Molecular marker related to purple leaf character of lagerstroemia indica and application of molecular marker

Abstract

The invention relates to the technical field of germplasm identification of lagerstroemia indica, in particular to a molecular marker related to purple leaf characters of lagerstroemia indica and application of the molecular marker. The molecular marker is designed based on insertion / deletion of 32 bp at 789140-789171 bp on chromosome 12 of a crape myrtle reference genome, and the polymorphism of a basic group at the site can be used for early identification of purple leaf characters of crape myrtle, especially early identification of germplasm with perennial purple leaves, purple young leaves and green mature leaves. The InDel molecular marker and the primer thereof provided by the invention are high in accuracy, strong in specificity, good in stability, simple and convenient in detection, economical and efficient, can be widely applied to early accurate identification of leaf color in natural population and hybrid population of lagerstroemia indica, and provide technical support for molecular marker-assisted genetic breeding of purple leaf characters of lagerstroemia indica.

Description

Technical Field

[0001] The invention relates to the technical field of crape myrtle germplasm identification, and in particular to a molecular marker related to the purple leaf trait of crape myrtle and an application thereof. Background Art

[0002] Crape Myrtle Lagerstroemia indica L.) is a summer flowering shrub or small tree of the genus Lagerstroemia in the Lythraceae family native to Asia. Due to its excellent ornamental value and stress resistance, it has been widely introduced, cultivated and developed and utilized all over the world. It is a landscape tree species with great market prospects. Purple-leaf crape myrtle is an important germplasm resource. Compared with green-leaf crape myrtle, the leaves of purple-leaf crape myrtle are rich in anthocyanins, which have the functions of scavenging active oxygen, resisting ultraviolet damage and pathogen attacks, and can improve the plant's resistance to environmental stress. At the same time, due to the bright leaf color of purple-leaf crape myrtle, the flowers and leaves can be appreciated together, which makes up for the lack of single color of the landscape during the non-flowering period and enhances the ornamental value and commercial value of crape myrtle. Therefore, it is very necessary to continue to breed purple-leaf crape myrtle varieties.

[0003] At present, there are few studies on the purple leaf traits of crape myrtle, and there are many problems. First of all, the breeding of purple-leaf crape myrtle is still carried out by traditional artificial hybrid pollination, and the leaf color of crape myrtle is judged by visual inspection. In addition to purple-leaf crape myrtle and green-leaf crape myrtle varieties, there is also a type of crape myrtle with purple young leaves, but green adult leaves. In this type of crape myrtle, only the young leaves on the top of the adult plant are purple, while the seedlings are purple. In early identification, this type of crape myrtle often interferes with the identification results of perennial purple-leaf crape myrtle; and the purple leaf color of crape myrtle is easily affected by the external environment, that is, strong light, high temperature or low temperature, drought, lack of nitrogen nutrition, etc. This situation often interferes with breeders' evaluation of the purple leaf traits of crape myrtle.

[0004] Previous researchers found that "LiHY5-LiMYB75+LibHLH1 / 4- LiCHS / LiANS "Transcription factor cascade regulation is involved in the formation of purple leaves in Lagerstroemia indica, but LiHY5 The genotyping and leaf color trait segregation in the purple-leaf hybrid population of Lagerstroemia indica is not completely consistent, that is, it is difficult to use LiHY5 Accurately screen out the purple leaf individuals in the hybrid population. In order to quickly and accurately identify the purple leaf trait, it is urgent to establish a method for quickly and efficiently identifying the purple leaf germplasm of Lagerstroemia indica, so as to provide technical support for the selection and identification of purple leaf varieties. Summary of the invention

[0005] In order to solve the above technical problems, the present invention combined BSA with RNA-seq and targeted metabolomics analysis to discover a 32 bp deletion co-segregated with the purple leaf trait of Lagerstroemia indica. Based on this, a molecular marker (InDel) related to the purple leaf trait of Lagerstroemia indica was first provided, which was an insertion or deletion of a 32 bp sequence at 789140-789171 bp on chromosome 12 of the Lagerstroemia indica reference genome PRJCA013427.

[0006] Insertion-deletion markers (InDel) are polymorphic markers at the nucleotide level, which have the advantages of wide distribution, easy detection, low cost, high safety, etc. The molecular markers related to the purple leaf trait of Lagerstroemia indica screened by the present invention can quickly and efficiently identify the purple leaf trait of Lagerstroemia indica, which is of great significance to the identification of Lagerstroemia indica germplasm resources and molecular marker-assisted breeding.

[0007] In the specific implementation process, the crape myrtle reference genome PRJCA013427 can be downloaded from the National Genome Science Data Center (https: / / ngdc.cncb.ac.cn / ).

[0008] In a specific implementation process, the 32 bp sequence is shown in SEQ ID No. 1 (TGAGGAGGCCCTGACCGCCGCTGAGGTCCCTC).

[0009] In a specific implementation process, the molecular marker is to insert or delete the sequence shown in SEQ ID No.1 after the 62nd base of the sequence shown in SEQ ID No.2 (GAGTTCGGGGATCTAGACTGGCTAGCTGACATGGGTCTCCTTGGGGAGCAAATCACTCATCAAGCTCCCGGTTTCTCAGCCAAGCAACTTCCCTGTCCCGAATTGCCGAACCAACAAGCTCACCATCTCCTCCCAGAAGAAACAGAGGATCGAAGTCCCTGCATATGATGACGACGATGATGAGGAGCACTT).

[0010] In the specific implementation process, if the 32bp sequence is missing, it is identified as a heritable crape myrtle variety with purple leaves all year round; if the 32bp sequence is not missing, it is identified as a crape myrtle variety with purple young leaves and green mature leaves or a crape myrtle variety with green leaves all year round.

[0011] Furthermore, the present invention provides primers for amplifying the molecular marker, and the primers are shown in SEQ ID No. 3 (GAGTTCGGGGATCTAGACTGGC) and SEQ ID No. 4 (AAGTGCTCCTCATCATCGTCGT).

[0012] A detection reagent or kit containing the primers also falls within the protection scope of the present invention.

[0013] Furthermore, the present invention provides the use of the molecular marker or the primer in identifying the purple leaf trait of Lagerstroemia indica.

[0014] More specifically, the present invention provides a method for identifying the purple leaf trait of Lagerstroemia indica, comprising: using the primers to perform PCR amplification on the genomic DNA of the sample to be tested.

[0015] In the specific implementation process, the samples to be tested include heritable crape myrtle varieties with purple leaves all year round, crape myrtle varieties with purple young leaves and green mature leaves, or crape myrtle varieties with green leaves all year round.

[0016] Preferably, the heritable crape myrtle varieties with purple leaves all year round include: 'Ebony Fire', 'EbonyGlow', 'Ebony and Ivory' and purple leaf strains of hybrid offspring, etc.

[0017] Preferably, the crape myrtle varieties with purple young leaves and green mature leaves include: 'Dynamite', 'Red Rocket', 'Whit III' and the like.

[0018] Preferably, the crape myrtle varieties with perennial green leaves include: 'Arapahoe', 'Pocomoke', 'Binfen Jiaren' and green leaf strains of their hybrid offspring.

[0019] In the specific implementation process, the reaction conditions of the PCR amplification are as follows (25 μl system): 2×Rapid TaqMaster Mix 12.5 μl, 10 μM upstream primer 1 μl, 10 μM downstream primer 1 μl, DNA template 1 μl, ddH2O is supplemented to 25 μl.

[0020] In the specific implementation process, the procedure of PCR amplification is: (1) Pre-denaturation at 95°C for 3 min; (2) Denaturation at 95°C for 15 seconds; (3) Annealing at 61°C for 15 seconds; (4) 72°C extension for 30 s; (5) Repeat steps (2), (3), and (4) 35 times; (6) Extend at 72°C for 2 min.

[0021] During the specific implementation process, it also includes: using agarose gel electrophoresis to detect the amplified product. If there are bands at both 224 bp and 192 bp, or only at 192 bp, it is identified as a heritable crape myrtle variety with purple leaves all year round; if there is only a band at 224 bp, it is identified as a crape myrtle variety with purple young leaves and green mature leaves, or a crape myrtle variety with green leaves all year round.

[0022] Preferably, the agarose gel is 1% agarose gel.

[0023] In the specific implementation process, the duration of electrophoresis detection can be appropriately extended according to the situation, until the marker runs away completely and the two bands of the amplified product are completely separated.

[0024] Preferably, the kit used for extracting crape myrtle genomic DNA is a novel plant genomic DNA rapid extraction kit (DN15, Aidlab).

[0025] Preferably, the extracted Lagerstroemia genomic DNA sample is tested for purity and quality by 1% agarose gel electrophoresis and micro-ultraviolet spectrophotometer.

[0026] In addition, the present invention also provides the molecular marker, the primer, the application or the method in crape myrtle genetic breeding or crape myrtle germplasm resource analysis.

[0027] Compared with the prior art, the present invention has the following beneficial effects: (1) The method of the present invention is rapid and efficient, and can identify the purple leaf expression of crape myrtles in natural populations and hybrid populations during the young stage of crape myrtles, avoiding interference from young purple-leafed crape myrtles and the influence of leaves turning purple due to the environment.

[0028] (ii) No expensive equipment or complicated procedures are required; only common instruments such as PCR instruments are needed to identify the results.

[0029] (III) High sensitivity and small sample requirement. DNA can be extracted from a single leaf for testing results.

[0030] (IV) Good specificity: primers are designed based on the specific fragment inserted into the perennial purple-leaf crape myrtle to accurately identify whether the crape myrtle contains the specific fragment. The present invention can accurately identify perennial purple-leaf germplasm, has a high reference value for the accurate identification of crape myrtle germplasm and the development of molecular marker-assisted breeding technology, and is suitable for promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1It is a schematic diagram of the InDel molecular marker location and upstream and downstream specific primers.

[0032] Figure 2 This is the result of molecular marker identification of plants with different leaf colors in the Crape Myrtle leaf color population.

[0033] Figure 3 It is the result of molecular marker identification between different Lagerstroemia germplasms. DETAILED DESCRIPTION

[0034] To make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme in the present invention will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. In the embodiments provided in this specification, those who do not indicate specific techniques or conditions are carried out according to the techniques or conditions described in the literature in this area, or according to the product specification. Those whose reagents or instruments are not indicated by the manufacturer are all conventional products that can be purchased through regular channels.

[0035] In order to better and faster screen perennial purple-leaf crape myrtle germplasm and realize molecular marker-assisted selection breeding of crape myrtle, the green-leaf crape myrtle variety 'Arapahoe' and the purple-leaf crape myrtle variety 'Ebony Embers' were resequenced, and two leaf color mixed pools were constructed from the F1 leaf color segregating population for sequencing. Subsequently, BSA combined with RNA-seq and targeted metabolomics analysis revealed a 32 bp specific deletion at 789140-789171 bp on chromosome 12 of purple-leaf crape myrtle. This deletion was also found in purple-leaf crape myrtle varieties with perennial purple leaves, such as 'Ebony Fire', 'Ebony Glow', 'Ebony and Ivory', and the purple-leaf strains of hybrid offspring, but there was no deletion in the varieties with purple young leaves and green mature leaves ('Dynamite', 'RedRocket', 'Whit III') and perennial green-leaf varieties ('Arapahoe', 'Pocomoke', 'Pink Beauty'), as well as the green-leaf strains of hybrid offspring. We designed a pair of primers for the 32bp deletion fragment. The schematic diagram of the InDel molecular marker position and upstream and downstream specific primers is shown in Figure 1 As shown. The present invention can quickly and accurately identify whether the crape myrtle seedlings are perennial purple leaf germplasm by extracting crape myrtle DNA and using the simple technology of PCR amplification, agarose gel electrophoresis and imaging analysis using this pair of primers. This identification method is convenient, fast, efficient, accurate, and inexpensive, and is suitable for promotion. The following are more specific embodiments.

[0036] Example The crape myrtle germplasm for trial included the hybrid female parent 'Arapahoe' (M54, leaves are green all year round), the hybrid male parent 'Ebony Embers' (BD4, leaves are purple all year round), the 'Arapahoe' × 'Ebony Embers' F1 population (79 plants), 'Ebony Embers' × 32 (No. 32 in the M54 × BD hybrid population, leaves are purple all year round), hybrid offspring lines B1-B9 and B40-B42 (leaves are purple all year round) and B110-B112 (leaves are green), the varieties with purple leaves all year round 'Ebony Fire', 'Ebony Glow', 'Ebony Embers' and 'Ebony and Ivory', and the varieties with purple young leaves and green mature leaves 'Dynamite', 'Red Rocket' and 'Whit III', and the varieties with green leaves all year round, 'Arapahoe', 'Pocomoke', 'Binfen Jiaren', 'Fen Linglong', 'Fen Jingling', and 'Linglong'. The above materials are all preserved by the Crape Myrtle Research Group of Beijing Forestry University.

[0037] 1. Template DNA extraction: 0.1 g of crape myrtle leaves were ground with liquid nitrogen, and the subsequent steps were carried out according to the instructions of the new plant genomic DNA rapid extraction kit (DN15, Aidlab). The extracted DNA samples were tested for purity and quality by 1% agarose gel electrophoresis and micro-UV spectrophotometer.

[0038] 2. Preparation of PCR amplification reaction system: The PCR reaction conditions are as follows (25 μl system): 2× Rapid Taq Master Mix 12.5 μl, 10 μM upstream primer 1 μl, 10 μM downstream primer 1 μl, DNA template 1 μl, ddH2O to 25 μl. Place the above reaction tube into the PCR instrument for reaction, reaction procedure: 1) Pre-denaturation at 95℃ for 3min; 2) Denaturation at 95°C for 15 seconds; 3) Annealing temperature: 61°C, annealing time: 15s; 4) 72℃ extension for 30s; 5) Repeat steps 2), 3), and 4) for 35 times; 6) 72℃ extension for 2 min; 7) Store at 4℃.

[0039] 3. Agarose gel electrophoresis: Perform electrophoresis in 1% agarose gel and use a 2,000bp DNA marker to indicate the band position. The electrophoresis time can be appropriately extended according to the situation until the marker runs away completely and the two bands of the amplified product are completely separated. Finally, image the gel on a gel imager.

[0040] 4. Result determination: Observe the amplified bands. If there are two bands (224 bp and 192 bp) or only one 192 bp band, the variety is a heritable perennial purple-leaved crape myrtle. If there is only one 224 bp band, the variety has purple young leaves and green mature leaves or perennial green leaves.

[0041] In this example, 40 purple leaf offspring and 39 green leaf offspring were amplified, and the molecular marker identification results of plants with different leaf colors in the crape myrtle leaf color population are as follows: Figure 2 As shown in Figure 1, the samples included: 'Arapahoe' × 'Ebony Embers' F1 population (79 plants), 'Ebony Embers' × 32 (No. 32 in the F1 population, purple leaves), and the lines B1-B9, B40-B42 (purple leaves), and B110-B112 (green leaves) of the offspring population. The molecular marker identification results between different crape myrtle germplasms are shown in Figure 1. Figure 3 As shown, the samples include: 'Ebony Fire' (BD1), 'Ebony Glow' (BD2), 'Ebony Embers' (BD4), 'Ebony and Ivory' (BD5), 'Dynamite' (DY), 'Red Rocket' (HHJ), 'Whit III' (TER), 'Arapahoe' (M54), 'Pocomoke' (M52), 'Binfen Jiaren' (BFJR), 'Pink Linglong' (FLL), 'Pink Elf' (FJL), and 'Linglong' (LL).

[0042] The results showed that the electrophoresis results of the purple-leaf offspring all contained two bands, 224 bp and 192 bp respectively, while the green-leaf offspring only contained a 224 bp band. The strains containing only the 192 bp band were extremely short, with purple-black leaves, and often died after one year of growth. The electrophoresis results of 4 perennial purple-leaf varieties, 3 young purple-leaf and mature green-leaf varieties and 6 perennial green-leaf varieties showed that there were two bands (224 bp and 192 bp) in the perennial purple-leaf varieties ('Ebony Fire', 'Ebony Glow', 'EbonyEmbers', 'Ebony and Ivory'), while there was only one 224 bp band in the young purple-leaf and mature green-leaf varieties ('Dynamite', 'Red Rocket', 'Whit III') and 6 perennial green-leaf varieties ('Arapahoe', 'Pocomoke', 'Binfen Jiaren', 'Fen Linglong', 'Fen Jingling', 'Linglong').

[0043] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A molecular marker associated with the purple leaf trait of Lagerstroemia indica, characterized in that: The molecular marker is an insertion or deletion of a 32 bp sequence at 789140-789171 bp on chromosome 12 of the crape myrtle reference genome PRJCA013427.

2. The molecular marker according to claim 1, characterized in that The 32 bp sequence is shown as SEQ ID No.

1.

3. The molecular marker according to claim 2, characterized in that The molecular marker is an insertion or deletion of the sequence shown in SEQ ID No. 1 after the 62nd base of the sequence shown in SEQ ID No.

2.

4. The molecular marker according to any one of claims 1 to 3, characterized in that If the 32bp sequence is missing, it is identified as a heritable crape myrtle variety with purple leaves all year round; if the 32bp sequence is not missing, it is identified as a crape myrtle variety with purple young leaves and green mature leaves or a crape myrtle variety with green leaves all year round.

5. A primer for amplifying a molecular marker according to any one of claims 1 to 4, characterized in that: The primers are shown as SEQ ID No.3 and SEQ ID No.

4.

6. Use of the molecular marker according to any one of claims 1 to 4 or the primer according to claim 5 in identifying the purple leaf trait of Lagerstroemia indica.

7. A method for identifying the purple leaf traits of Lagerstroemia indica, characterized in that: include: The genomic DNA of the sample to be tested is amplified by PCR using the primers described in claim 5.

8. The method according to claim 7, characterized in that Also includes: Agarose gel electrophoresis was used to detect the amplified product. If there were bands at both 224 bp and 192 bp, or only at 192 bp, it was identified as a heritable crape myrtle variety with purple leaves all year round. If there was only a band at 224 bp, it was identified as a crape myrtle variety with purple young leaves and green mature leaves, or a crape myrtle variety with green leaves all year round.

9. The method according to claim 7, characterized in that: The procedure of the PCR amplification is: (1) Pre-denaturation at 95°C for 3 min; (2) Denaturation at 95°C for 15 seconds; (3) Annealing at 61°C for 15 seconds; (4) 72°C extension for 30 s; (5) Repeat steps (2), (3), and (4) 35 times; (6) Extend at 72°C for 2 min.

10. Use of the molecular marker according to any one of claims 1 to 4, the primer according to claim 5, the use according to claim 6, or the method according to any one of claims 7 to 9 in Lagerstroemia indica genetic breeding or Lagerstroemia indica germplasm resource analysis.

Images