Combined vaccine of oral Ad5 carrier new crown vaccine and injection new crown vaccine and application thereof

Abstract

The invention provides a combined vaccine of an oral Ad5 carrier new crown vaccine and an injected new crown vaccine and application of the combined vaccine, and belongs to the technical field of new crown vaccines. The combined new crown vaccine provided by the invention comprises an Ad5-Omicron-S2PL oral vaccine and a BA.1-S-mRNA injection vaccine, and the combined new crown vaccine provided by the invention can be used for preparing the combined new crown vaccine. When the vaccine is used, the BA.1-S-mRNA vaccine is subjected to intramuscular injection firstly, then the Ad5-Omicron-S2PL vaccine is taken orally, and interval immunization is carried out. Whole body and mucosa immune response can be enhanced, and expression of T cells secreting IFN-gamma and IL-4 is improved.

Description

Technical Field

[0001] The present invention relates to the field of COVID-19 vaccine technology, and in particular to a combined vaccine of an oral Ad5 vector COVID-19 vaccine and an injectable COVID-19 vaccine and applications thereof. Background Art

[0002] Governments, scientists and industrial partners around the world are working hard to promote the development of new crown vaccines, actively exploring safe and effective new crown vaccines using various antigen designs and various vaccination routes. The Omicron variant has obvious genetic differences from the ancestral virus.

[0003] SARS-CoV-2 infection begins in the upper respiratory tract system (URT). The URT is usually the first line of defense against infection and is an important part of the mucosal immune system. Effective airway mucosal immunity is essential to prevent the virus from attaching and replicating on the mucosa. Current studies suggest that mucosal vaccination that can induce an effective immune response at the site of mucosal infection can more effectively block viral transmission and thus better prevent infection. Among them, dimer and multimer SIgA (secretory IgA) are important components of the specific mucosal immune response. They are secreted on the mucosal surface and play a key role in preventing respiratory pathogen infection. In addition, mucosal T cell immune responses triggered by mucosal immunity can also induce distal local mucosal immune responses and effectively clear viral infections in the distal mucosa, which is also an important feature of the common mucosal immune system. Studies on oral vaccines for norovirus, influenza virus, and COVID-19 type 5 adenovirus have shown that oral administration to the intestinal mucosa has produced effective immune responses against target antigens in the distal respiratory mucosa. In a study of virus clearance experiments, it was found that intramuscular administration of the COVID-19 vaccine can produce a strong systemic immune response to SARS-CoV-2, but the induction level of mucosal immune response is low and cannot eliminate viral infection and replication. However, mice that received a single dose of the COVID-19 vaccine via the intranasal route produced a strong IgA and neutralizing antibody response, which can protect the upper and lower respiratory tracts against SARS-CoV-2 infection and achieve immunity to clear the virus. The vaccines currently on the market are mainly administered by intramuscular injection, which can effectively prevent severe illness, but are not ideal for preventing viral infection and blocking viral transmission. It is worth noting that existing studies have shown that mucosal intervention can be quite effective in inhibiting disease transmission, which highlights the superiority and potential power of developing mucosal immune vaccines.

[0004] Adenovirus (Ad) vectors have the advantages of a wide host range, stable genome, simple design, and high immunogenicity, making them the most widely used viral vectors in current vaccine research. Oral vaccination has the characteristics of high acceptability, lower technical threshold for vaccination, and few side effects, and has always been an important direction for vaccine development. Existing studies have shown that oral adenovirus vector vaccines induce effective immune protection and have the advantages of convenient transportation and storage. They have become an important technical approach for the development of oral vaccines. Vaxart, a US company, has developed an oral adenovirus type 5 vector vaccine technology platform using dsRNA as a molecular adjuvant, which can overcome oral tolerance in the small intestine, trigger an innate signal cascade, and subsequently stimulate a strong adaptive response. It has achieved positive results in animal trials and clinical trials of oral vaccines for norovirus, influenza virus, and new coronavirus, including effective reduction of viral transmission. Our laboratory previously developed an oral adenovirus type 5 (rAd5-VP1-DS) Norovirus vaccine based on the oral adenovirus type 5 vector vaccine technology of Vaxart. The results showed that two oral doses of rAd5-VP1-DS vaccine can induce high levels of serum VP1-specific IgG antibodies and blocking antibodies in mice, and can also induce strong and lasting mucosal immunity (SIgA). After that, we used the oral adenovirus type 5 vector vaccine platform established in our laboratory to optimize and transform the new coronavirus S antigen and obtained an oral adenovirus type 5 new coronavirus vaccine. In order to improve the defects of oral vaccines against Omicron variants and provide a safe, effective, timely and convenient new coronavirus vaccine, the present invention is specially proposed. Summary of the invention

[0005] The purpose of the present invention is to provide a safe, effective, timely and convenient new crown vaccine, and to improve the defects of oral vaccines against Omicron variant strains.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a combined new coronavirus vaccine, which includes an Ad5-Omicron-S2PL oral vaccine and a BA.1-S-mRNA injection vaccine.

[0008] Preferably, the preparation method of the Ad5-Omicron-S2PL oral vaccine is as follows:

[0009] (1) Omicron-S2PL was used as the target gene and homologously recombined with the adenovirus vector backbone to obtain the recombinant adenovirus plasmid pKAd5ES-Omicron-S2PL;

[0010] (2) After the pKAd5ES-Omicron-S2PL is linearized, the transfected cells are rescued and amplified, and the virus liquid is collected to obtain the Ad5-Omicron-S2PL oral vaccine.

[0011] Preferably, the nucleotide sequence of the Omicron-S2PL is shown in SEQ ID NO:1.

[0012] Preferably, the adenovirus vector backbone is pKAd5ES-pmeI.

[0013] Preferably, the transfected cells are HEK 293 cells.

[0014] The present invention also provides an application of a combined COVID-19 vaccine in the preparation of a vaccine preparation for immunity to COVID-19.

[0015] Preferably, the novel coronavirus is Omicron.

[0016] Preferably, the combination vaccine jointly enhances systemic and mucosal immune responses and increases the expression of T cells that secrete IFN-γ and IL-4.

[0017] Preferably, the combined COVID-19 vaccine is first administered intramuscularly with the BA.1-S-mRNA vaccine, followed by an oral administration of the Ad5-Omicron-S2PL vaccine, with the immunizations spaced apart.

[0018] The combined COVID-19 vaccine provided by the present invention is composed of an Ad5-Omicron-S2PL oral vaccine and a BA.1-S-mRNA injection vaccine. When used, the BA.1-S-mRNA vaccine is first injected intramuscularly, and then the Ad5-Omicron-S2PL vaccine is taken orally, with interval immunization. It can enhance systemic and mucosal immune responses and increase the expression of T cells that secrete IFN-γ and IL-4. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 (A) Schematic diagram of the construction of the pKAd5ES-Omicron-S2PL recombinant adenovirus plasmid;

[0020] (B) Negatively stained electron microscopic morphology of Ad5-Omicron-S2PL recombinant adenovirus, scale bar = 200 nm; (C) Western Blot technique was used to detect the expression of target genes in 293 cells after Ad5V-Omicron-S2PL infection for 24 hours;

[0021] Figure 2Figure 2 shows the mucosal and systemic immunity levels induced by oral Ad5V-Omicron-S2PL vaccine in mice; (A) Vaccine immunization procedure and sample detection points using BALB / c mice; (B) Different vaccine immunization doses (10 7 ,10 8 ,10 9 ,10 10 IU) in vivo serum IgG levels in mice immunized with different vaccine doses (10 7 ,10 8 ,10 9 ,10 10 IU) in the intestinal SIgA level produced in vivo after immunization of mice;

[0022] Figure 3 Figure 2. The trend of S-specific IgG and SIgA antibody changes within 20 weeks after oral administration of two doses of Ad5-Omicron-S2PL; (A) Vaccine immunization program and sample collection points of BALB / c mice; (B) Oral administration of two doses of 10 9 IU vaccine, dynamic changes in serum IgG antibodies within 20 weeks; (C) oral administration of two doses of 10 9 Trends in serum NAb antibody levels within 20 weeks of IU vaccination; (D) Oral vaccination with 2 doses of 10 9 IU vaccine, dynamic changes of intestinal IgA antibodies within 20 weeks.

[0023] Figure 4 Mucosal and systemic neutralizing antibodies against Wildtype and different variants elicited by two oral doses of Ad5-Omicron-S2PL in BALB / c mice; (A) Vaccine immunization schedule and sample collection points for BALB / c mice; Neutralizing antibody titers in serum (B) and BALFs (C) against Omicron strains BA.1, WT, Alpha and Delta at week 9 after immunization; (D) IgA antibody titers in mouse serum, intestinal mucosa and BALFs at week 9 after immunization; (E) Endpoint titers of S protein-specific IgA antibodies against WT, Delta and Omicron BA.1, BA.2, XBB, BA.4 / BA.5 / BA.5.2 and JN.1 in BALFs.

[0024] Figure 5 Cellular immune response induced by oral Ad5-Omicron-S2PL vaccine; (A) Vaccine immunization schedule and sample collection time points of BALB / c mice (n=6 per group). ELISpot method was used to detect secretory IFN-γ and IL-4 (B); and the expression level of S-specific IgG / IgAACS (C).

[0025] Figure 6Extensive mucosal and systemic immune responses were established for BA.1-S-mRNA vaccine combined with oral vaccine booster immunization; (A) Vaccine immunization schedule and sample collection time points in BALB / c mice (n=6 per group); (B) Endpoint titers of IgA antibodies specific for WT, Delta and Omicron BA.1, BA.2, XBB, BA.4 / BA.5 / BA.5.2 and JN.1S proteins in BALFs; (C) Serum neutralizing antibody titers against Omicron strains BA.1, WT, Alpha and Delta at week 9 after immunization; (D) Detection of secreted IFN-γ and IL-4 by ELISpot method. DETAILED DESCRIPTION

[0026] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0027] Example 1

[0028] Construction of recombinant adenovirus plasmid

[0029] Replication-deficient recombinant adenovirus type 5 (Ad5-Omicron-S2PL) can express OmicronBA.1S protein in infected cells. In order to improve the expression of spike protein in human cells, we optimized the codons of the recombinant OmicronBA.1S protein (Omicron-S2PL), deleted the furin enzyme cleavage site, and replaced the amino acids at positions 983 and 984 with two prolines ( Figure 1 A). The expression cassette of the above S protein gene containing the human CMV promoter was inserted into the E1 region of the E1- and E3-deleted pKAd5ES-PmeI. In order to adapt and enhance mucosal immunity, we used the U6 promoter to co-express an endogenous dsRNA adjuvant to enhance the immune response.

[0030] Among them, Omicron-S2PL is a sequence carrying a CMV promoter and co-expressing an adjuvant (SEQ ID NO: 1), and the sequence and structure are as follows. The first paragraph of underlined lowercase letters is the CMV promoter sequence, the uppercase letters are the S2P gene sequence containing the kozak motif (underlined GCCACC), the second paragraph of underlined lowercase letters is the polyA tail sequence, the third paragraph of underlined lowercase letters is the U6 promoter, and gaaacgatatgggctgaatacggatccgtattcagcccatatcgtttc is the adjuvant sequence:

[0031] gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatg gagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaa taatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaac tgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgcta ttaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtct ccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactcc gccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct cgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccccggctagagcttcccggggtttaaacttcgaa GCCACCctgtgccttctagttgc cagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaat aaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaa gggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatgg TAACTATAACGGTCCTAAGGGAATTCAAGGTCGGGCAGGAA gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgtta gagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatt tcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttc gatttcttggctttatatatcttgtggaaaggacgaaacacc gaaacgatatgggctgaatacggatccgtattcagcccatatcgtttcTTTTTT.

[0032] Using pUC57-CMV-Omi-S2PL plasmid (50 ng / μl) as a template (synthesized by GenScript Biotech Co., Ltd.), primers were designed using SnapGene 6.0.2 software to amplify the Omi-S2PL target gene and purify it.

[0033] The vector backbone pKAd5ES-pmeI was linearized using PmeⅠ restriction endonuclease, and the purified target gene and linearized vector backbone were homologously recombined using ClonExpressIIOneStep Cloning Kit to obtain the recombinant adenovirus plasmid pKAd5ES-Omicron-S2PL.

[0034] The vector linearization and homologous recombination system are as follows:

[0035] Table 1 Vector linearization system

[0036]

[0037] Linearization reaction conditions: 37°C, 2h; 65°C, 20min.

[0038] Table 2 Homologous recombination system

[0039]

[0040] Homologous recombination reaction conditions: 37°C, 30 min.

[0041] pKAd5ES-Omicron-S2PL was rescued and amplified in HEK 293 cells. Specifically, pKAd5ES-Omicron-S2PL was linearized by digestion with PacⅠ, and the linearized pKAd5ES-Omicron-S2PL was transfected into HEK 293 cells.

[0042] Table 3 PacⅠ vector linearization system

[0043]

[0044] Transfection reagent used: X-tremeGENE HP DNA Transfection Reagent.

[0045] Operation steps: Before transfection, place the serum-free medium opti-MEM (Gibico) and X-trem transfection reagent at room temperature (25°C) for 15 minutes. Take a 1.5mL centrifuge tube in the safety cabinet and place it on the centrifuge tube rack, mark it, add 180μlopti-MEM, and then add 20μl of the plasmid system linearized by PacⅠ in the previous step, and mix gently. Place the X-trem transfection reagent on an oscillator and shake it, add 5μl of transfection reagent to each tube, and incubate at room temperature for 15 minutes. All the transfection complexes (205μl) at the end of incubation are added dropwise to the six-well plate cells, gently mixed, and placed in a 37°C, 5% CO2 incubator for culture. When more than 90% of the cells show cytopathic effect (CPE), the cells are collected to obtain the primary virus (P0).

[0046] The P0 virus seed was inoculated into HEK293 cells in good growth state at a cell number of 1:10 for amplification and cultured in a 37°C, 5% CO2 incubator. When more than 90% of the cells showed cytopathic effect, the cell supernatant and precipitate were collected and used as the P1 virus seed to continue inoculating HEK293 cells. According to the above steps, the virus liquid was repeatedly frozen and thawed three times between room temperature (25°C) and -80°C each time it was harvested, until the third generation virus liquid (P3) was cultured, and the cell precipitate was retained by centrifugation at 2500rpm for 30min for purification.

[0047] The cell pellet of the third generation virus solution (P3) was collected and repeatedly frozen and thawed three times at room temperature (25°C) to -80°C, centrifuged at 13000 rpm for 30 min, and the supernatant was collected for cesium chloride density gradient centrifugation (25000 rpm, 2.5 h). The virus band was carefully aspirated with a syringe and purified by desalting gel.

[0048] Take 50 μL of the purified recombinant adenovirus (Ad5-Omicron-S2PL), stain it with phosphotungstic acid, and observe the virus morphology under a transmission electron microscope (FEI TECNAI 12). Under the electron microscope, the purified virus structure particles with icosahedral symmetry and no envelope can be observed ( Figure 1 B).

[0049] Western blot detection

[0050] HEK 293 cells were infected with Ad5-Omicron-S2PL, and cell lysates were collected after 24 hours. At the same time, normal cell lysates were collected as controls. Proteins were separated by SDS-PAGE electrophoresis, and the protein bands were transferred to PVDF membranes. The membranes were blocked with 5% skim milk at room temperature for 2 hours, and the primary antibody (SARS-CoV-2 Spike Antibody, Omicron Reactive, Mouse MAb, SinoBiological; β-Tubulin, Mouse mAb, Yeasen Biotechnology (Shanghai) Co., Ltd.) was incubated overnight at 4°C, and the secondary antibody (HRP-Goat anti-Mouse IgG, TransGen Biotech) was added for incubation for 1 hour. After each step, the membranes were washed with PBST, and ECL was added for color development to detect the specific expression of the target protein in HEK293 cells. Results: The expression of OmicronBA.1 was confirmed. The S protein appeared at the predicted molecular weight position ( Figure 1 C).

[0051] Example 2

[0052] Laboratory animals and immunization

[0053] SPF female BALB / c mice, 6 weeks old, were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd., animal use license number: SCXK (Beijing) 2021-0006. Ad5-Omicron-S2PL vaccine was administered by gavage, and BA.1-S-mRNA vaccine was administered by intramuscular injection in the thigh.

[0054] Intragastric inoculation: Before immunization, mice were fasted for 12 h. Each mouse was given 100 μl of intragastric protective solution and then allowed to rest for 5 min before being intragastrically inoculated with 100 μl of virus solution. 9 IU / mouse. Ingredients of intragastric protective solution ( / 100ml): 0.1g citric acid, 9.6g sodium citrate, 3.6g sucrose, 0.1g zinc chloride, 0.19g sodium chloride.

[0055] Intramuscular injection: 100 μl / mouse, injection dose is 20 μg, through the outer muscle of the hind limb.

[0056] The mice were divided into control group (Control), oral group (Omicron-S2PL), sequential immunization group (IN+Omicron-S2PL) and intramuscular injection group (IN+IN). All experimental groups of mice were immunized twice at week 0 and week 4 (the sequential immunization group (IN+Omicron-S2PL) was injected at week 0 and gavage at week 4), and blood, feces, bronchoalveolar lavage fluid (BALF) and spleen were collected at specific time points, and the mice were finally euthanized.

[0057] Blood: 200 μL of blood was collected from mice through the mandibular venous plexus, and after standing at room temperature for 1 hour, it was centrifuged at 2500 rpm / min for 15 minutes to separate the serum, inactivated at 56°C for 30 minutes, and stored at low temperature after aliquoting.

[0058] Feces: Collect the wet soft feces of mice, add PBS at 10% (W / V), vortex and oscillate at 13000 rpm / min, centrifuge for 10 min, collect the supernatant, and store it at low temperature after aliquoting.

[0059] Alveolar lavage fluid: Use a 1 mL syringe with a self-prepared lavage tube to draw 0.8 ml PBS (containing 2% BSA) to wash the lungs three times. Place the lower edge of the lavage tube at the branch of the left and right bronchus of the mouse. Recover the lavage fluid at 400 × g for 5 min at 4°C, collect the supernatant, and store it at low temperature after aliquoting.

[0060] Splenic lymphocytes: The mice were killed by cervical dislocation, and then soaked in a solution containing 75% ethanol for moistening. The spleen was removed, and a spleen single lymphocyte suspension was prepared using mouse lymphocyte separation solution (DAKEWE BIOTECH). For detailed operations, refer to the instruction manual.

[0061] Detection Methods

[0062] ELISA test

[0063] Serum specific binding antibody detection: The sample was diluted 3 times in a gradient, with the first well dilution ratio of 1:100. The IgG antibody titer was detected using a customized mouse IgG serum antibody detection kit (Vazyme), which was coated with Omicron S protein. The absorbance values ​​at 450nm and 630nm were detected using an ELISA reader (Multiskan GO, Thermo Fisher Scientific). 450-630 The value was higher than the negative control well by 2.1 times and greater than 0.2, which was considered positive. The results were expressed as Log10GMT, and the antibody titer was taken as logarithm for statistical analysis. 20 The control samples were judged as negative, and the IgA titer was <Log102 The control samples were judged as negative to facilitate statistical analysis.

[0064] S-specific and cross-reactive SIgA detection: First, the sample was diluted 2 times in a gradient, with the first well dilution ratio of 1:5. The S protein (SinoBiological) of BA.1 (Novoprotein), Delta, BA.2, XBB, BA.4 / BA.5 / BA.5.2 and JN.1 was diluted to 3μg / mL with ELISA coating solution, and the diluted protein was added to the ELISA plate, 100μl / well, and incubated at 4℃ overnight for 16h; after washing 3 times with PBST, 180μl / well blocking solution was added, and incubated at 37℃ for 2h; the blocking solution in the well plate was discarded, washed, and patted dry for use; the serum sample was serially diluted and added to the ELISA plate, incubated at 37℃ for 1h, washed, and incubated with secondary antibody (Abcam), incubated at 37℃ for 1h; after washing, patted dry thoroughly; color development, incubated at 37℃ in the dark for 10min; stop color development, mix gently, and read A with an ELISA reader 450-630 Value. 450-630 The value was higher than the negative control well by 2.1 times and greater than 0.2, which was considered positive. The results were expressed as Log10GMT, and the antibody titer was taken as logarithm for statistical analysis. 2 The control samples were judged as negative to facilitate statistical analysis.

[0065] Pseudovirus Neutralization Assay (PNA)

[0066] The diluted serum samples were mixed with pseudovirus (SARS-CoV-2-Fluc B.1.1.529, Vazyme) and incubated at 37°C, 5% CO2 for 1 hour. The mixture was then added to the pre-plated ACE2-293T cells and incubated for another 48 hours. The luciferase assay kit (Bio-Lite TM Luciferase Assay System, Vazyme) measures the chemiluminescence value (RLU) of cells to evaluate the activity of neutralizing antibodies. Each experimental batch contains a positive control serum with a known titer and a serum-free medium as a negative control. All experiments were repeated at least three times, and the results are expressed as mean ± standard deviation. The neutralizing antibody titer was calculated based on RLU, and the neutralization curve was drawn. IC 50 Values ​​were defined as the serum dilution required to inhibit 50% viral infection and were determined by nonlinear regression analysis.

[0067] IFN-γ and IL-4 ELISpot assays

[0068] Mice were killed by cervical dislocation, and mouse spleen cells were isolated. Stimulating peptides (SARS-CoV-2 SpikeGlycoprotein-Omicron-90%purity, GenScript) were used to detect cellular immune responses using IFN-γ and IL-4 ELISPOT kits (Dakoway). 4×10 5 The spleen cells were measured at a concentration of 10 cells / well. The operation steps are detailed in the instructions. The results were detected by ELISA and the number of cells per well was calculated. 6 The number of T cells secreting IFN-γ and IL-4 in each spleen cell (SFC / 10 6 ).

[0069] ASCs ELISpot test

[0070] Single spleen lymphocytes from mice were isolated and the expression of B cells producing specific IgA / IgG antibodies was analyzed using Mouse IgA (HRP) ELISpot Flex and Mouse IgG (HRP) ELISpot Flex. Diluted anti-IgG or IgA coated antibodies were added to PVDF plates (Millipore) and incubated overnight at 4°C. Cells were added and cultured for 20 hours at 37°C, 5% CO2. The spots were developed using biotinylated Omicron S protein (SinoBiological) and streptavidin-HRP (Mabtech) and counted by ELISpot plate reader (Mabtech).

[0071] Statistical analysis

[0072] GraphPad Prism 9.5.0 software was used for data analysis and plotting. One-way ANOVA test was used to compare the significance of the mean differences among the groups. The number of samples in each result graph is indicated in the legend. The symbols for statistical significance are: P<0.05(*), P<0.01(**), P<0.001(***), and P<0.0001(****).

[0073] Experiments and Results

[0074] Oral administration of Ad5-S2PL-Omicron induced specific serum IgG and intestinal SIgA in a dose-dependent manner

[0075] In order to study the effect of the oral vaccine (Ad5-Omicron-S2PL) on the humoral immune response, the subjects were randomly divided into four groups (6 mice in each group) and vaccinated with two doses of 10 7 ,10 8 ,10 9and 10 10 Virus infection titer (IU) was measured by immunization twice according to the above method, and samples were collected at multiple time points after vaccination ( Figure 2 A). The preliminary experimental results of administration at intervals of 3 weeks and 4 weeks showed no statistical difference in IgG antibody levels, so this example selected immunization at intervals of 4 weeks. The serum antibody level produced after vaccination showed a dose-dependent relationship with the vaccine dose under certain conditions.

[0076] For serum IgG, 10 9 The IgG antibody level produced by the IU dose group was higher than 10 7 and 10 8 IU dose group (P<0.05), suggesting that within the tested dose range, antibody production showed a certain degree of dose-dependent enhancement effect, indicating that increasing the vaccine dose can effectively improve the intensity of the immune response. 10 IU, the growth trend of antibody levels slowed down. After oral booster immunization, with the increase of vaccine dose, the level of specific IgG binding antibody showed an increasing trend. 10 IU and 10 7 The difference in antibody levels among the dose groups did not reach statistical significance (P>0.05) ( Figure 2 B).

[0077] For intestinal SIgA, the production of IgA antibodies was not effectively stimulated among the dose groups 3 weeks after the initial immunization. After booster immunization, we tested the IgA antibody levels at 5, 6, 9, and 12 weeks. The results showed that the IgA antibody level showed an overall upward trend with the increase of the vaccination dose. However, at 5 and 6 weeks, 10 9 and 10 10 There was no statistical difference in IgA antibody levels between the dose groups. 9 The IgA antibody level in the dose group was less than 10 10 There was a statistically significant difference between the two groups (P<0.05), but at week 12, this difference disappeared ( Figure 2 C).

[0078] Two oral doses of Ad5-S2PL-Omicron vaccine induce long-lasting specific antibody responses

[0079] 1×10 9 The immunization dose of virus infection titer (IU) was used to immunize mice according to the above method ( Figure 3A, 6 mice per group). After vaccination, we regularly tested the IgG antibody levels in the mouse serum and the SIgA antibody secretion in the intestine from the 3rd to the 20th week. The latter was analyzed by fecal samples. The experimental results showed that after vaccination, the IgG antibody level in the mouse serum increased significantly, up to 1×10 5 level and remained relatively stable over the next few weeks ( Figure 3 B). This high level of antibody maintenance indicates that the vaccine induces a strong humoral immune response and that this response can be maintained for a long time. Serum neutralizing antibody titers increased significantly after booster immunization, reaching a peak at week 8, and these values ​​were 4.50 times higher than those at week 6 (95% CI 1.43-7.57) ( Figure 3 C). Subsequently, the neutralizing antibody titer began to steadily decrease until the 16th week. The level of SIgA antibodies in the intestine also increased significantly after the second booster immunization, and then remained stable at a certain level until it began to slowly decrease at the 14th week. By the 20th week, the IgA antibody level had basically returned to the level before the second booster immunization ( Figure 3 D) The results show that twice 1×10 9 An oral dose of 1 IU of the vaccine induced significant and durable humoral and mucosal immune responses in mice.

[0080] Two doses of oral Ad5-S2PL-Omicron vaccine induce broad systemic and mucosal immune responses

[0081] To evaluate the cross-protection of oral vaccines, Figure 4 The immunization schedule in A is to vaccinate 2 doses of 1 × 10 9 Neutralizing antibodies were detected in serum and BALFs of BALB / c mice after oral vaccination with 100 IU of Ad5-Omicron-S2PL. Oral vaccination elicited strong serum neutralizing antibodies that were biased toward BA.1. In addition, broadly neutralizing antibodies were also produced against the pre-Omicron strains wild type (WT), Alpha, and Delta, but the titers were reduced by at least 3-fold (WT) and 7-fold (Alpha and Delta) ( Figure 4 B). We detected a significant increase in neutralizing activity against BA.1 and wild type (WT) in mouse BALF, and a decrease in neutralizing activity against Alpha and Delta ( Figure 4 C). Serum IgA and mucosal SIgA antibody titers were measured using ELISA. The total serum IgA titer (102.5017) was significantly higher than the BALFs and intestinal SIgA titers (1.66 times), and the latter two titers were the same ( Figure 4D). The results showed that the vaccine not only increased the production of blood IgA, but also promoted the synthesis of SIgA on mucosal surfaces such as the intestine and respiratory tract. In another study, cross-reactive SIgA was detected in BALF. SIgA bound to BA.1, Delta, BA.2, XBB, BA.4 / BA.5 / BA.5.2, and JN.1S proteins, but no significant differences were found between the groups ( Figure 4 E). All data are shown as mean ± SD (n = 6), and individual data are shown.

[0082] Two doses of oral Ad5-S2PL-Omicron vaccine enhance T / B cell immune responses

[0083] To evaluate the T / B cell immune response induced by oral vaccines, two doses of 1×10 9 IU oral vaccination was performed one week after the mice were harvested. Lymphocytes were then isolated and obtained for ELISpot assay ( Figure 5 A). We further performed IFN-γ and IL4 ELISpot assays using stimulatory peptides to evaluate S protein-specific T cell responses. One week after two doses of immunization, the IFN-γ level produced by mice stimulated by two doses of Ad5-Omicron-S2PL was as high as 413.25 (95% CI 171.52-654.98) SFC / 1×10 6 The difference was statistically significant compared with the control group (P<0.001)( Figure 5 B). However, Ad5-Omicron-S2PL failed to effectively stimulate the production of IL-4, with no statistical difference compared to the control group (P>0.05). The results showed that two oral doses of Ad5-Omicron-S2PL induced Th1-biased cytokine expression (IFN-γ) and lacked Th2 cells that produced IL-4 expression ( Figure 5 B). The ability of oral vaccines to induce B cells that produce antigen-specific antibodies was evaluated using the ASC assay ( Figure 4 C). One week after two oral doses of vaccine, 5 / 6 mice (83.3%) and 6 / 6 mice (100%) in the same group developed IgA+ and IgG+ ASC responses expressing S protein, respectively. 6 An average of 9.1 IgA+ ASCs (95% CI 7.6-10.7) and 4.2 IgG+ ASCs (95% CI 3.0-5.3) were detected per spleen lymphocyte. Background ASC spot numbers were generally negligible. All data are shown as mean ± SD (n = 6), and individual data are shown.

[0084] Oral Ad5-Omicron-S2PL booster augments systemic and mucosal immune responses with BA.1-S-mRNA vaccine

[0085] Next, in order to explore the potential application strategy of oral adenovirus vector COVID-19 vaccine, the immunization method of combining BA.1-S-mRNA vaccine with oral vaccine was evaluated. First, 20μg BA.1-S-mRNA vaccine was used for primary immunization (week 0), followed by booster immunization with homologous vaccine (BA.1-S-mRNA) and heterologous vaccine (Ad5-Omicron-S2PL) respectively (week 4), and samples were collected at week 9 ( Figure 6 A). Heterologous boosting with oral vaccine resulted in the production of SIgA in BALFs that was cross-reactive against the S proteins of WT, Delta, and different Omicron mutants (BA.1, BA.2, XBB, BA.4 / BA.5 / BA.5.2, and JN.1). Figure 6 B). Heterologous boosting resulted in increased neutralizing antibody titers against BA.1 (1.6-fold), WT (2.3-fold), Alpha (2.0-fold), and Delta (2.8-fold). Figure 6 C). In addition, allogeneic boosting also increased the expression of T cells secreting IFN-γ and IL-4 ( Figure 6 D). All data are shown as mean ± SD (n = 6), and individual data are shown.

[0086] From the above examples, it can be seen that different vaccine doses (10 7 ,10 8 ,10 9 ,10 10 The dynamic changes of antibody responses caused by viral infection titer (IU) showed a certain dose dependence. In addition, the booster immunization strategy significantly increased the SIgA antibody level in the high-dose vaccine group, suggesting the necessity of booster immunization under oral vaccination. In general, the immune response is usually proportional to the dose administered. Given that higher doses indicate the possibility of more adverse reactions, 10 9 IU and 10 10 IU induced similar high levels of antibodies after booster immunization. Therefore, based on the consideration of safety and cost-effectiveness, we chose 10 9 IU doses were used in subsequent studies.

[0087] The rising trend of neutralizing antibody levels indicates that oral Ad5-Omicron-S2PL vaccine can induce strong neutralizing antibody production in mice, which significantly increased after booster immunization and reached a peak around the 8th week, then steadily declined, stimulating a sustained immune response, which is beneficial for the booster immunization strategy of the vaccine. The results also suggest that the second dose of vaccine can effectively enhance the specific immune response and provide stronger protection for the body. The level of SIgA antibodies in the intestine of mice persisted for 20 weeks, and there was a downward trend in the later period, but it was produced stably for a considerable period of time. This shows that two oral doses of 10 9 IU dose of Ad5-Omicron-S2PL vaccine was able to induce strong and persistent humoral and mucosal immune responses in mice for a considerable period of time.

[0088] This study examined the response level of SIgA antibodies to S antigen in the intestinal immune site and distal respiratory mucosa after oral vaccination. The results showed that the titer of S protein-specific SIgA antibodies in fecal suspension and BALF was as high as 10 1.507 , which is an important advantage of oral vaccines and an important feature of the common mucosal immune system. In addition, a wide range of cross-reactive SIgA and neutralizing antibodies were generated in BALFs.

[0089] The cellular immune response showed that the vaccine could induce specific T cell responses, mainly the expression of IFN-γ secretory cytokines, showing a helper T cell (Th1) bias, while traditional T cells were diverse in both phenotype and function.

[0090] This study also found that the BA.1-S-mRNA vaccine could not independently initiate a mucosal immune response if an oral vaccine was not present. Compared with a single oral vaccine immunization, oral vaccine boosters based on the BA.1-S-mRNA vaccine induced stronger cross-reactive SIgA antibody production. In addition, oral vaccine booster immunization increased BA.1-biased serum antibody titers. Therefore, the use of oral vaccine boosters on the basis of BA.1S-mRNA vaccines can induce a wide range of mucosal and systemic neutralizing antibodies. This emphasizes that after completing the basic vaccine injected intramuscularly, simply strengthening and improving the protective efficacy of the vaccine through oral administration will greatly improve the convenience and popularity of vaccination.

[0091] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A combined COVID-19 vaccine, characterized in that: The combined new coronavirus vaccine includes Ad5-Omicron-S2PL oral vaccine and BA.1-S-mRNA injectable vaccine.

2. The combined COVID-19 vaccine according to claim 1, characterized in that: The preparation method of the Ad5-Omicron-S2PL oral vaccine is as follows: (1) Omicron-S2PL was used as the target gene and homologously recombined with the adenovirus vector backbone to obtain the recombinant adenovirus plasmid pKAd5ES-Omicron-S2PL; (2) After the pKAd5ES-Omicron-S2PL is linearized, the transfected cells are rescued and amplified, and the virus liquid is collected to obtain the Ad5-Omicron-S2PL oral vaccine.

3. The combined COVID-19 vaccine according to claim 2, characterized in that: The nucleotide sequence of the Omicron-S2PL is shown in SEQ ID NO:

1.

4. The combined COVID-19 vaccine according to claim 3, characterized in that: The adenovirus vector backbone is pKAd5ES-pmeI.

5. The combined COVID-19 vaccine according to claim 4, characterized in that: The transfected cells are HEK 293 cells.

6. Use of the combined COVID-19 vaccine according to any one of claims 1 to 5 in the preparation of a vaccine preparation for immunity to COVID-19.

7. The use according to claim 6, characterized in that The new coronavirus is Omicron.

8. The use according to claim 7, characterized in that The combination vaccine jointly enhances systemic and mucosal immune responses and increases the expression of T cells that secrete IFN-γ and IL-4.

9. The use according to claim 8, characterized in that The combined new coronavirus vaccine first administers an intramuscular injection of the BA.1-S-mRNA vaccine, followed by an oral administration of the Ad5-Omicron-S2PL vaccine, with the immunizations spaced apart.

Images