Application of GPR146 inhibitors in the preparation of drugs for the treatment of wet age-related macular degeneration

Abstract

The application discloses application of a GPR146 inhibitor in preparation of a drug for treating wet age-related macular degeneration. The application finds that GPR146 is significantly up-regulated in expression in a mouse model of laser-induced CNV and a mouse model of subretinal fibrosis. In mice, shRNA is used to knock down GPR146, thereby significantly inhibiting CNV, subretinal fibrosis and inflammation. In an in-vitro experiment, siRNA targeting GPR146 can inhibit the in-vitro neovascular function of endothelial cells, such as proliferation, migration and tube formation, and reduce immune cell adhesion and transendothelial cell migration. In addition, targeting GPR146 can also inhibit the expression of TGF-beta, Fibronectin (FN), alpha-SMA, Col1A, MMP9 and other fibrosis-promoting molecules by endothelial cells. Meanwhile, targeting GPR146 can also inhibit the proliferation and migration of smooth muscle cells and reduce the expression of the above fibrosis-promoting molecules. The above results all show that targeting GPR146 can significantly inhibit CNV formation, inflammation and subretinal fibrosis, and has good therapeutic effect.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically the application of GPR146 inhibitors in the preparation of drugs for the treatment of wet age-related macular degeneration. Background Technology

[0002] Age-related macular degeneration (AMD), also known as age-related macular degeneration, is a degenerative eye disease that primarily affects vision in people over 50 years of age and is one of the leading causes of irreversible blindness. It is estimated that approximately 196 million people worldwide had AMD in 2020, and this number is projected to increase to 288 million by 2040, placing a significant burden on healthcare. AMD is mainly divided into two forms: dry AMD and wet AMD (wAMD). wAMD is the leading type of blindness caused by AMD, accounting for more than 90% of all AMD-related blindness cases. In wAMD, the formation of choroidal neovascularization (CNV) is a key pathological feature. The current main clinical treatment for wAMD is to inhibit choroidal neovascularization through intraocular injection of anti-VEGF antibodies or fusion proteins. This method can inhibit the proliferation of vascular endothelial cells and reduce leakage from neovascularization, thereby alleviating visual impairment in some wAMD patients to a certain extent. However, with the development of anti-VEGF drugs, the shortcomings and limitations of anti-VEGF therapy have gradually become apparent. For example, anti-VEGF drugs cannot antagonize all types of neovascularization, thus anti-VEGF treatment is only effective for some wAMD patients; long-term intravitreal injection of anti-VEGF drugs increases the risk of complications such as endophthalmitis, lens damage, retinal detachment, and retinal pigment epithelium tear; moreover, anti-VEGF drugs are difficult to resolve problems such as inflammation and subretinal fibrosis. More importantly, studies have shown that about half of wAMD patients develop subretinal fibrosis after anti-VEGF treatment, leading to damage to photoreceptors, retinal pigment epithelium (RPE), and choroidal capillaries, resulting in irreversible vision loss. In addition, an increasing number of studies have shown that endothelial cells can directly promote the fibrosis process through endothelial cell-to-myofibroblast transformation (EndMT), and can also indirectly promote fibrosis by secreting various pro-fibrotic and pro-inflammatory mediators, thereby activating fibroblasts and recruiting inflammatory / immune cells, further promoting fibrosis. However, there is currently no clear pathogenic mechanism and therapeutic target for subretinal fibrosis. Therefore, how to effectively inhibit subretinal fibrosis in wAMD has become a key aspect of wAMD treatment, and there is an urgent need to discover new targets that can effectively prevent subretinal fibrosis in wAMD.

[0003] G protein-coupled receptor 146 (GPR146) is an orphan G protein-coupled receptor. Current research indicates that GPR146 can promote atherosclerosis and pulmonary artery remodeling; furthermore, GPR146 is also associated with liver fibrosis. These studies reveal the potential role of GPR146 in fibrosis. However, the role of GPR146 in subretinal fibrosis in CNV has not yet been reported, and there are currently no ophthalmic drugs targeting GPR146 that have entered clinical trials. Summary of the Invention

[0004] The purpose of this invention is to provide the use of GPR146 inhibitors in the preparation of drugs for the treatment of wet age-related macular degeneration.

[0005] Therefore, the first objective of this invention is to provide the application of GPR146 as a target in screening drugs that inhibit the ability of endothelial and smooth muscle cells to generate new blood vessels, inflammation and promote fibrosis.

[0006] Preferably, the drug is, but is not limited to, a drug for the prevention and / or treatment of wet age-related macular degeneration.

[0007] Preferably, the drug is a drug that downregulates GPR146 expression.

[0008] A second objective of this invention is to provide the use of drugs that regulate GPR146 expression in the preparation of drugs that inhibit the angiogenesis, inflammation, and fibrosis of endothelial and smooth muscle cells.

[0009] Preferably, the drug is, but is not limited to, a drug for the prevention and / or treatment of wet age-related macular degeneration.

[0010] Preferably, the drug is an inhibitor of GPR146.

[0011] Preferably, the drug comprises a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is an inhibitor of GPR146.

[0012] Preferably, the GPR146 inhibitor includes small molecule inhibitors targeting the GPR146 protein and nucleotides that inhibit the expression of the GPR146 protein.

[0013] Preferably, the nucleotides that inhibit GPR146 protein expression include siRNA or shRNA.

[0014] Preferably, the siRNA is CCACUUCUCUACCGCUACA.

[0015] Preferably, the shRNA is CCGGGCATTATCTGGGCATCCTACACTCGAGTGTAGGATGCCCAGATAATGCTTTTTG (SEQ ID NO.1).

[0016] The present invention also provides a drug that inhibits the ability of endothelial cells and smooth muscle cells to generate new blood vessels, inflammation and promote fibrosis, such as a drug for treating wet age-related macular degeneration, the drug containing an inhibitor of GPR146 as an active ingredient.

[0017] Preferably, the formulation of the drug is an ophthalmic preparation. Preferably, the ophthalmic preparation includes, but is not limited to, eye drops, eye ointments, eye sprays, ophthalmic gels, eye patches, intraocular injections, ophthalmic microspheres, ophthalmic implants, periocular injections, and sustained-release ophthalmic preparations.

[0018] This invention reveals that GPR146 expression is significantly upregulated in both laser-induced CNV and subretinal fibrosis mouse models. In mice, knockdown of GPR146 using shRNA significantly inhibits CNV, subretinal fibrosis, and inflammation. In in vitro experiments, siRNA targeting GPR146 inhibits endothelial cell proliferation, migration, and tubular formation, reducing immune cell adhesion and transendothelial cell migration. Furthermore, targeting GPR146 inhibits the expression of pro-fibrotic molecules such as TGF-β, Fibronectin (FN), α-SMA, Col1A, and MMP9 on endothelial cells. Simultaneously, targeting GPR146 also inhibits smooth muscle cell proliferation and migration, and reduces the expression of these pro-fibrotic molecules. These results demonstrate that targeting GPR146 can significantly inhibit CNV formation, inflammation, and subretinal fibrosis, exhibiting good therapeutic effects. Therefore, this invention provides a novel therapeutic target and strategy for wAMD, possessing significant clinical application value. Attached Figure Description

[0019] Figure 1 Figure 1 shows the experimental results of the mouse CNV model. A shows the changes in GPR146 expression in the RPE-choroid complex on day 7 (D7) after CNV modeling and day 35 (D35) after the second modeling. B shows the knockdown efficiency of shGPR146 detected by qPCR. C, D, and E show the immunofluorescence assays for angiogenesis, inflammation, and subretinal fibrosis in the RPE-choroid complex after GPR146 knockdown in CNV mice (markers: IB4, Iba1, α-SMA, Coll1, respectively) (n=12), (scale bar=100μm).

[0020] Figure 2To investigate the effects of GPR146 knockdown in HREC cells on in vitro angiogenesis and inflammatory function of endothelial cells. Specifically: A) qPCR verification of GPR146 knockdown efficiency in HREC cells (n=4); B) CCK8 assay of HREC cell proliferation 24 h after GPR146 knockdown (n=4); C) HREC cell migration ability after GPR146 knockdown (n=4); D) HREC cell tube formation ability after GPR146 knockdown (n=4); E) THP-1 cell adhesion to endothelial cells after GPR146 knockdown in HREC cells stimulated with LPS (1 μg / mL) (n=3); F) THP-1 cell transendothelial migration ability after GPR146 knockdown in endothelial cells stimulated with LPS (n=3). (Scale bar = 50 μm)

[0021] Figure 3 To detect the expression of pro-fibrotic and inflammatory factors in endothelial cells after GPR146 knockdown in HREC cells. A shows the expression of numerous pro-fibrotic and inflammatory factors (n=4) after GPR146 knockdown by qPCR. Figure 4 To assess the effects of GPR146 knockdown on the proliferation and migration of smooth muscle cells in HUVSMC cells. A represents qPCR validation of GPR146 knockdown efficiency in HUVSMCs (n=4); B represents the CCK8 assay to assess the proliferation of HUVSMC cells 24 hours after GPR146 knockdown (n=4); and C represents the migration ability of HUVSMC cells after GPR146 knockdown (n=4).

[0022] Figure 5 To detect the expression of pro-fibrotic and inflammatory factors in smooth muscle cells after GPR146 knockdown in HUVSMC cells. A shows the expression of numerous pro-fibrotic and inflammatory factors (n=4) after GPR146 knockdown by qPCR. Detailed Implementation

[0023] The following examples are further illustrations of the present invention, but not limitations thereof. Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the reagents and...

[0024] Unless otherwise specified, all materials are available through commercial channels.

[0025] Human primary retinal endothelial cells (HREC): purchased from Cybio (Shanghai) Biotechnology Co., Ltd.

[0026] Human primary umbilical vein smooth muscle cells (HUVSMC): purchased from CyberKang (Shanghai) Biotechnology Co., Ltd.

[0027] Human leukemia mononuclear cells (THP-1): purchased from Angio-proteomie.

[0028] Table 1 siRNA sequence information

[0029] Sequence (5'-3') siCTRL UUCUCCGAACGUGUCACGU siGPR146 CCACUUCUCUACCGCUACA

[0030] Table 2 shRNA sequence information

[0031] Sequence (5'-3') shCTRL CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG shGPR146 CCGGGCATTATCTGGGCATCCTACACTCGAGTGTAGGATGCCCAGATAATGCTTTTTG

[0032] Table 3. qPCR primer sequence information

[0033]

[0034]

[0035] Experimental Example 1: Knockdown of GPR146 can inhibit pathological angiogenesis and reduce inflammation and fibrosis levels in CNV model mice. 1. Plasmid construction

[0036] The shRNA targeting GPR146 (as shown in Table 2, shGPR146) was designed using pLKO.1 as a vector via the Sigma website. The designed sequence was synthesized by Tsingke Biotechnology and ligated to the pLKO.1 vector using T4 DNA ligase. All plasmids were transformed with DH5α and extracted using a plasmid extraction kit (TIANGEN, DP117TA).

[0037] 2. Establishment of a mouse model of GPR146 knockdown in the choroid and laser-induced choroidal angiogenesis (CNV)

[0038] 1) Irradiate four laser photocoagulation spots (spot size 75μm, power 90mw, duration 75ms) onto the eyes of adult mice within an area 1.5-2mm from the diameter of the optical disc. Perform laser photocoagulation at positions 12, 3, 6, and 9, avoiding large retinal vessels.

[0039] 2) Inject 1 μg of plasmid-PEI complex containing shGPR146 (as shown in Table 2) or shCTRL (as shown in Table 2) into the vitreous cavity of mice. Two days later, sacrifice the mice, collect the eyeballs, isolate the RPE-choroid complex, and perform qPCR to verify the knockdown efficiency.

[0040] 3) Intravitreal injection of shGPR146 or shCTRL plasmid-PEI complex (1 μg plasmid per eye), followed by a second injection on the third day after CNV.

[0041] 4) Collect eyes on day 7. Fix the eyeballs under 4% PFA for 1 hour, remove the cornea, lens, lenticule, and vitreous body, and separate the RPE-choroid complex. Wash the RPE-choroid complex with PBS and block it in a perforated solution containing 5% donkey serum, 5% BSA, and 0.5% Txiton X-100 for 1 hour.

[0042] 5) Incubate RPE-choroid membrane overnight at 4°C with Alexa Fluor 488 (1:500) conjugated with 1% donkey serum, 1% BSA and 0.1% Txiton X-100, and heterolectin GS-IB4 and Iba1 antibody (1:400).

[0043] 6) Rinse the RPE-choroid complex with PBS, incubate with secondary antibody at room temperature for 1 hour, stain the nucleus with DAPI for 5 minutes, and wash three times with PBS. Place the RPE side up flat.

[0044] 7) Take images using a fluorescence microscope and analyze the area of ​​the CNV region using image analysis software.

[0045] 3. Immunofluorescence staining

[0046] 1) Fix with 4% PFA for 30 min.

[0047] 2) Wash with PBS for 5 minutes, three times.

[0048] 3) Block with 5% BSA, 5% donkey serum and 0.5% Triton X-100 at room temperature for 1 h.

[0049] 4) Then add IB4 antibody (1:400), Ibal antibody (1:400), α-SMA (1:400), and Coll1 (1:400) respectively, and incubate overnight at 4°C in the dark.

[0050] 5) Wash three times with PBS, 5 minutes each time.

[0051] 6) Add secondary antibody and incubate at room temperature for 1 hour, remove secondary antibody, and stain cell nuclei with DAPI for 5 minutes.

[0052] 7) Wash three times with PBS, 5 minutes each time.

[0053] 8) After sealing with the anti-fluorescence quencher, observe and photograph the slide using a fluorescence microscope.

[0054] 4. Experimental Results

[0055] like Figure 1As shown, we examined GPR146 expression 7 and 35 days after CNV modeling. qPCR results showed that GPR146 expression in the CNV model was significantly upregulated compared to the control group. To address this, we designed a shRNA targeting GPR146. CNV modeling was then performed, and the shRNA was injected simultaneously. Seven days later, the RPE-choroid complex was collected, and immunofluorescence staining was performed using markers of endothelial cells, fibrosis, and microglia / macrophages (IB4, α-SMA, Coll1, Ibal). The staining results showed a significant reduction in neovascularization area, subretinal fibrosis area, and microglia / macrophage enrichment. These results indicate that targeting GPR146 can significantly inhibit neovascularization, subretinal fibrosis, and inflammatory responses.

[0056] Example 2: Knockdown of GPR146 in endothelial cells can inhibit endothelial cell proliferation, migration, and tube formation, reduce the adhesion of immune cells to endothelial cells and the transendothelial migration ability of immune cells, as well as the expression of profibrotic factors and inflammatory factors.

[0057] 1. Recovery and culture of endothelial cells (HREC)

[0058] 1) Prepare complete endothelial cell culture medium: 500mL ECM + 5% FBS + 1% P / S + 1% ECGS, store at 4℃.

[0059] 2) To prepare 10×PBS: 2.7g potassium dihydrogen phosphate (KH₂PO₄) + 14.2g disodium hydrogen phosphate (Na₂HPO₄) + 80g sodium chloride (NaCl) + 2.0g potassium chloride (KCl), add ddH₂O to a final volume of 1L, mix well, and store at room temperature. Before use, dilute with ddH₂O to 1×PBS and sterilize at high temperature.

[0060] 3) Preheat 50 mL of culture medium or PBS in a centrifuge tube.

[0061] 4) Remove the endothelial cell (HREC) cryovial from the liquid nitrogen tank and place it in a 37°C constant temperature water bath for rapid thawing.

[0062] 5) Transfer the suspension to a centrifuge tube and centrifuge at 300g for 3-5 minutes. Then aspirate the supernatant.

[0063] 6) Resuspend the cells and transfer them to a clean culture dish, then incubate in a CO2 incubator. Once the cells have adhered, change the medium every two days.

[0064] 7) Observe under a microscope. When the cell clones grow and the cell density reaches more than 90%, passage them. After 2-3 passages, the cells can be used for experiments.

[0065] 2. Passaging of endothelial cells (HREC)

[0066] 1) Wash the cells twice with 1×PBS.

[0067] 2) Add 0.05% trypsin to digest the cells, incubate in an incubator for 1 minute, then gently shake the culture dish. Under a microscope, the cell clones are seen to be loose.

[0068] 3) Add culture medium to stop digestion. Spread the cells into a new culture dish at a ratio of 1:3. Shake the cell suspension well and then put the culture dish back into a 37℃ CO2 incubator for culture.

[0069] 3. siRNA transfection

[0070] 1) siRNA dissolution: Centrifuge the siRNA lyophilized powder to allow the siRNA on the wall to reach the bottom of the EP tube. Add 250 μL of RNase-free H2O to 5 nmol of siRNA lyophilized powder per tube to dissolve it, preparing a stock solution with a final concentration of 20 μM. Aliquot the solution into 20 μL / tube and store at -20℃.

[0071] 2) When the cells reach 80% confluence, the siRNA targeting GPR146 (siGPR146 in Table 1) or the control siRNA (siCTRL in Table 1) is mixed with the transfection reagent Escort. TM IV (Sigma, catalog number L3287) was prepared according to the proportions in Table 3 below for siRNA-Escort. TM IV mixture. TM Mix IV and siRNA and gently mix, avoiding shaking, and let stand at room temperature for at least 5 minutes. Add the mixture dropwise to the cell culture dish, gently shaking the dish to mix, in order to knock down GPR146 expression.

[0072] Table 3

[0073] petri dish siRNA (μL) Opti-MEM(μL) <![CDATA[Escort TM IV(μL)]]> 24-hole plate 0.75 50 1.5 12-hole plate 1.5 100 3 6-hole plate 3 200 7.5 6cm 7.5 400 15

[0074] 3) Cell samples were collected 48 hours after siRNA transfection and qPCR was performed to verify the knockdown efficiency. Endothelial cell function was measured 48-72 hours after transfection.

[0075] 4. Cell proliferation detection

[0076] HREC cells were seeded at 8000 cells per well in 96-well plates. After adhesion, they were transfected with siGPR146 for 24 hours (see section 3. siRNA transfection for details). The medium was then replaced with 100 μL of CCK8-ECM (ECM:CCK8 = 9:1) medium, and cultured for another 4 hours. The absorbance was measured at 450 nm using a BioTek EL×800 absorbance microplate reader.

[0077] 5. Endothelial cell migration assay

[0078] 1) HRECs treated with siRNA for 24 h were seeded into 24-well plates.

[0079] 2) Use the tip of a 200μL pipette perpendicular to the cells to horizontally scribble the cells, with at least three wells per group.

[0080] 3) Wash the cells three times with ECM, induce them, and take pictures under a microscope.

[0081] 4) Place the cells in an incubator and take another picture after 12 hours.

[0082] 6. Endothelial cell tube formation assay

[0083] 1) Pre-cool the 96-well plate, 200ul pipette tip, and Matrigel in a 4-degree refrigerator one day in advance.

[0084] 2) Add 50 μL of matrigel to a pre-cooled 96-well plate and incubate in an incubator for 30 min.

[0085] 3) HREC cells treated with siRNA for 48 hours were seeded into the above well plates, and the cells were placed in an incubator. The images were taken after 6 hours.

[0086] 7. Cell adhesion experiment

[0087] 1) HRECs (8.0 × 10⁻⁶) treated with siRNA for 48 h 4 (1 per well) is inoculated in a 24-well plate.

[0088] 2) Add 1 μg / mL LPS and treat for 4 h, then wash 3 times with PBS.

[0089] 3) Treat THP-1 (2.5 × 10⁻⁶) with 2.5 μM calcein AM (Beyotime). 5 Cells per well, 30 min.

[0090] 4) Incubate AM-labeled THP-1 cells with HREC for 2 hours.

[0091] 5) Wash three times with PBS to remove unattached THP-1 cells.

[0092] 6) Adherent THP-1 cells from 12 randomly selected visual regions were captured using a fluorescence microscope (Zeiss, Germany) and analyzed via Image.

[0093] 8. THP-1 cell transendothelial migration assay

[0094] 1) HRECs infected with siGPR146 for 24 hours (5.0 × 10⁻⁶) 4 (1 cell / well) is seeded into each upper chamber and cultured to allow the cells to adhere to the wall and form a monolayer.

[0095] 2) Treat adherent THP-1 cells with 2.5 μM calcein AM for 30 min. Centrifuge to remove the culture medium, resuspend the THP-1 cells in 1640 medium containing 1% FBS, and then divide the resuspended THP-1 cells into 5 × 10⁻⁶ cells. 5 (One per hole) is added to the upper chamber.

[0096] 3) Add 1640 medium containing 10% FBS, 50 ng / mL CCL2, and 1 μg / mL LPS to the lower chamber.

[0097] 4) After 12 hours, the THP-1 cells that had migrated in the lower chamber were transferred to new wells and treated with 150 ng / mL phorbol 12-myristate 13-acetate (PMA) for 12 hours to induce THP-1 cell adhesion. Twelve randomly selected regions were captured using fluorescence microscopy and analyzed by image processing.

[0098] 9. Cell RNA extraction, reverse cDNA and qRT-PCR

[0099] 1) Take cells that have grown to 80% density, discard the culture medium, wash once with PBS, add 600 μL of Trizol to lyse the cells, and transfer to a 1.5 mL centrifuge tube.

[0100] 2) Add 120 μL of chloroform, shake vigorously for 20 seconds, let stand for 5 minutes, and centrifuge at 4℃ for 15 minutes at 15000 rpm.

[0101] 3) Transfer the supernatant to a new centrifuge tube, being careful not to transfer it to the middle layer; add pre-cooled isopropanol to the supernatant in a 1:1 ratio, mix well, let stand at -20℃ for 20 minutes, then centrifuge at 4℃ for 15 minutes at 12000 rpm.

[0102] 4) Discard the supernatant and add 500 μL of 75% pre-cooled ethanol.

[0103] 5) Centrifuge at 4℃ for 5 min, discard the supernatant, add 500 μL of 95% pre-cooled ethanol, centrifuge at 4℃ for 5 min, discard the supernatant, invert the centrifuge tube onto clean absorbent paper, wait for the white precipitate at the bottom of the tube to become transparent, add 20 μL of DEPC H2O, and directly reverse the process or store at -20℃.

[0104] 6) The total RNA obtained was measured using an ELISA reader. 2 μg of total RNA was reversed for each sample, and cDNA was synthesized using the FastKing RT kit with DNase (TIANGEN).

[0105] 7) Using the synthesized cDNA as a template, the gene expression level was detected on an ABI QuantStudio 6 Flex device (Life Technologies) PCR instrument, referring to the SYBR Green (ROCHE) kit;

[0106] 8) Using ACTIN as an internal reference gene, the expression of each gene was calculated using the delta-delta Ct method. The primer sequences for each gene were obtained from the Primer Bank website, as shown in Table 3.

[0107] 10. Experimental Results

[0108] 1) such as Figure 2 As shown, we designed siRNA targeting GPR146 to knock down GPR146 expression in HREC cells. The CCK8 assay was used to detect the effect of GPR146 on endothelial cell proliferation; the results showed that knocking down GPR146 significantly inhibited endothelial cell proliferation. Figure 2 (B). The effect of GPR146 on endothelial cell migration was detected using a scratch assay. The results showed that knockdown of GPR146 inhibited endothelial cell migration. Figure 2 The effect of GPR146 on the in vitro lumen-forming ability of endothelial cells was detected using an endothelial cell tube-forming assay. The results showed that knockdown of GPR146 inhibited the in vitro lumen-forming ability of endothelial cells. Figure 2 These results suggest the effect of GPR146 on angiogenesis. To examine the effect of GPR146 on the inflammatory response in endothelial cells, we performed leukocyte adhesion and leukocyte transendothelial migration assays. HRECs with GPR146 knockdown were seeded in 24-well plates, treated with LPS for 4 h, and then calcein-labeled THP-1 cells were incubated with the HRECs for 2 h before microscopic observation. We found that knockdown of GPR146 in endothelial cells decreased the ability of HREC cells to adhere to immune cells (D). Figure 2 (E in the text). HREC cells with GPR146 knockdown were seeded in the upper chamber. Under LPS stimulation and low serum concentration culture conditions, THP-1 cells treated with calcein were seeded in the upper chamber, while the lower chamber contained culture medium with normal serum concentration. After 12 hours, PMA was added to the lower chamber to induce THP-1 cell adhesion, and images were taken. The results showed that knockdown of GPR146 in endothelial cells reduced the transendothelial migration ability of immune cells. Figure 2 (F in the text)

[0109] 2) such as Figure 3 As shown, to further understand the effects of GPR146 on endothelial cell inflammation and profibrosis, we knocked down GPR146 in endothelial HRECs and then examined the expression of numerous molecules related to profibrosis and inflammation. The results showed that GPR146 knockdown significantly inhibited the expression of profibrotic molecules and inflammatory factors in endothelial cells, indicating that GPR146 has a strong regulatory effect on the profibrotic and inflammatory functions of endothelial cells. Figure 3 ).

[0110] Example 3: Knockdown of GPR146 in smooth muscle cells can inhibit smooth muscle cell proliferation and migration, as well as suppress the expression of profibrotic and inflammatory factors.

[0111] 1. Recovery and culture of smooth muscle cells (HUVSMC)

[0112] 1) Prepare complete culture medium for smooth muscle cells: 500 mL SMCM + 5% FBS + 1% P / S + 1% SMCGS, store at 4℃. Other procedures are similar to those for endothelial cells (HREC), see above for details.

[0113] 2. Smooth muscle cell migration (transwell method)

[0114] 1) 24h siGPR146 HUVSMCs were transferred to the upper chamber of the transwell at a rate of 50,000 cells per well and fed in medium containing 1% FBS.

[0115] 2) Add culture medium containing 10 ng / ml PDGF-BB + 5% FBS to the lower chamber to attract HUVSMC migration.

[0116] 3) After 12-24 hours of migration, remove the transwell and fix it with 4% PFA for 15 minutes. Wash three times with PBS, stain with crystal violet solution for 3-5 minutes, and wash away excess crystal violet with water.

[0117] 4) Gently wipe away any unmigrated cells from the upper chamber of the transwell with a cotton swab, exposing only the migrating cells, and then take a white light photograph and count them.

[0118] 3. Experimental Results

[0119] 1) such as Figure 4 As shown, we designed a siRNA targeting GPR146 to knock down GPR146 expression in HUVSMC cells. The CCK8 assay was used to detect the effect of GPR146 on smooth muscle cell proliferation; the results showed that knocking down GPR146 significantly inhibited smooth muscle cell proliferation. Figure 4The effect of GPR146 on smooth muscle cell migration was examined using a transwell migration assay. The results showed that knockdown of GPR146 inhibited smooth muscle cell migration. Figure 4 (C).

[0120] 2) such as Figure 5 As shown, to further understand the effects of GPR146 on smooth muscle cell inflammation and pro-fibrosis, we knocked down GPR146 in HRECs of smooth muscle cells and then examined the expression of numerous molecules related to pro-fibrosis and inflammation. The results showed that GPR146 knockdown significantly inhibited the expression of pro-fibrotic molecules and inflammatory factors in smooth muscle cells, indicating that GPR146 has a strong regulatory effect on the pro-fibrotic and inflammatory functions of smooth muscle cells. Figure 5 ).

[0121] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Use of an inhibitor of GPR146 in the preparation of a drug for preventing and / or treating wet age-related macular degeneration; The inhibitor of GPR146 includes a small molecule inhibitor targeting GPR146 protein, a nucleotide inhibiting the expression of GPR146 protein; the nucleotide inhibiting the expression of GPR146 protein is siRNA or shRNA; the siRNA is CCACUUCUCUACCGCUACA; the shRNA is CCGGGCATTATCTGGGCATCCTACACTCGAGTGTAGGATGCCCAGATAATGCTTTTTG.

2. Use according to claim 1, characterized in that, The drug includes a pharmaceutically acceptable carrier and an effective amount of active ingredients, wherein the active ingredients are the inhibitors of GPR146.

Images