measuring 2 to 6 mm in diameter. However, the number of antral follicles varies significantly between individual donor cows, directly impacting OPU efficiency. Currently, screening for donor cows with a high number of antral follicles relies on ultrasound measurement of the antral follicle count (AFC), which is costly and ineffective for early prediction. Developing a non-invasive or minimally invasive method to select OPU donor cows with a high number of antral follicles is of great practical significance for improving OPU efficiency and reducing costs. Summary of the Invention

[0008] The object of the present invention is to provide LRRC46 The role of genes in regulating the number of bovine antral follicles and their application, in order to provide a gene significantly correlated with the number of bovine antral follicles, to achieve early prediction, non-invasive or minimally invasive screening of OPU donor cows with a large number of antral follicles, and contribute to improving OPU efficiency and reducing costs.

[0009] To achieve the above object, the present invention provides LRRC46 The application of the gene as a target for detecting the number of bovine antral follicles was to extract blood RNA from the tested cows, reverse transcribe it into cDNA, and use the cDNA as a template to perform qPCR with the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to detect LRRC46 The expression level of the gene, LRRC46 The higher the expression level of the gene, the more antral follicles the cows have.

[0010] Preferably, LRRC46 The CDS sequence of the gene is shown in SEQ ID NO.1.

[0011] One as described above LRRC46 Application of gene in live oocyte collection of cattle, LRRC46 Cows with high gene expression levels have greater egg donation potential than cows with low expression levels; LRRC46 The gene expression level determines the number of antral follicles in the donor cow, and then selects the donor cow with high antral follicle number; LRRC46 The upstream primer sequence of the gene expression level is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3.

[0012] A method of utilizing the above LRRC46 The method for detecting the potential of cows to donate eggs is to extract blood RNA from the cow to be tested, reverse transcribe it into cDNA using a kit, and perform qPCR with the primers shown in SEQ ID NO.2 and SEQ ID NO.3 using the cDNA as a template to detect LRRC46 The expression level of the gene, the higher the expression level, the better the egg donation potential of the tested cow.

[0013] Preferably, the qPCR system is: 10 μL of 2ʹ FastReal qPCR PreMix (SYBR Green), 0.6 μL of 10 μM forward primer, 0.6 μL of 10 μM reverse primer, 100 ng of cDNA, and 20 μL of RNase-free ddH2O.

[0014] Preferably, the qPCR program is: 95°C, 15 min; 95°C, 10 s, 55°C, 20 s, 72°C, 20 s, 40 cycles.

[0015] Therefore, the present invention provides LRRC46 The role of genes in regulating the number of bovine antral follicles and their application, and their specific technical effects are as follows:

[0016] (1) This invention is disclosed for the first time LRRC46 The gene plays a role in regulating the number of antral follicles in cattle. The expression level of the gene is significantly different between cattle with high antral follicle numbers and cattle with low antral follicle numbers. LRRC46 The gene is negatively correlated with the number of bovine antral follicles;

[0017] (2) Pass the test LRRC46 The gene expression level can realize the early prediction of the number of bovine antral follicles. The method is simple and easy to operate, low-cost, non-invasive or minimally invasive, and is of great significance for improving OPU efficiency and reducing costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0019] Figure 1 is the statistical result of the average number of follicles per egg collection of cattle in group H and group L in Example 1 of the present invention;

[0020] Figure 2 is the principal component analysis result in Example 2 of the present invention;

[0021] Figure 3 This is the heat map result in Example 2 of the present invention;

[0022] Figure 4 is the statistical result of differentially expressed genes in Example 2 of the present invention;

[0023] Figure 5 This is the volcano plot of differentially expressed genes in Example 2 of the present invention;

[0024] Figure 6 is the GO analysis result of the differentially expressed genes in Example 2 of the present invention;

[0025] Figure 7 is the KEGG analysis result of the differentially expressed genes in Example 2 of the present invention;

[0026] Figure 8 This is the significantly enriched pathway obtained by GO analysis in Example 2 of the present invention;

[0027] Figure 9 is a significantly enriched pathway obtained by KEGG analysis in Example 2 of the present invention;

[0028] Figure 10 is the gene interaction map in Example 2 of the present invention;

[0029] Figure 11 is the qPCR statistical result in Example 3 of the present invention;

[0030] Figure 12 These are the qPCR results of the three ovaries with more than 23 and less than 11 follicles in Example 4 of the present invention. DETAILED DESCRIPTION

[0031] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0032] In order to make the purpose, technical solutions and advantages of the present application clearer, more thorough and more complete, the technical solutions of the present invention are clearly and completely described below through the accompanying drawings and Examples. The following detailed description is an explanation of the embodiments and is intended to provide further details of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the application belongs.

[0033] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources.

[0034] Example 1

[0035] Bovine samples with significant differences in the number of antral follicles were obtained as follows:

[0036] Nine Yanbian yellow cattle (about 4 years old, with similar physique, healthy and non-pregnant females) were selected. Live egg collection was performed on Mondays and Thursdays of each week starting from April 2023 (live egg collection was performed twice a week) for a total of four weeks. The number of follicles in each egg collection was counted and recorded, and the average number of follicles in each egg collection for each cow was calculated. The average number of follicles in each egg collection for each of the 9 cows was added and averaged, and the average number of follicles in each egg collection for the 9 cows was 13.88. The cows with an average number of follicles per egg collection higher than 13.88 were recorded as group H, and the cows with an average number of follicles per egg collection lower than 13.88 were recorded as group L. The data of a total of 9 cows were obtained, as shown in Table 1. The statistical results of the average number of follicles per egg collection for cows in groups H and L are as follows: Figure 1 As shown, the average number of follicles per oocyte collection in the H group was 23.90±2.07 (range, 12 to 43, n=4), and the average number of follicles per oocyte collection in the L group was 11.66±1.87 (range, 4 to 21, n=5). P <0.05.

[0037] Table 1

[0038] ;

[0039] Example 2

[0040] For the bovine samples with significant differences in the number of antral follicles obtained in Example 1, mixed RNA-seq was performed to search for differentially expressed genes, as follows:

[0041] The tail vein blood of the cattle in group H and group L was drawn separately, the tail vein blood of the cattle in group H was mixed, and the tail vein blood of the cattle in group L was mixed, and then RNA-seq was performed on each of them.

[0042] Using Bos_taurus.ARS-UCD1.2.107 as the reference genome, the obtained RNA-seq data were subjected to principal component analysis (PCA), and the results showed good reproducibility between group samples, such as Figure 2 As shown, PCA1 and PCA2 explained 96.12% and 1.85% of the gene expression variation, respectively, indicating that the sample clustering was reasonable and could be used for DEGs identification.

[0043] Heatmap results ( Figure 3 ) shows that gene expression patterns are similar within groups but different between groups. This result is consistent with the principal component analysis results. Genes with higher expression levels are colored redder. Conversely, genes with lower expression levels are colored bluer.

[0044] The total differentially expressed genes were screened using DESeq2 software, and the screening criteria were set as follows: p<0.05 and |log2FoldChange|>2. A total of 280 genes were significantly differentially expressed between the low follicle group and the high follicle group ( P <0.05), among which 109 genes were up-regulated and 171 genes were down-regulated significantly. The statistical results of differentially expressed genes are as follows Figure 4 As shown, the volcano plot of differentially expressed genes is as follows Figure 5 shown.

[0045] GO analysis was performed on the differentially expressed genes obtained, such as Figure 6 As shown, differentially expressed genes were significantly enriched in multiple biological processes, molecular functions, and cellular components related to cell apoptosis and cell proliferation.

[0046] The differentially expressed genes were analyzed by KEGG. Figure 7 As shown in the results, these differentially expressed genes were significantly involved in a series of key biological pathways, such as NF-kappa B signaling pathway, Natural killer cell mediated cytotoxicity, PI3K-AKT signaling pathway, etc. These pathways are closely related to the signal transduction mechanisms of cell apoptosis and proliferation.

[0047] GO and KEGG analyses showed that differentially expressed genes were enriched in pathways related to cell apoptosis or proliferation. Figure 8 As shown in Figure 2, the significantly enriched pathways obtained by KEGG analysis are as follows Figure 9 As shown in Figure 2. The GO terms of several significant genes are as follows Figure 8 As shown, the KEGG pathway is as follows Figure 9 As shown in the gene interaction map Figure 10 shown.

[0048] LRRC46 The genes are differentially expressed genes between the high antral follicle count cow group and the low antral follicle count cow group. LRRC46 The expression level of the gene was significantly negatively correlated with the number of bovine follicles: LRRC46 The gene was significantly up-regulated in the high antral follicle number group and significantly down-regulated in the low antral follicle number group.

[0049] Example 3

[0050] qPCR and Sanger sequencing were used to investigate LRRC46 The relative expression of genes in high-antral follicle count cattle and low-antral follicle count cattle is as follows:

[0051] Obtained from NCBI LRRC46Primers were designed based on the CDS sequence of the gene (shown in SEQ ID NO.1), the upstream primer sequence was shown in SEQ ID NO.2, and the downstream primer sequence was shown in SEQ ID NO.3.

[0052] SEQ ID NO.1:

[0053] ATGCCTGGAGCTAAACTTGCCCAGAGTCCAGAGGAAATCAGTGGCGTGTGCATTACTGAAGCCCTCATCACTAGGCGGAACTTGGCCTTCCCTGAAGATGAGGATCTGTCAGAGAAGATGTTCCACACGCTTGCTGAACTGCAGACTGTTCGCCTGGACCGGGAGGGAATTACCACTATCAGGAACTTAGAGGGCCTCCAGAATCTTCACAGCCTCTATCTGCAAGGGAACAAGATTCAGAGAATTGAGAACCTGGCCTGCGTCCCCTCCTTACGCTTCCTGTCTTTGGCAGGAAACCAAATTAGGCAAGTGGAAAACCTCCGTGACCTCCCCCACCTCCAGTTTCTGGACCTTTCTGAGAACCTGATAGAAACGCTGAAGCTGGATGAATTCCCCGAGAGCCTTCTCATCCTCAACCTGACTGGAAACAGCTGCACCAACCAGGATGGCTACAGGAAGCTGTTGACAGAAGCCCTGCCACTGCTCCTAGACCTGGACGGGCAGCCTGTGGCAGAGCGCTGGACCTCGGACGAGGAGGATACAGCCTTGAGTGATGAGGATGAGGAGTTCCCAGAGCTCAGAGGCCCATTCTGCTCAGAACGAGGCTTCCTCAAGGAGCTGGAGCAGGGAATGAGCAGGCACCGGGAGCTCAGGCAGCAGACAGCCCTGCTGGAGCACCAGCTGAGGGTGGAGACTCAGCCCACCCTCACAGACCTGCCCCCGCTGCCGGGGGCGCCCATGGCTGGGGACAGCAGCCCTTCCGTCACCCCCACACAAGAGAAAGAGACAACCCCGGAGCCCGCTTCCTTGCCAGAGGCCTCCTCTACCACCAAGAGACTGTGCCCTCTGGCTCCCAGGGGCCAGCAAAGCACTATGCAGGCAAGGAAGGGGGCCAGAGCGGCCACAGCCCCCAAGGCCTCTCTGGCTGGGGCCCCCAGCACAACCAAAACTGTGACCAAAAAAATCAAGAAGTGA

[0054] SEQ ID NO.2: CAGAGGAAATCAGTGGCGTGTG

[0055] SEQ ID NO.3: AGCAAGCGTGTGGAACATCTTC

[0056] RNA from the blood serum of the two bovine donors H1 and L5 in Example 1 was extracted using the Trizol method. RNA that met the quality requirements was reverse transcribed into cDNA using a kit. The reverse-transcribed cDNA was used as a template for qPCR reactions using the system shown in Table 2. The reaction procedure was: 95°C for 15 min; 95°C for 10 s, 55°C for 20 s, and 72°C for 20 s, for 40 cycles.

[0057] Table 2

[0058] ;

[0059] The results are as follows Figure 11 As shown, two cows LRRC46 The expression levels of genes were significantly different.

[0060] Example 4

[0061] The ovaries of Yanbian yellow cattle provided by the slaughterhouse were observed using a portable B-ultrasound device. Three ovaries with more than 23 follicles (denoted as H1, H2, and H3) and three ovaries with less than 11 follicles (denoted as L1, L2, and L3) were selected. Ovarian tissue RNA was extracted using the Trizol method. RNA that met the quality requirements was reverse transcribed into cDNA using a kit. The reverse-transcribed cDNA was used as a template for qPCR reactions using the system shown in Table 2. The reaction program was as follows: 95°C for 15 min; 95°C for 10 s, 55°C for 20 s, and 72°C for 20 s, for 40 cycles.

[0062] The results are as follows Figure 12 As shown, LRRC46 The expression level of the gene in ovaries with more than 23 follicles is always greater than that in ovaries with less than 11 follicles, and the difference is significant. LRRC46 The gene plays a role in regulating the number of antral follicles in cattle. The expression level of the gene is significantly different between cattle with high antral follicle numbers and cattle with low antral follicle numbers. LRRC46 Gene is negatively correlated with the number of bovine antral follicles; LRRC46 The gene expression level can realize the early prediction of the number of bovine antral follicles. The method is simple and easy to operate, low-cost, non-invasive or minimally invasive, and is of great significance for improving OPU efficiency and reducing costs.

[0063] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. Detection LRRC46 The application of a gene reagent in screening the number of bovine antral follicles is characterized by: LRRC46 The expression level of the gene is positively correlated with the number of antral follicles in cattle; the application is in vitro embryo production in cattle; and the cattle are Yanbian yellow cattle.

2. The detection method according to claim 1 LRRC46 The application of a gene reagent in screening the number of bovine antral follicles is characterized by: LRRC46 The CDS sequence of the gene is shown in SEQ ID NO.

1.

3. A method as claimed in claim 2 LRRC46 The application of genes in live oocyte collection of cattle is characterized by: described LRRC46 Cows with high gene expression levels have greater egg donation potential than cows with low expression levels; LRRC46 The gene expression level determines the number of antral follicles in the donor cow, and then selects the donor cow with high antral follicle number; LRRC46 The upstream primer sequence of the gene expression level is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3; the cattle are Yanbian yellow cattle.

4. A method of using the method as claimed in claim 2 LRRC46 A method for genetically detecting the potential of bovine egg donors, characterized by: The blood RNA of the tested cattle was extracted and reverse transcribed into cDNA using a kit. qPCR was performed using the cDNA as a template and the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to detect LRRC46 The expression level of the gene, the higher the expression level, the better the egg donation potential of the tested cattle; the cattle are Yanbian yellow cattle.

5. A method according to claim 4 LRRC46 A method for genetically detecting the potential of bovine egg donors, characterized in that: The system for qPCR is: FastReal qPCR PreMix SYBR Green 10 μL, 10 μM forward primer 0.6 μL, 10 μM reverse primer 0.6 μL, cDNA 100 ng, and RNase-free ddH2O to 20 μL.

6. A method according to claim 4 LRRC46 A method for genetically detecting the potential of bovine egg donors, characterized in that: The qPCR program was as follows: 95°C, 15 min; 95°C, 10 s, 55°C, 20 s, 72°C, 20 s, 40 cycles.

Citation Information

Patent Citations

  • Application of homologous recombinant gene in diagnosis and treatment of fertility defects

    CN114480619A

  • Ectopic pregnancy kits and methods

    US20190390272A1