Application and method of KLF5 transcription factor in regulation and control of porcine skeletal muscle development

Abstract

The invention discloses an application of a transcription factor KLF5 in a KLF family with maximum differential expression in slowly oxidized solefish muscle (SOL) and fast glycolytic extensor toe muscle (EDL) tissues in regulation and control of pig skeletal muscle development, and the specific expression in a specific type of muscle is regulated and controlled by analyzing tissue specific enhancer-promoter interaction and a synergistic transcription factor. The invention discloses and verifies that KLF5 can regulate the activity of a super enhancer interacting with MYH1 / 4 genes (MYH1 and MYH4 genes), improve the interaction frequency of the super enhancer interacting with the MYH1 / 4 genes and a gene promoter, promote transcription of the MYH4 and MYH1 genes and induce formation of rapid glycolytic muscle fibers. A new breeding target can be provided for pork quality improvement, and theoretical reference can be provided for directionally changing the muscle fiber type proportion by applying a functional site mutation technology; and a new method is provided for improving the proportion of red meat in the pork and improving the quality of the slaughtered pork.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and in particular to an application and method of a KLF5 transcription factor in regulating pig skeletal muscle development. Background Art

[0002] Skeletal muscle accounts for 40-60% of the total body weight. It is the main tissue that provides livestock and poultry meat products. It is also the main organ for regulating glucose metabolism and maintaining blood sugar homeostasis. The differences in contractile ability and glycogen metabolism of different types of muscle fibers lead to different composition ratios of different types of muscle fibers, which directly affect the quality of livestock and poultry muscles and the body's sensitivity to metabolic diseases. The metabolic diversity, plasticity and fiber type composition of muscle fibers lead to different muscle characteristics. According to the expression of myosin heavy chain (MyHC) subtypes of muscle fibers, they can be mainly divided into slow muscle fibers and fast muscle fibers. Slow muscle fibers mainly express MYH7 (MyHC I), and fast muscle fibers express MYH1 (MyHC IIa) and MYH4 (MyHCIIb). Among them, slow muscle fibers are conducive to oxidative metabolism and endurance, while fast muscle fibers are mainly conducive to glycolytic activities and contract faster.

[0003] Although the total number of muscle fibers remains stable in adults, the composition of muscle fiber types can adapt to external stimuli such as aging, exercise, or disease. In obesity and type 2 diabetes, the shift from oxidative slow-twitch fibers to glycolytic fast-twitch fibers leads to impaired insulin sensitivity, reduced metabolic flexibility, and insulin resistance. In livestock production, the soleus muscle (SOL), which is rich in slow-twitch fibers, has superior meat quality, characterized by redder meat color, greater water retention, and lower tenderness, compared with the fast-twitch extensor digitorum longus (EDL). A deeper understanding of the regulatory mechanisms of muscle fiber determination and conversion could provide therapeutic insights and strategies for improving meat quality and human metabolic diseases.

[0004] Cis-regulatory elements (CREs), including enhancers and promoters, are defined by specific epigenetic features and regulate gene expression through cell-type-specific chromatin loops. Superenhancers (SEs) are large clusters of enhancers and key regulators of lineage-specific gene expression. SEs coordinate with chromatin regulators to form extensive intra-TAD loops to achieve precise gene activation expression. However, the genome-wide dynamics of enhancer-promoter interactions (EPs) between muscles, especially their role in shaping muscle-specific phenotypes, are still unclear. Therefore, further research is needed to provide new methods and ideas for muscle regulation. Summary of the invention

[0005] The purpose of the present invention is to provide an application and method of a KLF5 transcription factor in regulating the development of pig skeletal muscle, so as to provide a new method and idea for regulating the development of pig skeletal muscle, and to apply the KLF5 transcription factor to regulate the development of pig skeletal muscle to regulate the muscle fiber type of pigs, and to provide new ideas and methods for improving meat quality.

[0006] According to a first aspect of the present invention, there is provided an application of KLF5 transcription factor in regulating the development of pig skeletal muscle, thereby effectively regulating the type of pig muscle fibers and the development of pig skeletal muscle.

[0007] According to a second aspect of the present invention, there is provided an application of KLF5 transcription factor in preparing a product capable of regulating the development of pig skeletal muscle. Thus, through this application, the type of pig muscle fibers and the development of pig skeletal muscle can be effectively regulated.

[0008] According to a third aspect of the present invention, there is provided an application of an agent that promotes or inhibits KLF5 transcription factor in regulating the development of pig skeletal muscle. Thus, through this application, pig muscle fiber type and pig skeletal muscle development can be effectively regulated.

[0009] According to a fourth aspect of the present invention, there is provided the use of an agent that promotes or inhibits KLF5 transcription factor in the preparation of a product that can regulate the development of pig skeletal muscle. Thus, through this application, the type of pig muscle fibers and the development of pig skeletal muscle can be effectively regulated.

[0010] In certain embodiments, the regulating pig skeletal muscle development refers to regulating the transformation of pig muscle fiber types by regulating the expression of KLF5 transcription factor.

[0011] According to a fifth aspect of the present invention, a method for regulating the type of pig muscle fibers is provided, wherein the method regulates the transformation of pig muscle fiber types by regulating the expression of KLF5 transcription factor. Thus, by regulating the expression of KLF5 transcription factor, the transformation of pig muscle fibers and the development of pig skeletal muscle can be regulated, which can be used to improve the quality of pork.

[0012] In certain embodiments, the method comprises injecting or transfecting a KLF5 overexpression vector to promote the expression of KLF5, thereby promoting the formation of glycolytic fast muscle fibers, inhibiting the formation of oxidative slow muscle fibers, or promoting the transformation of oxidative slow muscle fibers into glycolytic fast muscle fibers.

[0013] In certain embodiments, the nucleotide sequence of the KLF5 overexpression vector is shown as SEQ ID No:14.

[0014] In certain embodiments, the method comprises promoting the formation of oxidative slow muscle fibers, inhibiting the formation of glycolytic fast muscle fibers, or promoting the transformation of glycolytic fast muscle fibers into oxidative slow muscle fibers by inhibiting the expression of KLF5.

[0015] According to the sixth aspect of the present invention, the application of KLF5 transcription factor in regulating the activity of super enhancers (hereinafter referred to as "SE-MYH1 / 4") that interact with MYH1 and MYH4 genes is provided. Thus, in this application, SE-MYH1 / 4 enhancer activity is regulated by overexpressing KLF5, the interaction frequency of SE-MYH1 / 4 with gene promoters is regulated, and then MYH1 / 4 gene expression is regulated, the formation of glycolytic fast muscle fibers is promoted, and the regulation of muscle fiber types is achieved.

[0016] According to the seventh aspect of the present invention, there is provided an application of KLF5 transcription factor in increasing the interaction frequency between super enhancers interacting with MYH1 and MYH4 genes (hereinafter referred to as "MYH1 / 4 genes") and gene promoters. Thus, in this application, by overexpressing KLF5, the interaction frequency between SE-MYH1 / 4 and gene promoters can be increased, thereby regulating MYH1 / 4 gene expression, promoting the formation of glycolytic fast muscle fibers, and achieving regulation of muscle fiber types.

[0017] According to an eighth aspect of the present invention, there is provided an application of KLF5 transcription factor in promoting the transcription or expression of MYH4 and MYH1 genes. Thus, in this application, by overexpressing KLF5, the expression of MYH1 / 4 genes is promoted, the formation of glycolytic fast muscle fibers is promoted, and the regulation of muscle fiber types is achieved.

[0018] According to the ninth aspect of the present invention, there is provided a kit / nucleic acid molecule / recombinant protein / recombinant vector / product containing a KLF5 transcription factor expression regulator for use in regulating the transformation of pig muscle fiber types. Thus, through this application, the regulation of pig muscle fiber type transformation and the regulation of pig skeletal muscle development can be achieved.

[0019] Beneficial effects of the present invention: The present invention discloses the application of the transcription factor KLF5 in the KLF family with the greatest differential expression in the slow oxidative soleus muscle (SOL) and the fast glycolytic extensor digitorum longus muscle (EDL) tissues in regulating the development of pig skeletal muscle. By analyzing the tissue-specific enhancer-promoter interaction and the specific expression of the coordinated transcription factor regulation in a specific type of muscle, it is revealed and verified that KLF5 can regulate the enhancer activity of SE-MYH1 / 4, increase the interaction frequency between SE-MYH1 / 4 and the gene promoter, promote the transcription of MYH4 and MYH1 genes, and induce the formation of fast glycolytic muscle fibers. It can provide new breeding targets for improving pork quality and provide a theoretical reference for the application of functional site mutation technology to change the proportion of muscle fiber types; it also provides a new method for improving the proportion of red meat in pork and the quality of pork after slaughter. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The results of SE identification and characteristic analysis are shown in Figure 1. Figure 1 A is the annotation of SE, and 554 and 592 super enhancers were identified in SOL and EDL tissues, respectively; Figure 1 B is the proportion of super enhancers with specificity in EDL and SOL tissues; Figure 1 C shows the location of super enhancers, most of which are located in conserved topological domains;

[0021] Figure 2 The results of the analysis of super enhancers promoting the formation of glycolytic muscle fibers through chromatin looping: Figure 2 A shows the heat map of expression characteristics of SOL-specific super-enhancer interacting genes, EDL-specific super-enhancer interacting genes, and genes interacting with both SOL and EDL and super-enhancers; Figure 2 B is an IGV analysis showing that the MYH4 gene encoding MyHC IIb type and the MYH1 gene encoding MyHC IIx type in EDL tissue interact with a 42-kb long EDL-specific super enhancer (SE-MYH1 / 4); Figure 2 C is the reconstruction of the three-dimensional chromatin conformation model of MYH1 and MYH4 genes, exploring the spatial distance between SE-MYH1 / 4 and the promoters of MYH1 and MYH4 genes;

[0022] Figure 3The result diagram of KLF5 promoting super enhancer SE-MYH1 / 4-mediated chromatin three-dimensional interaction: Figure 3 A is the result of footprint analysis of super enhancers. Diff indicates the difference in the proportion of transcription factors with at least one binding site in super enhancers in SOL and EDL. FC indicates the difference in expression of transcription factors in SOL and EDL tissues. Figure 3 B is the result of differential analysis of transcription factor footprints to identify the proportion of super enhancers bound by the KLF transcription factor family in SOL and EDL tissues; Figure 3 C is the result of the binding analysis of the KLF transcription factor family on SE-MYH1 / 4;

[0023] Figure 4 The results of CRISPR-cas9 experiments verifying the regulation of SE-MYH1 / 4 on the expression of MYH1 and MYH4 genes in muscle fibers: Figure 4 A is a graph showing the results of the dual luciferase reporter experiment to verify enhancer activity, where Vector represents the control group, SE-MYH1 / 4-E1 represents the E-MYH1 / 4-E1 recombinant plasmid group, and SE-MYH1 / 4-E2 represents the SE-MYH1 / 4-E2 recombinant plasmid group; Figure 4 B is the experimental model diagram of CRISPR-cas9; Figure 4 C is the result of PCR electrophoresis experiment to verify the cutting efficiency of SE-MYH1 / 4; Figure 4 D is the result of qPCR detection of the changes in the expression of muscle fiber marker genes MYH1 and MYH4 before and after super enhancer knockout, in which * represents P < 0.05, ** represents P < 0.01, and *** represents P < 0.001;

[0024] Figure 5 This is the differential expression diagram of the binding ability of KLF5 and SE-MYH1 / 4 in SOL and EDL tissues;

[0025] Figure 6 The results of ChIP-qPCR experiments verifying the enhanced enrichment of H3K27ac after overexpression of KLF5: EV represents the control group, OV-KLF5 represents the overexpression of KLF5 group, IgG represents detection by immunoglobulin G antibody, IP represents detection by H3K27ac antibody, and ** represents P < 0.01 in the figure;

[0026] Figure 7 This is the result of the dual luciferase experiment verifying that overexpression of KLF5 enhances the enhancer activity of SE-MYH1 / 4. In the figure, *** represents P < 0.001;

[0027] Figure 8The results of 3C-qPCR experiments verifying that KLF5 promotes the interaction between SE-MYH1 / 4 and MYH4 and MYH1: EV represents the control group, OV-KLF5 represents the overexpression KLF5 group, and the horizontal axis represents the interaction results of the internal reference genes ACTB, MYH1, and MYH4 in the overexpression KLF5 group and the control group. In the figure, ** represents P<0.01, and *** represents P<0.001;

[0028] Fig. 9 This is the result of qPCR showing the changes in the expression of MYH1 and MYH4 after KLF5 overexpression: EV represents the control group, OV-KLF5 represents the KLF5 overexpression group, the horizontal axis represents the relative mRNA expression levels of KLF5, MYH1, and MYH4 in the KLF5 overexpression group and the control group, and *** in the figure represents P<0.001. DETAILED DESCRIPTION

[0029] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0030] Example 1: Discover regulatory factors that can regulate pig skeletal muscle development.

[0031] The muscle tissue of the pig was collected, and the SOL and EDL tissue samples of the pig were ground into fine powder using a freezing grinder. 2% formaldehyde was added to fix at room temperature for 10 minutes, and a certain volume of glycine solution was added to make the final concentration 0.2M, and the reaction was carried out at room temperature for 5 minutes. After the termination, centrifuge at 1500r / min for 5 minutes, and the supernatant was removed. Add one volume of PBST solution to resuspend the cells, centrifuge at 1500r / min for 5 minutes, and remove the supernatant. Add 350μL cold Hi-C lysis buffer (15mM Tris-HCl, 15mM NaCl and 0.2% Igepal) and mix, and incubate the reaction product on ice for 20 minutes. Then resuspend the lysed cell mass with 50μL 0.5% SDS solution. Incubate at 65℃ for 10 minutes. Then add Triton X-100 and incubate at 37℃ for 20 minutes to terminate the reaction. Add 100UAlu I restriction endonuclease and digest overnight at 37℃. The enzyme digestion reaction was terminated at 62°C for 20 minutes. The end of the DNA fragment was then incubated at 37°C with a biotin mixture and DNA polymerase. The DNA was ligated using T4 DNA ligase by slowly rotating the reaction at room temperature for 4 hours. 5 μL of 20 mg / mL proteinase K and 12 μL of 10% SDS solution were added to the post-reaction system and incubated at 55°C for 30 minutes. 13 μL of NaCl (5M) solution was added and incubated at 68°C overnight to dissolve the cross-links. The DNA was then precipitated at -80°C using DNA purification solution (15 μL of sodium acetate solution (3M), 1 μL of glycogen and 240 μL of anhydrous ethanol), washed twice with 75% alcohol, and finally dissolved with an appropriate amount of water. The purified DNA was sheared using Covaris S220 to ensure that the fragments were in the range of 300-500 bp. Subsequently, the Hi-C library was constructed according to the instructions of the Illumina library construction kit (GenSeq, GS-EG-003) and sequenced on the Illumina HiSeq X TenPE150 platform.

[0032] The sequencing results of Hi-C libraries of pig SOL and EDL tissues are as follows Figure 1 As shown in the figure, the results showed that 554 and 592 candidate SEs were identified in SOL and EDL tissues, respectively. Figure 1 A), and found that approximately 35% of SEs were tissue-specific ( Figure 1 B), and most of them are located inside TADs, with only about 3.2% of SEs located at the TAD boundary ( Figure 1 C). In addition, more than 80% of SEs are located within conserved TADs ( Figure 1 C), suggesting the important role of SE in gene regulation.

[0033] By further analyzing the sequencing results of the Hi-C library of pig SOL and EDL tissues, the results are as follows Figure 2 As shown in the figure, 365 and 673 super enhancer-promoter interactions (SE-P) were identified in SOL and EDL tissues, respectively, involving 744 expressed genes, including 46 differentially expressed genes. The specificity of these interactions in tissues was divided into three categories: the first category is SOL-specific super enhancer-interacting genes; the second category is EDL-specific super enhancer-interacting genes; the third category is genes that interact with super enhancers in both SOL and EDL, such as Figure 2 As shown in A. In EDL tissues, the MYH4 gene encoding the fermentative MyHC IIb type and the MYH1 gene encoding the MyHCIIx type both interact with a 42-kb EDL-specific super enhancer (SE-MYH1 / 4 for short) ( Figure 2 B). Chromatin region interaction analysis also confirmed that SE-MYH1 / 4 interacted more frequently with MYH1 and MYH4 promoters in EDL tissues than in SOL tissues. Using Genomeflow software, a three-dimensional chromatin model of the region near the MYH1 and MYH4 genes was reconstructed ( Figure 2 C), the results confirmed that in EDL tissue, SE-MYH1 / 4 was closer to the promoters of MYH1 and MYH4 genes, indicating that this super enhancer may promote the formation of glycolytic muscle fibers through chromatin looping.

[0034] Further analysis revealed that the KLF and AP-1 transcription factor families had the largest difference in the proportion of SE binding between the two tissues ( Figure 3 A). Specifically, compared with SOL tissue, SE in EDL tissue was more likely to be bound by the KLF transcription factor family, while SE was less likely to be bound by the AP-1 transcription factor family. Finally, differential analysis of transcription factor footprints identified that the KLF transcription factor family had a stronger ability to bind to chromatin open regions in EDL ( Figure 3 B). Based on these results, we focused on the binding of the KLF transcription factor family to the super enhancer SE-MYH1 / 4 and found that KLF5 was highly expressed in EDL tissues, had a stronger ability to bind to the open chromatin region, and bound to the EDL-specific super enhancer SE-MYH1 / 4 ( Figure 3 C), indicating that KLF5 transcription factor can promote the three-dimensional chromatin interaction mediated by super enhancer SE-MYH1 / 4. It is speculated that KLF5 transcription factor may be used to regulate pig skeletal muscle development.

[0035] Example 2: CRISPR-cas9 experiment verifies the regulation of SE-MYH1 / 4 on the expression of fast muscle fiber marker genes.

[0036] 2.1 Dual luciferase reporter gene experiment.

[0037] Based on the results in Example 1 and using ROSE software, two candidate enhancers were selected: SE-MYH1 / 4-E1 and SE-MYH1 / 4-E2, wherein SE-MYH1 / 4 represents a super enhancer interacting with the MYH1 / 4 gene, and SE-MYH1 / 4-E1 and SE-MYH1 / 4-E2 represent the conserved common enhancers E1 and E2 in the super enhancer SE-MYH1 / 4, respectively. The nucleotide sequence of SE-MYH1 / 4-E1 is shown in SEQ ID No: 1, and the nucleotide sequence of SE-MYH1 / 4-E2 is shown in SEQ ID No: 2.

[0038] The pGL3-Promoter plasmid (Shanghai Zeye Biotechnology Co., Ltd., ZY6726) was double-digested with restriction endonucleases (KpnⅠ and XbaⅠ) and then ligated. The recombinant plasmids after ligation were recorded as SE-MYH1 / 4-E1 recombinant plasmid and SE-MYH1 / 4-E2 recombinant plasmid, respectively. The recombinant plasmids after ligation were then transformed into competent cells and the plasmid was extracted.

[0039] The SE-MYH1 / 4-E1 recombinant plasmid or SE-MYH1 / 4-E2 recombinant plasmid was transfected into porcine skeletal satellite cells using Lipofectamine 3000 and Opti-MEM. In the control group, only the pGL3-Promoter empty vector was transfected into porcine skeletal satellite cells. The experimental groups were transfected with SE-MYH1 / 4-E1 recombinant plasmid (SE-MYH1 / 4-E1 recombinant plasmid group) and SE-MYH1 / 4-E2 recombinant plasmid (SE-MYH1 / 4-E2 recombinant plasmid group), and each plasmid transfection operation was repeated at least 3 times. After 72 hours of incubation, the cells were collected and the fluorescence value was measured using the instructions of the dual luciferase reporter gene assay kit (YEASEN, 11402ES60). The results are shown in Figure 2. Figure 4 As shown in A: Compared with the control group (indicated by Vector), the fluorescence values ​​of the SE-MYH1 / 4-E1 recombinant plasmid group and the SE-MYH1 / 4-E2 recombinant plasmid group were significantly increased (P<0.001), indicating that the conserved common enhancer (TE) within the super enhancer SE-MYH1 / 4 has significant enhancer activity in pig skeletal muscle satellite cells.

[0040] 2.2CRISPR-cas9 experiment.

[0041] (1) sgRNA design for candidate enhancers (SE-MYH1 / 4-E1, SE-MYH1 / 4-E2)

[0042] Design sgRNA sequences for the above two candidate enhancers (SE-MYH1 / 4-E1, SE-MYH1 / 4-E2) respectively (model as follows Figure 4 B), and add BbsI restriction sites at the 5' end of the forward and reverse strands of the sgRNA as needed (the sgRNA sequences are shown in Table 1).

[0043] Table 1 sgRNA sequences

[0044]

[0045] (2) Construction and identification of CRISPR / Cas9 recombinant plasmid.

[0046] The px330 plasmid (Addgene, 42230) was selected as the vector backbone to construct the targeting vector, and the restriction endonuclease BbsI was used to linearize the px330 vector.

[0047] The linearized px330 vector was connected to the sgRNA sequence fragments shown in Table 1, and the connected recombinant plasmid was transformed (10 μL of the connected product was added to 100 μL of competent cells and then mixed and transformed), and the plasmid extracted after transformation was sequenced. After detecting the successful insertion of sgRNA, the recombinant px330 plasmid was stored at -20°C for subsequent transfection experiments.

[0048] (3) Transfection of CRISPR / Cas9 recombinant plasmid.

[0049] Uncontaminated PSC cells (porcine skeletal muscle satellite cells) were revived, and when the cells grew to 80% to 90% confluence, the cells were digested and subcultured in 12-well plates for culture. When the cells grew to 60% to 80% confluence, liposome transfection was performed, and each plate of cells was divided into two groups, 6 wells for the treatment group: co-transfection of recombinant px330 plasmid and pCDNA3.1-EGFP empty plasmid (Qiyun Biology, QP1135), 6 wells for the negative control group: co-transfection of px330 empty plasmid and pCDNA3.1-EGFP empty plasmid of the same quality as the treatment group, and the growth medium was replaced 24 hours after transfection. In order to screen positive cells, G418 drugs were added to each well to a final concentration of 200ng / uL, and placed in a 37°C incubator for continuous culture for 10 days. During the period, daily observations were made and the culture medium and drugs were replaced every three days according to the cell growth. On the 11th day of G418 treatment, when nearly half of the cells had died, the cells were collected for subsequent detection.

[0050] The collected cells were subjected to genomic DNA extraction, and then the genomic DNA was amplified by ordinary PCR. After the electrophoresis detection bands were qualified, sequencing was performed to identify the knockout effect and efficiency of the cells, and the expression of MYH1 and MYH4 genes was quantitatively detected. The results showed that the sgRNA target sites of the conserved TEs (SE-MYH1 / 4-E1, SE-MYH1 / 4-E2) of the two super enhancers in PSC cells were effective and were all cut (such as Figure 4 C). Moreover, the quantitative results also showed that after knocking out SE-MYH1 / 4-E1 and SE-MYH1 / 4-E2, the expression of fast muscle marker genes MYH1 and MYH4 genes decreased significantly ( Figure 4 D)

[0051] The above results indicate that in pig skeletal muscle satellite cells, the conserved enhancer within SE-MYH1 / 4 has enhancer activity, and site-directed knockout will cause a decrease in the expression of fast-twitch muscle fiber marker genes MYH1 and MYH4, proving that the super enhancer SE-MYH1 / 4 can regulate the expression of pig skeletal muscle fast-twitch muscle fiber marker genes MYH1 and MYH4.

[0052] Example 3: ATAC-seq footprint analysis of KLF5 expression differences in SOL and EDL. 1. Experimental procedures.

[0053] About 5 mg of porcine muscle tissue samples were crushed into fine powder using a cryo-grinder. 5 mL of pre-frozen PBS solution was then added to the crushed muscle tissue and gently rotated for 10 minutes. The cell pellet was resuspended in 1 mL of lysis buffer (containing 50 mM HEPES, 150 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40 and 0.25% Triton X-100), and 50,000-100,000 nuclei were isolated according to the published library construction process steps. The transposition reaction mixture containing Tn5 transposase was then added to the isolated muscle cell nucleus suspension and incubated at 37°C for 2 hours. The reaction product was purified using a DNA purification kit. The purified DNA fragments were amplified using PCR technology, and the amplified products were selected for DNA fragments by gel product purification and other experiments to ensure that the size was between 100 and 600 bp. The selected products were then sequenced by PE150 on the Illumina HiSeq X Ten platform.

[0054] 2. Data analysis.

[0055] Transcription factor footprint analysis uses TOBIAS software with default parameters to identify footprint regions from chromatin open regions. Information such as motifs of transcription factors were downloaded from the JASPAR database (https: / / jaspar.elixir.no / ). Transcription factors with gene expression levels TPM>1 in at least one tissue were used for subsequent analysis.

[0056] 3. Result analysis.

[0057] According to Example 1, it was found that super enhancers have abundant transcription factor binding sites, and their functions require the synergistic action of transcription factors. The KLF transcription factor family has the largest difference in the proportion of super enhancers bound to super enhancers in EDL and SOL tissues. Compared with SOL tissue, SE in EDL tissue is bound by the KLF transcription factor family at a higher proportion. Therefore, the difference in the ability of the KLF transcription factor family to bind to chromatin open regions in EDL and SOL is further identified by differential analysis of transcription factor footprints. The results are shown in FIG. Figure 5 As shown, ATAC-seq footprint analysis showed that KLF5 showed different binding patterns in SOL and EDL tissues, and KLF5 had a higher binding ability to EDL compared with SOL.

[0058] Example 4: Amplification of KLF5 fragment and construction of KLF5 overexpression vector (denoted as OV-KLF5 vector).

[0059] Primer design: Search the porcine KLF5 gene (ID: 100038005) on the ensemble website, screen out the predicted transcript (ID: NM_001097489), obtain its CDS sequence (sequence as shown in SEQ ID No: 11), and use the primer design function on the NCBI website (http: / / www.ncbi.nlm.nih.gov / ) to design CDS region amplification primers. The primers are shown in Table 2:

[0060] Table 2 Amplification primers for porcine KLF5

[0061]

[0062] Note: The underlined part is the restriction endonuclease site.

[0063] Then, pig cDNA was used as a template and the primers in Table 2 were used for PCR amplification to amplify the CDS region fragment of KLF5. After sequencing to confirm that the sequence was correct, it was recovered and purified for subsequent experiments.

[0064] The CDS region fragment of KLF5 and the eukaryotic gene expression vector pcDNA3.1 (Qiyun Biology, QP1673) were digested with the same restriction endonuclease (KpnⅠ and XbaⅠ), and then the digested products were connected using T4 ligase (Guangzhou Angke Biotechnology Co., Ltd.), and finally the recombinant ligation products were transformed and sent to sequencing. The bacterial solution with correct sequencing was selected for extraction of endotoxin-free plasmids, extracted using Endo-free Plasmid Mini KitⅡ (Omega), and finally the concentration was measured and recorded to obtain the pig KLF5 overexpression vector (referred to as OV-KLF5 vector), the nucleotide sequence of which is shown in SEQ ID No: 14, and the OV-KLF5 vector was stored at -20°C for standby use. Example 5, ChIP-qPCR and dual luciferase experiments verified the enrichment of H3K27ac and the enhancement activity of SE-MYH1 / 4 after overexpression of KLF5.

[0065] 5.1. ChIP-qPCR experiment.

[0066] The experiment was divided into two groups: control group and KLF5 overexpression group. The control group was transfected with pcDNA3.1 empty vector; the KLF5 overexpression group was transfected with KLF5 overexpression vector (OV-KLF5 vector). The specific operation is as follows: the porcine skeletal muscle satellite cells grown to a density of about 70% are transfected, and the transfection system (taking a six-well plate as an example) is as follows: 5 μL Lipofectamine 3000 is added to 125 μL Opti-MEM medium, and mixed evenly; 1 μg KLF5 overexpression vector (OV-KLF5) plasmid (overexpression KLF5 group) or pcDNA3.1 empty vector (control group) is added to 125 μL Opti-MEM medium, mixed evenly, and allowed to stand for 5 minutes; then the A solution and B solution in the previous step are mixed, and incubated at room temperature for 15 minutes; then the cells to be transfected are taken out, the original culture medium is discarded, and 250 μL transfection reagent is added to each well after replacing with fresh proliferation medium, and the mixture is shaken to mix evenly, and cultured in a 37°C cell culture incubator; finally, the culture medium to be replaced is determined according to the cell density after 6 hours. If the cell density is greater than 80%, it is replaced with differentiation medium to induce differentiation, otherwise it is replaced with fresh proliferation medium to culture to more than 80% and then induce differentiation.

[0067] The differentiated cells were then fixed with formaldehyde at room temperature for 30 minutes, and glycine was added at a final concentration of 0.2M. The cell nuclear lysis products were fragmented using a Covaris S220 ultrasonic disruptor. The size of the fragmented DNA was then detected by electrophoresis to ensure that the fragment size was between 200 and 800 bp. 10 μg of H3K27ac antibody or negative control antibody IgG was then added to the fragmented DNA product, and immunoprecipitation was performed at 4°C and incubated overnight. After the incubation, a certain amount of protein magnetic beads was added to purify the antibody-bound DNA fragments, and incubated at room temperature for 3 hours. The DNA fragments of the target antibody were eluted and purified using a DNA purification kit, and then the purified DNA fragments were added with sequencing adapters and blunt end repair, and sequenced on the Illumina HiSeq X Ten PE150 platform.

[0068] Through ChIP-qPCR experiments, we can see the binding of SE-MYH1 / 4 in EDL tissue after overexpression of KLF5. Figure 6 It can be seen that when the negative control antibody IgG was used, there was no significant difference between the KLF5 overexpression group and the control group; however, when the H3K27ac antibody was used, the enrichment of H3K27ac in the KLF5 overexpression group was significantly increased compared with the control group (P<0.01).

[0069] 5.2. Dual luciferase experiment.

[0070] Referring to the operation of 2.1 in Example 2, the SE-MYH1 / 4-E1 recombinant plasmid and SE-MYH1 / 4-E2 recombinant plasmid obtained in Example 2 2.1 were used in the following experiment. The experiment was divided into three groups: Group A was: the control group was transfected with pGL3-Promoter empty vector and pcDNA3.1 empty vector only in pig skeletal satellite cells, and the experimental group was transfected with OV-KLF5 vector and pGL3-Promoter empty vector; Group B was: the control group was transfected with pcDNA3.1 empty vector and SE-MYH1 / 4-E1 recombinant plasmid only in pig skeletal satellite cells, and the experimental group was transfected with OV-KLF5 vector and SE-MYH1 / 4-E1 recombinant plasmid; Group C was: the control group was transfected with pcDNA3.1 empty vector and SE-MYH1 / 4-E2 recombinant plasmid only in pig skeletal satellite cells, and the experimental group was transfected with OV-KLF5 vector and recombinant plasmid pGL3-SE-MYH1 / 4-E2, and each group was technically repeated at least 3 times. After incubation for 72 h, the cells were collected and the fluorescence value was measured according to the instructions of the dual-luciferase reporter gene assay kit (YEASEN, 11402ES60).

[0071] from Figure 7The results of the dual luciferase experiment showed that in group A, there was no significant difference in fluorescence value between the experimental group and the control group; while in groups B and C, after overexpression of KLF5 in the experimental group, the fluorescence value increased significantly (P<0.001) compared with the control group, indicating that after overexpression of KLF5 in pig skeletal muscle satellite cells, the enhancer activity of SE-MYH1 / 4-E1 and SE-MYH1 / 4-E2 was significantly increased. It further shows that the transcription factor KLF5 can increase the enhancer activity of SE-MYH1 / 4, thereby increasing the interaction frequency between SE-MYH1 / 4 and gene promoters. It shows that KLF5 can regulate the enhancer activity and interaction frequency of SE-MYH1 / 4, thereby inducing the formation of fast-type fibers. Example 6, 3C-qPCR experiment verifies that KLF5 promotes the interaction between SE-MYH1 / 4 and MYH4 and MYH1.

[0072] 6.1 Formaldehyde fixation, cross-linking and cleavage.

[0073] The experiment was divided into a control group and a KLF5 overexpression group: the control group was transfected with an empty vector of pcDNA3.1, and the overexpression group was transfected with an overexpression vector of KLF5, OV-KLF5. The details were as follows: After the pig skeletal satellite cells were transfected with the KLF5 overexpression vector OV-KLF5 (overexpression KLF5 group) or the empty vector of pcDNA3.1 (control group) using Lipofectamine 3000 and Opti-MEM, 2% formaldehyde was added to fix at room temperature for 10 minutes after differentiation was completed, and a certain volume of glycine solution was added to make the final concentration 0.2M, and the reaction was carried out at room temperature for 5 minutes. After termination, the cells were centrifuged at 1500r / min for 5 minutes, and the supernatant was removed. One volume of PBST solution was added to resuspend the cells, and the cells were centrifuged at 1500r / min for 5 minutes, and the supernatant was removed.

[0074] 6.2 Generation of in situ interactions.

[0075] The suspension obtained in 6.1 was incubated with Hi-C lysis buffer ((15 mM Tris-HCl, 15 mM NaCl and 0.2% Igepal)) on ice, the precipitate was collected, resuspended with 0.5% SDS, incubated at 62°C for 10 minutes, and 10% Triton X-100 was added to terminate the reaction.

[0076] 6.3DNA ligation.

[0077] Add 100 U of Alu I restriction enzyme to the liquid obtained in 6.2 and digest overnight at 37°C. Terminate the digestion reaction at 62°C for 20 minutes. Then incubate with a biotin mixture and DNA polymerase at 37°C to achieve end-labeling of the DNA fragments. Use T4 DNA ligase to slowly rotate and incubate the reaction at room temperature for 4 hours to connect the DNA.

[0078] 6.43 Obtaining C-DNA.

[0079] The ligated product was washed twice with 10mM Tris-HCl (pH 8.0), and finally resuspended with 600μL, and 10μL of proteinase K solution was added, followed by 13μL of NaCl (5M) solution, and incubated at 68°C overnight to dissolve cross-links. Then, DNA purification solution (15μL sodium acetate solution (3M), 1μL glycogen and 240μL anhydrous ethanol) was placed at -80°C to precipitate the DNA, washed twice with 75% alcohol, and then dissolved with an appropriate amount of water. Finally, the purified DNA was sheared with Covaris S220 to ensure that the fragment was in the range of 300-500bp.

[0080] 6.53C-qPCR.

[0081] After obtaining 6.4 of DNA, find the MboI restriction site and design primers in the same direction (Table 3). At the same time, a pair of primers located inside the internal reference gene ACTB (Table 3) need to be designed as a control, and then perform qPCR experiments.

[0082] Table 3 Primer sequences

[0083]

[0084] Based on the analysis of Example 1, it was found that KLF5 was highly expressed in EDL tissues, had a stronger ability to bind to the open chromatin region, and could bind to the EDL-specific super enhancer SE-MYH1 / 4. Therefore, 3C-qPCR and qPCR experiments were further performed to verify whether KLF5 could promote the interaction between SE-MYH1 / 4 and MYH4 and MYH1. During the 3C-qPCR test, Random primers (randomly selected fragments were used as reference primers, and ACTB primers were used in this experiment), MYH1 primers, and MYH4 primers were used for detection. The results are as follows: Figure 8 As shown in the figure: when using random primers for detection (ACTB primers), there was no significant difference between the KLF5 overexpression group and the control group; when using MYH1 primers for detection, the interaction between SE-MYH1 / 4 and MYH1 in the KLF5 overexpression group was significantly higher than that in the control group (transfected with pcDNA3.1 empty vector) (P<0.001); when using MYH4 primers for detection, the interaction between SE-MYH1 / 4 and MYH4 in the KLF5 overexpression group was significantly higher than that in the control group (transfected with pcDNA3.1 empty vector) (P<0.01). This indicates that after overexpression of KLF5, the interaction between SE-MYH1 / 4 and MYH4 and MYH1 in the KLF5 overexpression group was significantly higher than that in the control group (P<0.001).

[0085] During qPCR detection, the relative mRNA expression levels of KLF5, MYH1, and MYH4 were detected respectively. The results are as follows Fig. 9 As shown in the figure: the mRNA level of KLF5 in the KLF5 overexpression group was significantly higher than that in the control group (P<0.001), indicating that the overexpression was successful; the mRNA level of MYH1 in the KLF5 overexpression group was significantly higher than that in the control group (P<0.001), indicating that overexpression of KLF5 can promote the transcription or expression of MYH1 gene; the mRNA level of MYH4 in the KLF5 overexpression group was significantly higher than that in the control group (P<0.001), indicating that overexpression of KLF5 can promote the transcription or expression of MYH4 gene.

[0086] The above results indicate that the transcription factor KLF5 can promote the interaction between SE-MYH1 / 4 and the glycolytic marker genes MYH4 and MYH1, ultimately promoting the transcription or expression of MYH4 and MYH1 genes, thereby inducing the formation of fast-twitch muscle fibers.

[0087] In summary, the present invention discloses a method for regulating pig muscle fiber types, which includes identifying for the first time that the transcription factor KLF5 in pig soleus and extensor digitorum longus tissues regulates muscle fiber type conversion by promoting the activity of SE-MYH1 / 4, further promoting the transcription or expression of MYH4 and MYH1 genes, inducing the formation of glycolytic fast muscle fibers, or promoting the conversion of oxidative slow muscle fibers into glycolytic fast muscle fibers.

[0088] SE-MYH1 / 4-E1 sequence (SEQ ID No: 1):

[0089] TGCCTCCCAGGACCAGAGTCCAGAGAGCTTGCAGGCCAGCCAAGCAGAGTGCCCAGTGTAAGCACAGTCCAG

[0090] GGCCTCTGATGGATATAGAGCCCAGTTTAGAATGAGCTGGAAAGACCCTCTTATCGGCATGGGGGCACATCATGA

[0091] AAGATGATTATTTGTCACATAATTACAATAAAACTTATTTCTATCTGGTTACTTTTTTTTTTCTTTTTCAGAAGAAG

[0092] AAATTTTCCGTCTTTCTTAAGAAGTCCCAGGAAGCATTGTTTGATTCTCAGAAGTCAGTAGATAAGAAAAGTCTC

[0093] CTTGAATTCTTCTGAGTAAAAATCTTCCCATTAGACCTTTATGTGTCATCAAAGAACCCAGTTTTAAGGACATACT

[0094] TTCCATCTTTTTTTGTTTGTTTGTTTGTTTGTTTTTTAGGGCCACACGTGCAGCATATGGAAGGTCCCAGACTATG

[0095] GGTTGGATTAGAGCTGTAGCTGCTGGTCTACACCACAGCCACAGCAACGCCAGATCCAAGCCATGTCTGCGATC

[0096] TACACCACAGCTCACAGCAATGCTGGATCCTTAACCCACTGAGCAAGGCCAGGGATCAAACCCGCAACCTCAC

[0097] GGATACTAGTTGGGTTCTTAACCTGCTGAGCCACCATGGGAACTCCTCATACTTTCCATCTTTTTAAGAATTACTT

[0098] TTCACAAAAATAAAATTCACAGCTAGGAGGTTAAAAGCTAAGACTGAGGGTTTACTCAATGGGCTGATTTAGCC

[0099] TTTGCCTTTAATTCTGTGATTTGGGTAATACGAAGCAGTAGCTGTGAGCCCCAGAGTCTGCACATGCAAACCGAA

[0100] TCCCACACTAACAGTGATCTCCAAAGCCCAAGTCAGTTTCCCCTCTGAACTCGCTGTCTGCCTTCACTCGTACGG

[0101] GATCCTTGGAGCACCCAGTGTGAGGAGGTCTAGTAGTACCAGTTCTTCTCACTGTAGAGATGAGTGGGATAAAG

[0102] AGGAGAGGAGCAATTCTTGCCTCCAGAGAGTCTGGCGGGGACGACGCACATGAACACAACTAATAGAGAGCAG

[0103] CAGGGGCGAGGGTTGCGGTCTGACCTAGTGTGGTGGGGAGACGAAAAGTAATTCTTGCAAGACCAGGAGAGAT

[0104] TTCACTATGGAGGGGACAACATTGAGATTTATTCTTGGGAGGGGACTTTGCCAGACAGAGAATAGAAAAGGTGT

[0105] GTTCCCAGCTGCAGGAGGTGCATGGGTGAACTCTCCCCGTGGAGAATCAGAGAAGTTTGGTCATTGCGGGGAG

[0106] TGGCAGGAGGCGAACATGGAAGGATCTGGAGACACACGAAGAGACAGAAGACATAGGCTCTTGAGTTACCCA

[0107] GTTCTGGACACTGTGACACACATACAAAGGGCTCTCCCACTCGTTCTTACCCATAATAGTACTGAGACCCAGAG

[0108] AACAGGGTCGGGGAGACCAGAGCCTGGGCTTTGGGGAGTGACAGACTTGAGTTTTATTCTTGGCTCCAAAAGG

[0109] CGCTCTAGCCGTGGCCTTAGAAGATGAACTCTCCCTCAACCTCAGTTTCCTTATCTGTGAAATAGGGGTAAAATA

[0110] GCACCTTCTTCACGAGGCTCAGAAGGAACGAGGAAGAGAATGTACGTGATGCAGTCAACACATGTCCAGCCCA

[0111] TCGTAAGTGCTCAGCACGTTGAGTTCAGAATAATCCAAGATTAATACTAACGTCTGGTGAGGAACGTCGATAGTA

[0112] ACTCTCCCTTGGGCGGGTCAGCACCGAAGCCCGGGGCGGGGGAGATCAGCTGAGGTCAAAGGACCCATCACTT

[0113] GGTTTCTGATATCAGCCCCGGTGGGATTGACAGCCTCGGCCCATCTCTCGGCCAGATCTGCCGTGTCGCGGGGA

[0114] GGCCCAGCAGGCTCGTTCTTCCTCAGATTTCTTCCCCTGTGGGGATCAAGGCAGGAGAGCACAGGCCTCGGATG

[0115] ATAAACACATTCTTGCCTCTCCCTGTGTAAAGTGATAATGCCAGAGGTGCCTGGCACCAAGCAAGGGACAGTGC

[0116] CATCCCTCCAAGGCTCCTTGTCCCCACAGCTGACTAGGTGCCTGCGGGTATGGCTCTGGGAACTGTCTTGAAAG

[0117] TCCTTGTCTCTCTCCCCTTTGTCTTTGTTTAGCAGCTGCGTTGCACTGCTGGGTATGGGGTGCATTCCTGCCTCCT

[0118] GACAGTGATTGTTCCCTTCAACAAGTTTTAATAGATTTTGGGGGGAGCAATTTTATGTCCACAGCCGATTGTGTG

[0119] GAGAGCACAGAGAATGCCCTATCCTTCCTACGCCCTCAGACACACACAGCCTCCCCCGATCCACATCCCCCTGC

[0120] AGAGGGCACACTTTCGACCTCCGTGAACGTGCACGGACACGTCGTTATCGCTCAGATTCCACATTCACTGTAGG

[0121] ATTCGCTCTTGGCATTATACCTTCTATAGGAGTTGTTGACTTTTTACACCAGAAATTGTCCCATGAGAGCTTATTC

[0122] GAGTAATTCAGGGCAAAGCTGGGGATGCCGACCTGTTTCTAAATAATCCATTTTGGAGAAGAGCATTTGAGATG

[0123] AAATGGAAATAGAAAAGAAAGAAAGACACAATGGAAGGAAGGAGCAAGAGAAAGAGAAGAGACCATCCAGG

[0124] CACCCAGGCAGGTCCCTCCCCCCAGTCTCCGAAGCGCTTCACAAGCAGAGGTCAGTGGTTGTTCTTGCCTAAAA

[0125] TTCATACTCTTCTCCTGTTCCAAAATCCTCCCACCATCCCCCCACTGTCTCCTGGCCTTCCTCTTCCTGGGGGGAG

[0126] AGTTCTGCCTTTGAATCTTTGCCTTGAAGCTTTTCCGCTGCCTGTCCTCCAGGCCTCCATGGTGAGGCCCCTACC

[0127] GGTGAAAGGAGAGAGTTTTACTTTGAAATGGAGGGCCCAGGAATGGAGCAGGGCAGTTTGAAGAGTTTTTTCC

[0128] CCTGTACCTAAGATAACTTTTTATTGCTCTAGCAACGTTCTTGTAAGAAACCAAGTCAGCCTCCTGCTCTGACAG

[0129] ATGAAACCTTGAGGAGCTGGCTGTCCCCAGTGCTAAGATGTCCTTCCAAACCGGGACCCAGACAGCTGGAGGG

[0130] CTCCAGTTACTCAAGAGGTGAGTGACACGGACCCTTGGCCCGTGTGCGGAAGGGAGGAGTGGGGCAAGGGAG

[0131] CTCGGGGAGGGAAGGACAGAGGAGAAAGAAGGGCAGTGACAAGAGGGAGGGGGCTGCTAGGAAGGCGGGA

[0132] AGCAGGCGGGGCTGAGGCCTGGCTGTGGAGGAGGGGAGCGTCCTTTCTGACCATACCCCCTGCTGGACTTTGG

[0133] GGGCAAGGGTGGTGCCCCACCTTGGACCTCGGGGTGTGATTGGTGACTTTCCAACCCAAAAGACCCCTGAAGT

[0134] GGAAACCGTTCTGGCCGTCTCTCTCCCCCAGGATCATTAAGGTCCTTTCACAGCGAACGACCATTCCAGAAGCT

[0135] GGCCATCTCCAAGCCAGCAGATGGAGTTTGCTCTCAACCTTTGATTCGAGATTTAAATATGTATTGTTTTTTTTCA

[0136] AATAGTGAATTAAAATGCACACCCATCTAAATGTTTTTATTGTACTTTCTAAAATGACGATGGGTGGCGTTAGCAA

[0137] TGATAAAAAATGATTTTCCATGATAAAAATTGAATTGGTTTGAA

[0138] SE-MYH1 / 4-E2 sequence (SEQ ID No:2):

[0139] TAGATTGCTCAGAATTACGGGCAGGACAGGGCGGGCGTCACTGGGGTGTCAGCACCAAGCCACTTGGGCAGCA

[0140] GGAGTGTTCTGGGGTCAGAGTTAGGAGTTTGAATCCCGGTTTGTGGAGCTGTTTGGGGTTCAGAAGTGCTGACA

[0141] GGGCTGATTCTAGGCTTGGGGGCAGCGCCGTGGGTTAGGAGTTTGAATCCCGGTTTGTGGCACTGTTGGGGGTC

[0142] CCTCATTGCTGACAGGACTGATTCTAGGCTTGGGGGCAGCGCCGTGGGTGCCACTCTGACCCCTCGGGAGGGA

[0143] GATGGGTGAGAAGCAGGGGGCAGGGAGACACCCTATTTAAAGCTCCCTCTGATTGCATCAGGCGCTGCTAAGG

[0144] CCAAAGCAGCTCCCCCCTGGGGAAGGCCCATGTCCTCGTCCCATGGAGCCACTCACAAGGTGAGAATGAGCCC

[0145] ACGGGCTGCACGCTCTTGGCCATGGGGGGTTGATGGTGGCCACAGCACCTCGACTCGGTGTGTATCTATAGGTC

[0146] ACTCGTGATCTAAGACCCTCTCGTGGGCTGGATTTACTGTGGAACTCAAGGCAAATCCCTTGAACAGGTGAAAA

[0147] CTCGTGTCCTCTTAAACTCCTTTCCAAAAGTGGCCATCCCGTCCTCGCTGCCCTGTGGGCTGGCGTAGGAATGAT

[0148] CTGGGAAGTGTATTTTAGAACTGTGATGTCTGGCCTATGCATCCGCACCGTCGGGCACCACCTGGCTGTGGGCAT

[0149] CGGGGCAGTGGCGAGAAGGGGCCTGATTGGGCTCCACTCTGCGGGCTTCCCAAGCAAGCCTGGGGGTGGAGG

[0150] GGAGACGGGAGGAGGAGATGGTAGGTCTCCAGCTGGGGGCTGGTTCTGGCCCCTGGCCATGAGGCCAGGGCG

[0151] CCCCCAAATAAACACCCACGTAAGCGCCTGTTCTTCACGTCCCCACACCTGCTCCCCAGGGGCTGAGACCCCAG

[0152] GCCCGAAATAGGCGCAGCTGCTGCGGATGCTAATCCGGCCCCACGCTGAGGCTGAGCCGTATTTGGAAATGTCT

[0153] GGCCTGCCACCCGCCCTCAGCCTTGGGGCCTCAAAGCAGAGTTCTTGCTCCCTCTTCCTGGCCTGGCTTTCCTG

[0154] GGGACTTCTGTCTGCCTGTTTCCTGTCCCTGGGCACGCAGTGGGCAGCTGTAAATGACAGGTGAATGAGTTGGT

[0155] ACAGAAAGGAACAGAGACCTGAGACGTGCAGCCTCAAAACCGGCTTCCCACGGCAGCGCCTCACCCCCAAGG

[0156] GCCTCCTCTGCTACTCGACTCTGTCTTCAGGCTTCCGAGCCCCTGCGACCCGTGCCCAGCCATGCCCACACCCG

[0157] CTGCTTCAGGAAGCCACGCAAGCCCAGTGCCTGTTAGCACCTCTCCCACATCCGTGGGTCTCGGCTGCTGGGTT

[0158] GTCGTGACGTCTTTCTTGGTGACACGCAGAGCAGAAGGTCAGAAGAACTGGCTTTCCCCAGGGTCACACAGCA

[0159] TCCCCCACCGCTTTCTCTTCTTACTGGGAGTTCAGTTCAGCACATGCTGAGCACCTGCTGTGTACAGAGCAGTG

[0160] GCTCACTGCTAAAGGGATTGACTTTCTTTCGGTCTCTGACTCTAAAAGTGTGTCACCCTGTCACCTTCCTCAGTT

[0161] TCCTCTGTTTTCTCTTCCATCATTATCTCAGTACTTAGATTTCTTTGATTGTCCTTGAGGTTCAAGGTTCTGTCTCA

[0162] TTTATTTTTGAATCTCTGGGTCACTGAGGAACCCTCTGTGGACGACAATGGTCCATTTTCTTTATCTAAGATGCCC

[0163] CTCTGTCTGGAAGCTGGGCTCTTGGTGAAGGTGACCTATGGGCCTCTGTCACCTGCTCCCCTGGGCCTCCTCAG

[0164] GGGTCCTTGGGGCCACCTCTCATTTGCTAAAACATGGAGAAGGCCCCCAAATGCCCAGGTGACGGGGCTTCTTG

[0165] CTTCTCACTGCCACGGAAAGCTTGAAACAACTTAGCTAAAAATAATCAGTGCCTTCCTGGGCCCAGCTGCCCTC

[0166] ACCAGGCGCACGAGGGCCTCCGGCATGTCTTGGCCTTGCTCAGGGTAACCAGATCCCGGCTTGGCCCCGGCGA

[0167] GCAGCCGCAGGCACCCTCAGCCTCAGCTGGTTTTAGCAGGAGGATTCCTGGGAGGGCGGGCATAGACTCCGTG

[0168] TTCTGGGCGGCCTCCTCAGCCCACACGTCTAGGTACACTCGGCTTTGTTAAAGCGCTCAGCTGTCGCGGTGACC

[0169] AGGCGAGAAGGGCAAGGCCGCTCTCCCCAGCAGGAGGGCCTGCGGACCACAGCGGTTTGTCACCCTGAGGAC

[0170] GTGTTGCTCCAGTTAGAGCTGAGCCCCTTCCGTGTCCTAAAGAAGGGGGCCCCACCAATCATAAATCAGGATCT

[0171] CATCGCCTCCAAATAAAGGGAGTCTGCCGTCCCCGCGCCCGGCCCTTCAGCATTGACAGATAGATTGTTTTAGTC

[0172] CTGTGTCGAGCATTTCTTTTTGCTTTTTTTTTTTTTTTTTTTTTTTTGGGCCGCACCCATGGAG KLF5 CDS region sequence (SEQ ID No:11):

[0173] ATGGCTACGCGGGTGCTGACTATGAGCGCCCGCCTGGGACCCGTGCCCCAGCCGCCGGCCCCGCAGGACGAGC

[0174] CCGTGTTCGCGCAGCTTAAGCCCGTGTTGGGCGCCGCGAACCCAGCCCGCGACGCGGCGCTCTTCCCCGGCGA

[0175] CGAGCTGAAGCACCCGCACCACCACCCGCAGGCACAGCCCGCGCCGCCGCAGCCGCCGCAGCCGGCGCCGCC

[0176] GCCCGCCGCGGGCCCGCGGCTGCCCGCCGAGGAGCTGGTCCAGACGCGATGTGAAATGGAGAAGTATCTGACA

[0177] CCCCAGCTTCCGCCAGTTTCCATAATTCCAGAGCATAAGAAGTATAGACGAGACAGTGCCTCAGTCGTAGACCA

[0178] GTTCTTCACTGACAGTGAAGGGTTACCTTACAGTATCAACATGAACGTCTTCCTCCCTGACATCACTCACCTGAG

[0179] AACTGGCCTCTACAAATCCCAGAGACCGTGCGTAACCCACATCAAGACCGAACCTGTTACCATTTTCAGCCACC

[0180] AGAGTGAAACGACGGCCCCTCCTCCGGCCCCGACCCAGGCCCTCCCCGAGTTCACCAGTATATTCAGCTCCCAC

[0181] CAGACCGCAGCTCCAGAGGTGAACAACATTTTCATCAAACAAGAACTTCCTACACCAGACCTTCATCTTTCTGT

[0182] CCCTCCCCAGCAGGGCCACCTGTACCAGCTGCTGAACACACCGGATCTAGATATGCCCAGTTCTACCAACCAGA

[0183] CAGCAGTGATGGACACTCTCAATGTTTCTATGTCAGCTGCCATGGCGGGCCTTAACACCCACACCGCCGCCGTC

[0184] CCGCAGACTGCGATGAAGCAATTCCAGAGCATGCCCCCTTGCACATACACCATGCCAAGTCAGTTTCTTCCCCA

[0185] GCAGGCTACTTACTTCCCCCCGTCACCACCAAGCTCGGAGCCGGGAAGTCCAGATAGACAAGCAGAGATGCTC

[0186] CAGAATCTAACCCCACCTCCATCCTATGCTGCTACGATTGCTTCTAAACTGGCGATTCATAATCCAAATTTGCCCG

[0187] CCACCCTGCCAGTTAATTCCCAAAACATCCAGCCTGTCAGATACAATAGGAGGAGTAACCCCGATCTGGAGAAA

[0188] CGACGCATCCACTACTGCGATTACCCGGGCTGCACCAAAGTTTATACAAAGTCTTCTCATTTAAAAGCTCACCTG

[0189] AGGACTCATACTGGCGAGAAGCCCTACAAGTGCACCTGGGAAGGCTGCGACTGGAGGTTCGCGCGCTCGGACG

[0190] AGCTGACCCGCCACTACCGCAAGCACACGGGAGCCAAGCCCTTCCAGTGCGGCGTGTGCAACCGCAGCTTCTC

[0191] CCGCTCTGATCACCTCGCCCTGCACATGAAGAGGCACCAGAACTGA

[0192] OV-KLF5 vector sequence (SEQ ID No:14):

[0193] GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCC

[0194] AGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAA

[0195] GGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAG

[0196] ATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATAT

[0197] GGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGT

[0198] CAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTA

[0199] AACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATG

[0200] GCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATC

[0201] GCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCA

[0202] AGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAA

[0203] CAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGC

[0204] TAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGC

[0205] GTTTAAACTTAAGCTTGGTACCATGGCTACGCGGGTGCTGACTATGAGCGCCCGCCTGGGACCCGTGCCCCAGC

[0206] CGCCGGCCCCGCAGGACGAGCCCGTGTTCGCGCAGCTTAAGCCCGTGTTGGGCGCCGCGAACCCAGCCCGCGA

[0207] CGCGGCGCTCTTCCCCGGCGACGAGCTGAAGCACCCGCACCACCACCCGCAGGCACAGCCCGCGCCGCCGCA

[0208] GCCGCCGCAGCCGGCGCCGCCGCCCGCCGCGGGCCCGCGGCTGCCCGCCGAGGAGCTGGTCCAGACGCGATGT

[0209] GAAATGGAGAAGTATCTGACACCCCAGCTTCCGCCAGTTTCCATAATTCCAGAGCATAAGAAGTATAGACGAGA

[0210] CAGTGCCTCAGTCGTAGACCAGTTCTTCACTGACAGTGAAGGGTTACCTTACAGTATCAACATGAACGTCTTCCT

[0211] CCCTGACATCACTCACCTGAGAACTGGCCTCTACAAATCCCAGAGACCGTGCGTAACCCACATCAAGACCGAAC

[0212] CTGTTACCATTTTCAGCCACCAGAGTGAAACGACGGCCCCTCCTCCGGCCCCGACCCAGGCCCTCCCCGAGTTC

[0213] ACCAGTATATTCAGCTCCCACCAGACCGCAGCTCCAGAGGTGAACAACATTTTCATCAAACAAGAACTTCCTAC

[0214] ACCAGACCTTCATCTTTCTGTCCCTCCCCAGCAGGGCCACCTGTACCAGCTGCTGAACACACCGGATCTAGATAT

[0215] GCCCAGTTCTACCAACCAGACAGCAGTGATGGACACTCTCAATGTTTCTATGTCAGCTGCCATGGCGGGCCTTA

[0216] ACACCCACACCGCCGCCGTCCCGCAGACTGCGATGAAGCAATTCCAGAGCATGCCCCCTTGCACATACACCATG

[0217] CCAAGTCAGTTTCTTCCCCAGCAGGCTACTTACTTCCCCCCGTCACCACCAAGCTCGGAGCCGGGAAGTCCAGA

[0218] TAGACAAGCAGAGATGCTCCAGAATCTAACCCCACCTCCATCCTATGCTGCTACGATTGCTTCTAAACTGGCGAT

[0219] TCATAATCCAAATTTGCCCGCCACCCTGCCAGTTAATTCCCAAAACATCCAGCCTGTCAGATACAATAGGAGGAG

[0220] TAACCCCGATCTGGAGAAACGACGCATCCACTACTGCGATTACCCGGGCTGCACCAAAGTTTATACAAAGTCTT

[0221] CTCATTTAAAAGCTCACCTGAGGACTCATACTGGCGAGAAGCCCTACAAGTGCACCTGGGAAGGCTGCGACTG

[0222] GAGGTTCGCGCGCTCGGACGAGCTGACCCGCCACTACCGCAAGCACACGGGAGCCAAGCCCTTCCAGTGCGGC

[0223] GTGTGCAACCGCAGCTTCTCCCGCTCTGATCACCTCGCCCTGCACATGAAGAGGCACCAGAACTGACTAGTCCA

[0224] GTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGA

[0225] TCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAA

[0226] GGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTC

[0227] TGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGG

[0228] TGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGC

[0229] GCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCC

[0230] TTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTA

[0231] GGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCC

[0232] ATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAAC

[0233] TGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTA

[0234] AAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAG

[0235] TCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTC

[0236] CCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAA

[0237] CTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTAT

[0238] GCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTT

[0239] TTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCAT

[0240] GATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCAC

[0241] AACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAG

[0242] ACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCG

[0243] TTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGG

[0244] GCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCA

[0245] TACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGG

[0246] AAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAG

[0247] GCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGG

[0248] TGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCG

[0249] TTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCC

[0250] GCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAA

[0251] TGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGC

[0252] TTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCAC

[0253] CCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTT

[0254] TTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGC

[0255] TAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATAC

[0256] GAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCA

[0257] CTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCG

[0258] GTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCG

[0259] GTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGC

[0260] AAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCT

[0261] GACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGT

[0262] TTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCC

[0263] CTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGC

[0264] TGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAAC

[0265] CCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCG

[0266] GTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGC

[0267] TGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTTTT

[0268] TTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTC

[0269] TGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGA

[0270] TCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATG

[0271] CTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAG

[0272] ATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGC

[0273] TCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCT

[0274] CCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTG

[0275] CCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAA

[0276] GGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTA

[0277] AGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATG

[0278] CTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCC

[0279] GGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGG

[0280] GGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTT

[0281] CAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAAT

[0282] AAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGT

[0283] CTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAA

[0284] GTGCCACCTGACGTC

Claims

1. Application of KLF5 transcription factor in regulating pig skeletal muscle development or in preparing products capable of regulating pig skeletal muscle development.

2. Use of an agent that promotes or inhibits KLF5 transcription factor in regulating pig skeletal muscle development or in preparing a product that can regulate pig skeletal muscle development.

3. The use according to claim 1 or 2, wherein: The regulation of pig skeletal muscle development refers to regulating the transformation of pig muscle fiber types by regulating the expression of KLF5 transcription factor.

4. A method for regulating pig muscle fiber type, wherein: The method achieves the regulation of pig muscle fiber type conversion by regulating the expression of KLF5 transcription factor.

5. The method according to claim 4, wherein: The method comprises injecting or transfecting a KLF5 overexpression vector to promote the expression of KLF5, thereby promoting the formation of glycolytic fast muscle fibers, inhibiting the formation of oxidative slow muscle fibers, or promoting the transformation of oxidative slow muscle fibers into glycolytic fast muscle fibers.

6. The method according to claim 4, wherein: The method comprises inhibiting the expression of KLF5, thereby promoting the formation of oxidative slow muscle fibers, inhibiting the formation of glycolytic fast muscle fibers, or promoting the transformation of glycolytic fast muscle fibers into oxidative slow muscle fibers.

7. Application of KLF5 transcription factor in regulating the activity of super enhancers that interact with MYH1 and MYH4 genes.

8. Application of KLF5 transcription factor in increasing the interaction frequency between super enhancers that interact with MYH1 and MYH4 genes and gene promoters.

9. Application of KLF5 transcription factor in promoting the transcription or expression of MYH4 and MYH1 genes.

10. Application of a kit / nucleic acid molecule / recombinant protein / recombinant vector / product containing a KLF5 transcription factor expression regulator in regulating the transformation of pig muscle fiber types.

Images