Application of MSR1 gene as a target in screening drugs for prevention and treatment of sepsis

Abstract

The present application relates to the technical field of biotechnology, and particularly relates to application of MSR1 gene as a target in screening of drugs for preventing and treating sepsis. The purpose of the present application is to provide application of a preparation for knocking out MSR1 gene expression in preparation of a drug for treating immune function disorder and excessive inflammation caused by sepsis, and regulating immune function disorder and excessive inflammation caused by sepsis.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and particularly relates to application of MSR1 gene as a target in screening drugs for preventing and treating sepsis. BACKGROUND

[0002] Sepsis is a life-threatening organ dysfunction caused by a dysregulated host response to infection, with high mortality and high morbidity. Globally, 48.9 million people suffer from sepsis each year, and 11 million people die of sepsis, which is an important cause of global population mortality and morbidity. Sepsis can rapidly activate the body's innate immune and adaptive immune systems, causing severe systemic inflammatory response and immune function hyperactivity, and then secondary long-term immune function inhibition due to massive consumption of cytokines and immune cells, which is the key mechanism of repeated infection and multiple organ dysfunction syndrome (MODS) in sepsis patients.

[0003] Currently, for sepsis, especially severe sepsis and septic shock, it often depends on anti-infection and supportive treatment, which are passive symptomatic support treatments, and cannot cure the root cause. With the increase of drug resistance, the effect is limited when facing some refractory septic shock, which makes the treatment of sepsis more difficult.

[0004] MSR1, also known as scavenger receptor A (SR-A) or cluster of differentiation (CD204), was first described by Brownn and Goldstein in 1979. MSR1 is mainly expressed on macrophages and DCs, and also exists on the surface of lymphocytes, and may be involved in the pathogenesis of asthma and chronic obstructive pulmonary disease. Since macrophages mainly remove pathogens through phagocytosis and produce cytokines, MSR1 plays an important role in the process of removing foreign pathogens. LPS is an important endogenous toxin in sepsis, and its main ligand is TLR4. The synergistic effect of MSR1 and TLR4 can activate the phagocytosis of gram-negative bacilli, and promote the synthesis of inflammatory cytokines by activating NF-κB into the nucleus and binding with DNA and downstream signaling pathways. Although MSR1 is active throughout the disease spectrum, it can trigger different signaling pathways according to different recognition receptors, thereby exerting different and even opposite biological functions. Therefore, studying the different functions and regulatory mechanisms of MSR1 is of great significance for using it to treat specific diseases. SUMMARY

[0005] In order to solve the problems in the above background, the application provides an application of MSR1 gene as a target in screening drugs for preventing and treating sepsis, so as to improve the survival rate of sepsis mice.

[0006] The application aims to provide an application of a preparation for knocking out MSR1 gene expression in the preparation of a drug for treating immune function disorders and excessive inflammation caused by sepsis, wherein the preparation is gRNA-B1 or gRNA-B2 for knocking out MSR1 gene expression; the sequence of the gRNA-B1 is: GGCCUUUGCACGUGAAGAGGAGG, as shown in SEQ ID NO. 1; and the sequence of the gRNA-B2 is: ACUUUGGGGAAAUAAGGUACAGG, as shown in SEQ ID NO. 2.

[0007] Further, the preparation for inhibiting or knocking out MSR1 gene expression can inhibit the decrease of the number of CD3+T cells and CD3+CD4+T cells in sepsis mice.

[0008] Further, the preparation for inhibiting or knocking out MSR1 gene expression can inhibit the increase of the level of pro-inflammatory cytokines in the serum of sepsis mice, and the markers of the pro-inflammatory cytokines are IFN-γ, IL-2, IL-4 and IL-12.

[0009] The application can regulate the immune response of refractory sepsis by knocking out MSR1 gene expression, so as to help reduce immune function disorders and excessive inflammatory reactions.

[0010] In summary, the application has the following beneficial effects: the knockout of MSR1 gene can regulate immune function disorders and excessive inflammatory reactions caused by sepsis, improve the decrease of T cell number and cytokine storm caused by sepsis, maintain the function of important organs and reduce tissue damage, and improve the survival rate of sepsis mice.

[0011] The above description is only a summary of the technical solutions of the application, in order to more clearly understand the technical means of the application, the content of the specification can be implemented, and in order to make the above and other purposes, characteristics and advantages of the application more obvious and easy to understand, the following preferred embodiments are described in detail, and the accompanying drawings are described as follows. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 Effect of conditional knockout of MSR1 gene on the proportion of CD3+T cells in peripheral blood of sepsis mice

[0013] Figure 2 Effect of conditional knockout of MSR1 gene on the proportion of CD3+CD4+T cells in peripheral blood of sepsis mice

[0014] Figure 3: Effect of conditional knockout of MSR1 gene on the proportion of CD3+Foxp3+ Tregs in peripheral blood of septic mice;

[0015] Figure 4 : Effect of conditional knockout of MSR1 gene on the level of inflammatory cytokines in serum of septic mice;

[0016] Figure 5 : Effect of conditional knockout of MSR1 gene on the damage of important organs and tissues of septic mice;

[0017] Figure 6 : Detection of Msr1 fl / fl Mice and Cd11 c cre Msr1 fl / fl Mice in serum after CLP modeling and MSC-Exo treatment;

[0018] Figure 7 : Effect of conditional knockout of MSR1 gene on the survival rate of septic mice 7 days after CLP. DETAILED DESCRIPTION

[0019] In order to make the content of the present application more easily and clearly understood, the present application will be further described below according to specific embodiments and in conjunction with the accompanying drawings.

[0020] The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.

[0021] WT male C57BL / 6J mice were used in the following experiments, each weighing about 20-25g, provided by Huafukang Biotechnology Co., Ltd. The mice were raised in a SPF level animal room, with an environmental temperature of 22℃, an environmental humidity of 65%, good ventilation, water at any time, and adaptive feeding for 1 week.

[0022] Before the experiment, 24 normal Msr1 fl / fl Mice and 24 knockout Msr1 gene expression gRNA-B1 or gRNA-B2; the sequence of gRNA-B1 is: GGCCUUUGCACGUGAAGAGGAGG; the sequence of gRNA-B2 is: ACUUUGGGGAAAUAAGGUACAGG. Cd11 c cre Msr1 fl / flThe mice were randomly divided into 3 groups according to a random number table, with 8 mice in each group. One group was opened and the cecum was turned over, and then the abdomen was closed, which was the sham operation group (Sham); one group was subjected to CLP modeling, which was the model group (CLP); one group was injected with MSC-exo through the tail vein immediately after the establishment of the mouse sepsis model, with a dose of 100 μg per mouse, which was the treatment group (CLP+MSC-exo). The sham operation group, the model group and the treatment group were taken at 24 h after modeling, and the blood was taken after the eyeball was removed under anesthesia, and the samples were taken after the blood was taken.

[0023] The method steps for establishing a mouse sepsis model by CLP are as follows:

[0024] S1, the mice were fasted for 12 h before operation, and the water was not restricted. The mice were anesthetized by intraperitoneal injection of 5% chloral hydrate, and the anesthetic dose was calculated according to 10 mL / kg. After anesthesia, the mice were fixed on the operation board in a supine position;

[0025] S2, the mouse abdominal skin was disinfected with iodophor, and the incision was made along the midline of the abdomen layer by layer, with a length of 1 cm;

[0026] S3, after opening the abdomen, the cecum was quickly found, and a sterile No. 4 thread was used to ligate 1.0 cm from the distal end of the cecum. A 22G needle was used to penetrate the cecum once at the distal end of the ligation, and the ligation was squeezed to make part of the intestinal contents overflow. The cecum was returned to the original position in the abdominal cavity, and was sutured layer by layer, and the abdomen was closed;

[0027] S4, 1 mL of 0.9% normal saline was injected subcutaneously into the back of the mouse, and the mouse was transferred to a feeding cage. After the mouse woke up, it could eat and drink freely.

[0028] Experiment 1: Analysis of the proportion of immune cells in the peripheral blood of mice by flow cytometry

[0029] (1) Experimental steps

[0030] S1, after the peripheral blood mononuclear cells of each group of mice were separated and obtained, they were counted and collected in a flow tube at 3x105 cells / tube;

[0031] S2, 1 mL of sterile phosphate buffered saline (PBS) was added to each tube, and then the flow tube was placed in a centrifuge for centrifugation at room temperature, with a speed of 1500 rpm and a time of 5 min. After the supernatant was discarded, the cells were resuspended with 1 mL of PBS and centrifuged again. This was repeated 2 times, and finally the cell pellet was resuspended with 200 μL of PBS;

[0032] S3, 1 μL of CD3 flow cytometry antibody and 1 μL of CD4 flow cytometry antibody were added to each tube, respectively. Blank tubes, CD3 single-staining tubes and CD4 single-staining tubes were also set up. After the addition of the antibodies, the tubes were incubated at room temperature for 30 min in the dark;

[0033] S4, after incubation, 1 mL PBS was added to resuspend each tube, and then the flow tube was placed in a centrifuge for centrifugation at room temperature at a speed of 1500 rpm for 5 min;

[0034] S5, FOXP3 fixing / membrane breaking buffer (1X) and FOXP3 membrane breaking buffer (1X) were configured; FOXP3 fixing / membrane breaking buffer (4X) was mixed with fixing / membrane breaking diluent at a ratio of 1:3 to obtain FOXP3 fixing / membrane breaking buffer (1X); FOXP3 membrane breaking buffer (10X) was mixed with deionized water at a ratio of 1:9 to obtain FOXP3 membrane breaking buffer (1X);

[0035] S6, after centrifugation of the flow tube in the S4 step, the supernatant was discarded, and 500 μL of OXP3 fixing / membrane breaking buffer (1X) was added to each flow tube, and incubated at 4°C for 14 h;

[0036] S7, after membrane breaking incubation, the cells were washed twice with membrane breaking buffer, and the cell precipitate was resuspended with 200 μL of membrane breaking buffer, and then 1.5 μL / tube of Foxp3 flow antibody was added after blowing, and incubated at room temperature in the dark for 1 h;

[0037] S8, after incubation, the cells were resuspended with 1 mL of membrane breaking buffer, and then the flow tube was placed in a centrifuge for centrifugation at room temperature at a speed of 1500 rpm for 5 min, and then the supernatant was discarded, and the cells were resuspended with 300 μL of PBS for detection, and the proportion of CD3+T cells, CD3+CD4+T cells and CD4+Foxp3+Tregs cells in the peripheral blood of mice in different groups was analyzed by using FlowJo V 10.0 software.

[0038] (2) Experimental results

[0039] As shown in Figure 1 , Figure 2 and Figure 3 , compared with the sham operation group, the Msr1 fl / fl mice and Cd11 c cre Msr1 fl / fl The proportion of CD3+T cells in PBMCs (Msr1 fl / fl : P<0.0001; Cd11 c fl / fl Msr1 fl / fl : P<0.0001; Cd11 c cre Msr1 fl / fl: P<0.01) were significantly decreased, but Cd11c cre Msr1 fl / fl The levels of Msr1 fl / fl The levels of Msr1

[0040] The levels of Msr1 fl / fl The levels of Msr1 cre Msr1 fl / fl The levels of Msr1

[0041] The levels of Msr1 fl / fl The levels of Msr1 cre Msr1 fl / fl The levels of Msr1 fl / fl : P<0.001; Cd11c cre Msr1 fl / fl : P<0.0001), Cd11c cre Msr1 fl / f The levels of Msr1 fl / fl The levels of Msr1 fl / fl The levels of Msr1 cre Msr1 fl / fl The levels of Msr1 fl / fl : P<0.0001; Cd11c cre Msr1 fl / fl : P<0.001).

[0042] The results show that conditional knockout of the MSR1 gene can improve the reduction of CD3+T cells and CD3+CD4+T cells caused by sepsis, indicating that conditional knockout of the MSR1 gene can alleviate the immune dysfunction caused by sepsis.

[0043] Experiment two: ELISA method for detecting cytokine levels

[0044] (1) Experimental steps

[0045] S1, detecting sample processing method: removing eyeball of each group of mice to take blood, allowing blood to coagulate naturally at room temperature for 30 min, then placing blood in a centrifuge for centrifugation at room temperature, centrifugation speed is 3000 rpm, centrifugation time is 20 min, then collecting serum and storing. Detecting cytokine level in cell culture supernatant or serum by ELISA kit;

[0046] S2, taking out the 96-well plate coated and closed in advance, balancing to room temperature, adding standard and specimen universal diluent to blank hole, adding 100 μL of each group of diluted cell culture supernatant or serum to the rest of the holes respectively, sealing the reaction hole with sealing tape, placing into 37℃ constant temperature box, avoiding light incubation for 90 min;

[0047] S3, after incubation, absorbing reaction liquid in reaction hole, preparing biotinylated antibody working solution in advance for 20 min, adding 100 μL of biotin-labeled antibody diluted by 1:100 in reaction hole, then sealing reaction hole with sealing tape, placing into 37℃ constant temperature box, avoiding light incubation for 60 min;

[0048] S4, using washing buffer to clean hole plate, soaking for 1 min each time, repeating for 5 times;

[0049] S5, after cleaning hole plate, adding 100 μL of diluted and peroxidase-labeled avidin in reaction hole, wherein the dilution ratio of avidin is 1:100, then sealing reaction hole with sealing tape, placing into 37℃ constant temperature box, avoiding light incubation for 30 min;

[0050] S6, using washing buffer to clean hole plate, soaking for 90 s each time, repeating for 5 times;

[0051] S7, adding 90 μL of color developing substrate in reaction hole, placing into 37℃ constant temperature box, avoiding light incubation for 20 min;

[0052] S8, after incubation, adding 100 μL of reaction termination liquid in reaction hole, mixing gently, then placing hole plate into enzyme label instrument to detect OD value of each hole at 450 nm wavelength within 3 min after adding reaction termination liquid, and calculating concentration of pro-inflammatory cytokine level such as IFN-γ, IL-2, IL-4 and IL-12, and anti-inflammatory cytokine level such as IL-10 and TGF-β.

[0053] (2) Experimental results

[0054] Results as shown in Figure 4 Msr1 fl / fl Mice and Cd11 c cre Msr1 fl / flThe serum of mice after CLP modeling showed significant up-regulation of pro-inflammatory cytokines (IL-2, IL-4, IL-12 and IFN-γ) and anti-inflammatory cytokines (TGF-β), and the levels of Msr1 fl / fl The serum of mice after CLP modeling showed significant up-regulation of pro-inflammatory cytokines (IL-2, IL-4, IL-12 and IFN-γ) and anti-inflammatory cytokines (TGF-β), and the levels of Msr1 cre The serum of mice after CLP modeling showed significant up-regulation of pro-inflammatory cytokines (IL-2, IL-4, IL-12 and IFN-γ) and anti-inflammatory cytokines (TGF-β), and the levels of Msr1 fl / fl The serum of mice after CLP modeling showed significant up-regulation of pro-inflammatory cytokines (IL-2, IL-4, IL-12 and IFN-γ) and anti-inflammatory cytokines (TGF-β), and the levels of Msr1

[0055] The serum of mice after CLP modeling showed significant up-regulation of pro-inflammatory cytokines (IL-2, IL-4, IL-12 and IFN-γ) and anti-inflammatory cytokines (TGF-β), and the levels of Msr1 cre The serum of mice after CLP modeling showed significant up-regulation of pro-inflammatory cytokines (IL-2, IL-4, IL-12 and IFN-γ) and anti-inflammatory cytokines (TGF-β), and the levels of Msr1 fl / fl The serum of mice after CLP modeling showed significant up-regulation of pro-inflammatory cytokines (IL-2, IL-4, IL-12 and IFN-γ) and anti-inflammatory cytokines (TGF-β), and the levels of Msr1 fl / fl The serum of mice after CLP modeling showed significant up-regulation of pro-inflammatory cytokines (IL-2, IL-4, IL-12 and IFN-γ) and anti-inflammatory cytokines (TGF-β), and the levels of Msr1 fl / fl The serum of mice after CLP modeling showed significant up-regulation of pro-inflammatory cytokines (IL-2, IL-4, IL-12 and IFN-γ) and anti-inflammatory cytokines (TGF-β), and the levels of Msr1

[0056] The results showed that conditional knockout of MSR1 gene could effectively reduce the levels of pro-inflammatory cytokines such as IFN-γ, IL-2, IL-4 and IL-12 in the serum of septic mice, and the levels of anti-inflammatory cytokines such as IL-10 and TGF-β did not show significant compensatory increase.

[0057] Experiment three: hematoxylin-eosin (HE) staining to evaluate tissue damage

[0058] (1) Experimental steps

[0059] S1, after the mice in each group were sacrificed, the heart, liver, lung and kidney were fixed in 4% paraformaldehyde;

[0060] S2, gradient dehydration, the order is 75% alcohol→85% alcohol→95% alcohol→100% alcohol;

[0061] S3, paraffin embedding and sectioning, the thickness of the section is about 4 μm;

[0062] S4, deparaffinization of paraffin sections to hydration, the order is environmental deparaffinization I deparaffinization 20 min→ environmental deparaffinization II deparaffinization 20 min→ anhydrous ethanol I deparaffinization 5 min→ anhydrous ethanol II deparaffinization 5 min→ 75% alcohol deparaffinization 5 min, after completion, rinse with water;

[0063] S5, after dewaxing, use hematoxylin staining solution to dye for 4 min, after dyeing, use tap water to rinse the section; use differentiation solution to differentiate, after completion, use tap water to rinse the section; use blue return solution to return the section to blue, after completion, use tap water to rinse the section;

[0064] S6, gradient dehydration of the section, the sequence is 85% alcohol dehydration for 5 min→95% alcohol dehydration for 5 min, after completion, put into HE staining solution to dye for 5 min;

[0065] S7, after dyeing, put the section into the following solution to soak and operate in sequence: anhydrous ethanol I for 5 min→anhydrous ethanol II for 5 min→anhydrous ethanol III for 5 min→xylene I for 5 min→xylene II for 5 min transparent, then use neutral balsam to mount the section;

[0066] S8, after mounting, observe the pathological morphology of each organ under a microscope and collect images.

[0067] (2) Experimental results

[0068] The results are shown in Table 1, and the results are shown in Table 2. Figure 5 Msr1 fl / fl Msr1 cre Msr1 fl / fl The mouse did not show obvious tissue damage in these organs after CLP modeling.

[0069] The results show that conditional knockout of the MSR1 gene can significantly improve tissue damage caused by sepsis.

[0070] Experiment three: biochemical index detection

[0071] (1) Experimental steps

[0072] Take the eyeball blood of each group of mice, let the blood coagulate naturally at room temperature for 30 min, then put the blood in a centrifuge and centrifuge at room temperature, the centrifugal speed is 3000 rpm, the centrifugal time is 20 min, then collect the serum and store. Configure the working reagent, set the parameters of the automatic biochemical instrument, and then load 100 μL of background serum + 10 μL of index sample, and the automatic biochemical instrument automatically measures and detects Msr1 fl / fl Msr1 cre Msr1 fl / fl The levels of important organ damage markers in the serum of mice after CLP modeling and MSC-Exo treatment.

[0073] (2) Experimental results

[0074] As Figure 6 Msr1 fl / fl The levels of organ injury markers such as ALT (P<0.0001), AST (P<0.001), BUN (P<0.001), CREA (P<0.0001) and CK (P<0.001) in mice were significantly increased after CLP modeling, and these indicators were significantly down-regulated after MSC-Exo treatment (ALT: P<0.01; AST: P<0.05; BUN: P<0.05; CREA: P<0.01; CK: P<0.01). However, compared with Msr1 fl / fl Cd11 c cre Msr1 fl / fl The above indicators in mice were significantly decreased after CLP modeling (ALT: P<0.01; AST: P<0.01; BUN: P<0.01; CREA: P<0.01; CK: P<0.05).

[0075] The results showed that conditional knockout of MSR1 gene could significantly protect the function of important organs.

[0076] Experiment four: statistical analysis of survival of mice in each group

[0077] Kaplan-Meier method was used for survival analysis of mice in each group, and Log-rank (Mantel-Cox) Test was used for statistical difference.

[0078] As Figure 7 Msr1 fl / fl The 7-day survival rates of mice in the sham operation group, sepsis group and treatment group were 100%, 20% and 70% respectively, and there was a significant difference in survival rate between the sepsis group and the treatment group (P<0.05). Cd11 c cre Msr1 fl / fl The 7-day survival rates of mice in the sham operation group, sepsis group and treatment group were 100%, 60% and 80% respectively, and there was a significant difference in survival rate between the sepsis group and the treatment group (P<0.05). Cd11 c cre Msr1 fl / fl The survival rates of sepsis mice and Msr1 fl / fl The survival rates of sepsis mice and Msr1

[0079] The above experiments were statistically graphed and data statistically analyzed by Graphpad Prism 9.0 software. The measurement data was expressed as mean ± standard deviation (x ± s), and the data of each group was in normal distribution, and the variance was homogeneous, ANOVA was used for analysis among multiple groups, and Tukey post-hoc test was used for comparison between two groups. P<0.05 was significantly different, *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. The experimental results were repeated more than three times.

[0080] The above-described embodiments are only preferred embodiments of the present application, and cannot be used to limit the protection scope of the present application. Any non-essential changes and modifications made by those skilled in the art on the basis of the application shall fall within the protection scope of the present application.

Claims

1. The use of a formulation that knocks out MSR1 gene expression in the preparation of a drug for treating immune dysfunction and excessive inflammation caused by sepsis, wherein the formulation is gRNA-B1 or gRNA-B2 that knocks out MSR1 gene expression; the sequence of gRNA-B1 is: GGCCUUUGCACGUGAAG AGGAGG; the sequence of gRNA-B2 is: ACUUUGGGGAAAUAAGGUACAGG.

Images