Staphylococcus epidermidis capable of producing antibacterial peptide and application of staphylococcus epidermidis in skin antioxidation and antibiosis

Abstract

The invention provides staphylococcus epidermidis capable of producing antibacterial peptide and application of the staphylococcus epidermidis in skin antioxidation and antibiosis. The staphylococcus epidermidis CCSMS0776 is separated from healthy skin, and membrane filtration and ammonium sulfate fractional precipitation are adopted to extract a crude extract of the antibacterial peptide from a TSB fermentation supernatant of the staphylococcus epidermidis CCSMS0776. Experiments prove that an antibacterial peptide crude extract produced by the strain has a specific antibacterial effect on propionibacterium acnes, has no obvious inhibition effect on skin symbiotic staphylococcus epidermidis, and can specifically inhibit the propionibacterium acnes and regulate the micro-ecological balance of acne crowds. The screened staphylococcus epidermidis, the fermentation supernatant and the antibacterial peptide of the staphylococcus epidermidis have wide application prospects in acne treatment.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, in particular to a strain of Staphylococcus epidermidis producing antimicrobial peptides and application thereof in skin anti-oxidation and antibacterial treatment. Background Art

[0002] In recent years, the overuse of antibiotics has led to an increasingly serious problem of bacterial resistance, posing a serious threat to global public health. Antimicrobial peptides (AMPs) are a class of small molecule, cationic, amphipathic peptides produced by ribosomes, and their antibacterial mechanisms mainly include destroying cell membrane integrity and inhibiting gene expression. Unlike antibiotics that interfere with the metabolic process of pathogenic microorganisms, AMPs usually produce antimicrobial effects by physically destroying microbial cell membrane lipids and inducing leakage of cell contents, so they have little effect on the evolution of bacterial resistance. Coagulase-negative staphylococci that live on the surface of human skin, including Staphylococcus epidermidis, Staphylococcus capitis and Staphylococcus hominis, are an important source of antimicrobial peptides. Mining new antimicrobial peptide-producing strains from the human microbiome can effectively reduce dependence on antibiotics and alleviate the problem of drug resistance caused by them, becoming an important direction for solving the bacterial resistance crisis.

[0003] Acne is a common chronic inflammatory skin disease that is more common in adolescents, with an incidence rate of over 90%. The occurrence of acne is closely related to factors such as excessive sebum secretion, keratinization of the sebaceous gland ducts, pathogen infection and inflammation. Excessive sebum secretion from the sebaceous glands can lead to clogged pores, which in turn promotes the overgrowth of microorganisms such as Propionibacterium acnes, further aggravating the inflammatory response. Currently, the treatment of acne mainly relies on hormone antagonists, retinoic acid drugs, antibiotics and other drugs for treatment, but long-term use of drugs has the risk of causing allergies, kidney damage, and even deformities and other toxic side effects.

[0004] Propionibacterium acnes and Staphylococcus epidermidis are the main abundant bacteria on the skin surface. Studies have shown that there is an imbalance in the skin flora of acne patients, which is manifested by an increase in the number of Propionibacterium acnes and a decrease in Staphylococcus epidermidis. The imbalance between the two leads to a large number of Propionibacterium acnes, which secretes lipase to hydrolyze triglycerides and metabolizes more free fatty acids, thereby aggravating the inflammatory response.

[0005] Currently, there is a lack of effective means to regulate the balance of skin microbiota and inhibit acne and inflammatory responses. Summary of the invention

[0006] Based on the above shortcomings of the prior art, the purpose of the present invention is to provide a strain of Staphylococcus epidermidis producing antimicrobial peptides and its application in skin anti-oxidation and antibacterial treatment.

[0007] The present invention screens a strain of Staphylococcus epidermidis from healthy human skin, and its fermentation supernatant, membrane filtration concentrate and crude antimicrobial peptide have good inhibition of Propionibacterium acnes, but no significant inhibition of the growth of Staphylococcus epidermidis, and can specifically inhibit Propionibacterium acnes, regulate the skin microecological balance of acne patients, and provide a new solution for the prevention and treatment of acne. The antimicrobial peptide-producing Staphylococcus epidermidis provided by the present invention provides a new strain resource for the development of new antimicrobial peptides, and lays a foundation for further studying the properties and structure of the antimicrobial peptides produced by it and developing new, efficient, antimicrobial peptides.

[0008] One of the technical solutions of the present invention provides a strain of Staphylococcus epidermidis CCSMS0776 producing antimicrobial peptides, which has been deposited in the China General Microbiological Culture Collection Center on June 5, 2024, with a deposit number of CGMCC 30873. The 16S rDNA nucleotide sequence of the strain of Staphylococcus epidermidis CCSMS0776 producing antimicrobial peptides is shown in SEQ.ID.No.3.

[0009] Furthermore, the Staphylococcus epidermidis CCSMS0776 has the following microbiological characteristics: it is a facultative anaerobic strain and does not produce biofilm. The colonies of the Staphylococcus epidermidis CCSMS0776 strain on the TSA blood agar plate are round, with neat edges and milky white color, and the surface is moist, smooth, raised and easy to pick up. The Staphylococcus epidermidis CCSMS0776 is Gram-positive, the bacterial body is spherical, arranged in a grape shape, and also arranged individually, without flagella, unable to move, and does not produce spores. The delay period of the strain CCSMS0776 is relatively short, entering the logarithmic growth phase in 2 hours and reaching the stable phase in 10 hours.

[0010] Furthermore, a method for screening the antimicrobial peptide-producing Staphylococcus epidermidis CCSMS0776 is provided, comprising the following steps:

[0011] Using Propionibacterium acnes as the indicator bacteria, the fermentation supernatants of different Staphylococcus epidermidis were tested for in vitro antibacterial experiments on the indicator bacteria using a 96-well plate, and strains with antibacterial effects were preliminarily screened; further excluding acid inhibition and hydrogen peroxide inhibition, repeated screening was performed to determine the target strain CCSMS0776. The specific steps include: (1) Staphylococcus epidermidis isolated from the surface of a healthy human body was inoculated into TSB liquid culture medium, cultured at 36-38°C (preferably 37°C) for 18-22h (preferably 20h), and centrifuged; (2) Using Propionibacterium acnes and Staphylococcus epidermidis as indicator bacteria, the obtained fermentation supernatant was subjected to in vitro antibacterial experiments on the indicator bacteria using a 96-well plate, and strains with antibacterial effects were preliminarily screened; (3) The pH value of the above fermentation supernatant was adjusted to pH ≥ 6 using a 0.5 mol / L NaOH solution, and the fermentation supernatant was placed in a constant temperature water bath at 80°C for 10 minutes to remove the influence of hydrogen peroxide, and the target strain CCSMS0776 with better antibacterial activity was screened out by parallel comparison.

[0012] Further, a fermentation supernatant of the Staphylococcus epidermidis CCSMS0776 is provided, and the preparation method of the fermentation supernatant is as follows:

[0013] The Staphylococcus epidermidis CCSMS 0776 was inoculated into a fermentation container and cultured to obtain a fermentation liquid; the fermentation liquid was centrifuged to remove the bacterial cells, thereby obtaining a fermentation supernatant of the Staphylococcus epidermidis CCSMS0776.

[0014] The fermentation container is a common device in the art, such as a triangular flask and a fermenter; the inoculation amount is 1.8-2.2% (V / V), preferably 2% (V / V); the culture conditions are common fermentation conditions in the art, preferably a temperature of 36-38°C, more preferably 37°C; 150-200r / min shaking culture or stirring with a stirring paddle in the fermenter can be selected; the centrifugation conditions are 6000-10000r / min, 5-10min, preferably 8000r / min centrifugation for 5min.

[0015] A second technical solution of the present invention provides an antimicrobial peptide, which is derived from the Staphylococcus epidermidis CCSMS0776 described in the above technical solution.

[0016] Furthermore, the method for preparing the antimicrobial peptide comprises the following steps: filtering the fermentation supernatant of Staphylococcus epidermidis CCSMS0776 obtained by the above technical scheme through an ultrafiltration membrane with a molecular weight cutoff of 10 kDa and precipitating by ammonium sulfate, collecting the precipitated components with 75% and 100% saturation, dialyzing, and freeze-drying to obtain the antimicrobial peptide.

[0017] The ammonium sulfate fractional precipitation is a commonly used protein separation technology, and its basic principle is to change the ionic strength in the solution by adjusting the concentration of ammonium sulfate, thereby affecting the solubility of different proteins and achieving protein separation and purification.

[0018] Furthermore, the antimicrobial peptide was further determined to be a polypeptide substance through protein content analysis and ultraviolet spectrum scanning analysis. The protein content of the ammonium sulfate precipitation component with 75% saturation was 56.23%, and the protein content of the ammonium sulfate precipitation component with 100% saturation was 42.27%. The antimicrobial peptides with two saturation levels had good antioxidant and antibacterial effects, and the inhibitory effect of the 75% saturation component on Propionibacterium acnes was better than that of the 100% saturation component.

[0019] The third technical solution of the present invention provides the application of the Staphylococcus epidermidis CCSMS0776, its fermentation supernatant and the extracted antimicrobial peptides in skin antioxidation and antibacterial aspects, wherein the Staphylococcus epidermidis CCSMS0776, its fermentation supernatant and the extracted antimicrobial peptides are used to prepare antioxidation and antibacterial products. The products can resist the damage to the skin caused by DPPH free radicals and Propionibacterium acnes.

[0020] Furthermore, the fermentation supernatant of Staphylococcus epidermidis CCSMS0776 and the antimicrobial peptide have a good scavenging effect on DPPH free radicals and show strong antioxidant properties.

[0021] Furthermore, the fermentation supernatant of Staphylococcus epidermidis CCSMS0776 and the antimicrobial peptides have a significant inhibitory effect on Propionibacterium acnes ATCC 11827 and ATCC 6919, but have no significant inhibitory effect on Staphylococcus epidermidis ATCC 35984 and ATCC 12228.

[0022] Furthermore, the product is any one of the following types of products:

[0023] 1) A product for improving acne; the product for improving acne is used to inhibit the growth of Propionibacterium acnes;

[0024] 2) Products that regulate the balance of skin flora.

[0025] Furthermore, the product is any one of medicines, skin care products, and hair care products.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] (1) The present invention screens for the ability to inhibit Propionibacterium acnes and Staphylococcus epidermidis from the perspective of regulating the balance of skin microbiota, and is a safe and effective means of preventing and treating acne.

[0028] (2) The present invention provides a strain of Staphylococcus epidermidis isolated from healthy skin, whose fermentation supernatant, ultrafiltration membrane filtered concentrate and crude antimicrobial peptide have good inhibitory effects on Propionibacterium acnes, providing new strain resources for the development of new antimicrobial peptides.

[0029] (3) The antimicrobial peptide of Staphylococcus epidermidis provided by the present invention has good inhibition of Propionibacterium acnes, but has no significant inhibition on the growth of Staphylococcus epidermidis. It can specifically inhibit Propionibacterium acnes, regulate the skin microecological balance of acne patients, provide a new solution for the prevention and treatment of acne, and has broad application prospects in the treatment of acne. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 TSA plate colony morphology of antimicrobial peptide-producing Staphylococcus epidermidis CCSMS0776;

[0031] Figure 2 Bacterial morphology and electron microscope images of antimicrobial peptide-producing Staphylococcus epidermidis CCSMS0776;

[0032] Figure 3 Growth curve of antimicrobial peptide-producing Staphylococcus epidermidis CCSMS0776;

[0033] Figure 4 Adhesion curve of antimicrobial peptide-producing Staphylococcus epidermidis CCSMS0776;

[0034] Figure 5 DPPH free radical scavenging rate of the fermentation supernatant of Staphylococcus epidermidis CCSMS0776;

[0035] Figure 6 The antibacterial rate of the fermentation supernatant of Staphylococcus epidermidis CCSMS0776 against Propionibacterium acnes and Staphylococcus epidermidis;

[0036] Figure 7 This is the UV spectrum of the crude extract of 75% antimicrobial peptides;

[0037] Figure 8 This is the UV spectrum of the crude extract of 100% antimicrobial peptides;

[0038] Fig. 9 is the scavenging rate of DPPH free radicals by the crude extract of antimicrobial peptides from Staphylococcus epidermidis CCSMS0776;

[0039] Fig.10 The antibacterial rate of 75% component against Propionibacterium acnes and Staphylococcus epidermidis;

[0040] Fig.11 It is the antibacterial rate of 100% component against Propionibacterium acnes and Staphylococcus epidermidis. DETAILED DESCRIPTION

[0041] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is described in detail below in conjunction with specific embodiments. It should be noted that the following embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be noted that for those of ordinary skill in the art, several variations and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0042] All raw materials of the present invention are not particularly limited in their sources and can be purchased from the market or prepared according to conventional methods known to those skilled in the art.

[0043] The experimental strains used in the examples of this application are:

[0044] Staphylococcus epidermidis CCSMS0776 was isolated from healthy skin and deposited in China General Microbiological Culture Collection Center with the deposit number: CGMCC 30873.

[0045] Staphylococcus epidermidis (ATCC35984, ATCC12228) and Propionibacterium acnes (ATCC11827, ATCC6919) were purchased from the American Type Culture Collection (ATCC).

[0046] The culture medium used in the examples of this application is:

[0047] (1) TSB medium: 17 g / L trypticase, 3 g / L soybean papain hydrolysate, 5 g / L sodium chloride, 2.5 g / L potassium dihydrogen phosphate, 2.5 g / L glucose, sterilized at 121°C for 15 min, set aside;

[0048] (2) TSA: 15 g / L trypticase, 5 g / L soybean papain hydrolysate, 5 g / L sodium chloride, 15 g / L agar, sterilize at 121°C for 15 min, and set aside.

[0049] Example 1 Isolation, Screening and Purification of Staphylococcus epidermidis CCSMS0776

[0050] (1) Microbial sample collection:

[0051] Healthy scalp volunteers were recruited, and an area of ​​approximately 2 cm × 2 cm was selected on both sides of the scalp. A sterile cotton swab was moistened in a wetting solution (0.9% sodium chloride and 0.1% Tween-20), and after rubbing the selected area back and forth 50 times, it was placed in a 5 mL centrifuge tube (EP tube), and 5 mL of normal saline (0.9% sodium chloride) was drawn into the EP tube and mixed thoroughly.

[0052] (2) Separation and purification:

[0053] The samples obtained above were diluted with physiological saline in a concentration gradient, and the appropriate dilution was selected. 0.1 mL of the dilution was applied to the TSA plate and placed in a 37°C incubator for 16 h. After multiple streaking purifications, the strains were set aside. The purified strains were stored in a cryopreservation tube using skim milk powder (the storage method is a routine operation of those skilled in the art, which will not be described in detail here), and were stored in a -80°C deep freezer after freeze-drying.

[0054] (3) Observation of bacterial morphology:

[0055] A small amount of bacteria was picked up and smeared on a glass slide and stained with Gram stain. The morphological characteristics of the bacteria were observed under an optical microscope.

[0056] Depend on Figure 1 It can be seen that the colonies of Staphylococcus epidermidis CCSMS0776 on TSA plates are round, with neat edges and milky white color, and the surface is moist, smooth, raised and easy to pick up; Gram staining is positive, and the bacterial cells are spherical, such as Figure 2 shown.

[0057] Example 2 Identification of Staphylococcus epidermidis CCSMS0776

[0058] A single colony of CCSMS0776 purified in Example 1 was picked up, inoculated into 10 mL of TSB medium, placed in a constant temperature shaker, and cultured at 37° C. for 14 to 16 h, then the bacterial solution was centrifuged (8000 r / min, 15 min) to collect the bacteria.

[0059] DNA was extracted using a DNA extraction kit (Shanghai Bioengineering Co., Ltd.). Two synthetic universal primers (16s 27F: GAGAGTTTGATCCTGGCTCAG, SEQ.ID.No.1; 16s 1492R: CGGCTACCTTGTTACGACTT, SEQ.ID.No.2) were used for PCR amplification. The PCR product was recovered using a column PCR product purification kit (Shanghai Bioengineering Co., Ltd.), and after purification, it was sent to Meiji Bioengineering Co., Ltd. for sequencing. The obtained 16S rDNA nucleotide sequence of CCSMS0776 is shown in SEQ.ID.No.3, and the sequence length is: 1454bp.

[0060] The strain CCSMS0776 was sent to GenBank for Blast analysis, and the strain with the highest homology to AB617572.1 was 99.93%.

[0061] According to Goodfellow and O'Donnell, species with DNA G+C (mol%) ≤ 10% to 12% and 16S rRNA sequence homology ≥ 95% can be classified as one genus, and Embley and Stackebrangdt believe that when the 16S rRNA sequence homology is ≥ 97%, it can be considered as one species. It can be inferred that strain CCSMS0776 and Staphylococcus epidermidis belong to the same species. Therefore, strain CCSMS0776 was identified as Staphylococcus epidermidis.

[0062] Based on the above-mentioned microbiological characteristics such as colony, bacterial morphology, culturing, physiological and biochemical identification and its genetic characteristics 16s rDNA, CCSMS0776 was identified as Staphylococcus epidermidis. The strain was deposited in the China General Microbiological Culture Collection Center on June 5, 2024, and its deposit number is CGMCC 30873.

[0063] Example 3 Plotting of the growth curve of Staphylococcus epidermidis CCSMS0776

[0064] (1) Strain activation:

[0065] A small amount of freeze-dried bacterial powder of Staphylococcus epidermidis CCSMS0776 stored in a -80°C refrigerator in Example 1 was picked up, streaked onto a TSA agar plate, placed in a 37°C constant temperature incubator for aerobic culture for 18-20 hours, activated twice, and set aside.

[0066] (2) Seed solution preparation:

[0067] The Staphylococcus epidermidis CCSMS0776 activated in step (1) was inoculated into TSB liquid culture medium and cultured in a shaking incubator at 37° C. for 18-20 h to serve as seed liquid.

[0068] (3) Growth curve and pH determination:

[0069] The seed solution of Staphylococcus epidermidis CCSMS0776 was inoculated into a triangular flask at a 2% (V / V) inoculation rate, and cultured in a shaking incubator at 37°C and 160 rpm. Samples were taken every 2 hours, and the bacterial OD at each sampling time point was measured. 600 And the pH of the fermentation supernatant were measured, and the growth curve and pH curve of the strain were drawn and plotted into a curve.

[0070] Depend on Figure 3 It can be seen that Staphylococcus epidermidis CCSMS0776 entered the logarithmic growth phase at 2 hours and the stable growth phase at 10 hours. The growth rate was rapid. As the bacteria grew, the strain produced acid and the pH of the fermentation liquid decreased.

[0071] Example 4 Determination of adhesion curve of Staphylococcus epidermidis CCSMS0776

[0072] (1) Strain activation:

[0073] A small amount of freeze-dried bacterial powder of Staphylococcus epidermidis CCSMS0776, ATCC 35984 and ATCC 12228 stored at -80°C was picked up, streaked on TSA agar plates, placed in a 37°C constant temperature incubator for aerobic culture for 16-20 hours, activated twice, and set aside.

[0074] (2) Seed solution preparation:

[0075] Staphylococcus epidermidis CCSMS0776, ATCC 35984 and ATCC 12228 were inoculated into TSB liquid culture medium and cultured in a shaking incubator at 37°C for 18-20 h. The OD of the fermentation broth was measured. 600 , adjusted to 1×10 7 CFU / mL is used as seed solution for later use.

[0076] (3) Determination of adhesion curve:

[0077] Add 150 μL of TSB liquid culture medium and three kinds of 50 μL seed solutions to a 96-well plate, and inoculate them into 6 96-well plates according to the time. Set four duplicate wells for each bacterial suspension and culture them in a 37°C constant temperature box. Take out one plate every 4 hours, pour out the liquid, wash the plate with 0.9% saline, dry it in a drying oven, add 0.01% crystal violet solution, let it stand for staining for 15 minutes, then wash away the excess crystal violet solution with sterile deionized water, dry it, release the fixed crystal violet with ethanol, and measure the absorbance at 595 nm.

[0078] Depend on Figure 4 It can be seen that the crystal violet semi-quantitative method was used to determine the biofilm-forming ability of Staphylococcus epidermidis CCSMS0776. Staphylococcus epidermidis ATCC 12228 was used as a negative control strain, which did not form a biofilm due to the lack of adhesion genes; Staphylococcus epidermidis ATCC 35984 was used as a positive control strain, which had a strong ability to produce biofilms and was a commonly used strain for studying Staphylococcus epidermidis biofilms. Staphylococcus epidermidis CCSMS0776 and Staphylococcus epidermidis ATCC 12228 were both non-film-producing strains, and their film-producing ability was significantly lower than that of the high-film-producing strain Staphylococcus epidermidis ATCC 35984.

[0079] Example 5 Determination of Antioxidant Capacity of Staphylococcus epidermidis CCSMS0776 Fermentation Supernatant

[0080] (1) Strain activation:

[0081] A small amount of freeze-dried bacterial powder of Staphylococcus epidermidis CCSMS0776 stored at -80°C was picked up, streaked on a TSA agar plate, placed in a 37°C constant temperature incubator for aerobic culture for 16-20 hours, activated twice, and set aside.

[0082] (2) Seed solution preparation:

[0083] Inoculate Staphylococcus epidermidis CCSMS0776 into TSB liquid culture medium and culture in a shaking incubator at 37°C for 18-20h. Measure the OD value of the fermentation liquid. 600 , as seed liquid.

[0084] (3) Collection of fermentation supernatant:

[0085] The seed solution of Staphylococcus epidermidis CCSMS 0776 was inoculated into a conical flask at a 2% (V / V) inoculation rate, and cultured in a shaking incubator at 37° C. and 160 rpm. Samples were taken every 4 hours, and the samples were centrifuged at 8000 rpm for 5 minutes.

[0086] (4) DPPH free radical scavenging assay:

[0087] Prepare 0.1 mmol / L DPPH stock solution with anhydrous ethanol, store at low temperature and away from light, and add the corresponding solution to a 96-well plate as follows:

[0088] A 0 --100μL water + 100μL DPPH;

[0089] A 1 --100 μL sample solution of different concentrations + 100 μL DPPH solution;

[0090] A 2 --100μL sample solution of different concentrations + 100μL anhydrous ethanol solution.

[0091] Mix the above solution and place it in a 37°C incubator to avoid light for 30 minutes. Measure A at 517 nm using an enzyme marker 0 , A 1 , A 2 The OD value of the reaction solution in the well was set up with 3 replicate wells for each sample, and the average value was taken to calculate the DPPH clearance rate of the sample according to the formula.

[0092] DPPH free radical scavenging rate % = [A 0 -A 1 +A 2 ] / A 0 ×100%

[0093] Depend on Figure 5 It can be seen that the fermentation supernatant of Staphylococcus epidermidis CCSMS0776 at different culture time points has strong antioxidant activity. As the fermentation time increases, its ability to scavenge DPPH free radicals increases. At 20 hours, the DPPH scavenging rate of the fermentation supernatant can be as high as 90%.

[0094] Example 6 Determination of antibacterial ability of Staphylococcus epidermidis CCSMS0776 fermentation supernatant

[0095] (1) Strain activation:

[0096] A small amount of freeze-dried bacterial powder of Staphylococcus epidermidis CCSMS0776, ATCC 35984 and ATCC 12228 stored at -80°C was picked up, streaked on TSA agar plates, placed in a 37°C constant temperature incubator for aerobic culture for 16-20 hours, activated twice, and set aside.

[0097] A small amount of freeze-dried bacterial powder of Propionibacterium acnes ATCC 11827 and ATCC 6919 was picked up, streaked onto TSA blood agar plates, and placed in a 37°C constant temperature incubator for anaerobic culture for 2-3 days.

[0098] (2) Seed solution preparation:

[0099] Staphylococcus epidermidis CCSMS0776, ATCC 35984 and ATCC 12228 were inoculated into TSB liquid culture medium and cultured in a shaking incubator at 37°C for 18-20 hours; Propionibacterium acnes ATCC 11827 and ATCC 6919 were inoculated into TSB liquid culture medium and cultured anaerobically at 37°C for 2-3 days, and the OD of the fermentation broth was measured. 600 , adjusted to 1×10 6 CFU / mL is used as seed solution for later use.

[0100] (3) Fermentation supernatant collection:

[0101] The activated Staphylococcus epidermidis CCSMS0776 seed solution was inoculated into a test tube at a 2% (v / v) inoculation amount and cultured at 180r / min and 37°C for 18-20h. After centrifugation at 4°C and 8000-10000r / min for 5min, the fermentation supernatant was obtained. The fermentation supernatant was adjusted to pH ≥ 6.0 with 0.5mol / L NaOH solution for antibacterial test. The fermentation supernatant was kept warm in a water bath at 80°C for 10min to remove the interference of hydrogen peroxide.

[0102] (4) Antibacterial assay of fermentation supernatant:

[0103] In vitro antibacterial experiments were performed using a 96-well plate and a 200μL system. The 11th column of the 96-well plate was used as a sterile control group, and the 12th column was used as a growth control group: 200μL of sterile TSB culture medium was added to the 11th column and set as a sterile control column; 100μL of each indicator bacteria suspension and 100μL of sterile TSB culture medium were added to the 12th column and set as a growth control column. The odd-numbered columns 1-10 were used as experimental groups: 50μL of the obtained fermentation supernatant, 50μL of each indicator bacteria suspension, and 100μL of sterile TSB culture medium were added to each sample well as the experimental group; the even-numbered columns were used as the corresponding blank control groups of the experimental groups: the indicator bacteria suspension of the experimental group was replaced with an equal amount of sterile TSB culture medium as a blank control, and 4 parallel wells were set for each group. The 96-well plate with the sample added was placed upright and cultured at 37°C for 20h. The absorbance was measured at a wavelength of 600nm, and the antibacterial rate of each sample was calculated by the following formula:

[0104]

[0105] (5) Antibacterial assay of concentrated fermentation supernatant:

[0106] The collected fermentation supernatant was filtered through an ultrafiltration membrane with a molecular weight cutoff of 10 kDa, and the effluent was concentrated by rotary evaporation to obtain a 4-fold concentrated fermentation supernatant. The antibacterial assay was performed according to the fermentation supernatant antibacterial assay method.

[0107] Depend on Figure 6It can be seen that the fermentation supernatant of Staphylococcus epidermidis CCSMS0776 and the 4-fold concentrated fermentation supernatant have obvious inhibitory effects on Propionibacterium acnes ATCC 11827 and ATCC 6919. The inhibition rates of the fermentation stock solution are 48% and 47%, respectively, and the inhibition rates of the concentrated supernatant are 54% and 61%, respectively. The inhibitory effect of the concentrated supernatant is better than that of the original fermentation stock solution. However, there is no obvious effect on Staphylococcus epidermidis ATCC 35984 and ATCC 12228.

[0108] Example 7 Preparation of Antimicrobial Peptide Crude Extract and Determination of Protein Content

[0109] (1) Preparation and collection of fermentation supernatant:

[0110] The same method as described in Example 6 was used to inoculate Staphylococcus epidermidis into TSB liquid culture medium, and the culture was placed at 37°C for 24 hours to obtain a fermentation broth, which was centrifuged at 4°C and 8000-10000 rpm / min for 10 minutes to obtain a fermentation supernatant. The fermentation supernatant was filtered through an ultrafiltration membrane with a molecular weight cutoff of 10 kDa, and the effluent was concentrated by rotary evaporation to obtain a 4-fold concentrated fermentation supernatant.

[0111] (2) Collection of antimicrobial peptides:

[0112] The crude extract of antimicrobial peptides was prepared by ammonium sulfate graded precipitation. First, the ammonium sulfate was ground into powder, slowly stirred and added to the fermentation supernatant to make the ammonium sulfate saturation reach 50%, and the precipitate was collected by centrifugation after being placed at 4°C for 24 hours. The saturation of the supernatant at this time was taken as the initial salting-out degree, and the salting-out was continued to make the ammonium sulfate saturation reach 75%, and the above operation was repeated. After the salting-out reached 100%, the salting-out precipitates of 75% and 100% gradients were placed in a 3500Da dialysis bag for desalting, dialyzed with deionized water, and the retained liquid was collected and freeze-dried to obtain a powdered crude extract of antimicrobial peptides. According to weighing calculation, about 0.4±0.04g of 75% component crude extract of antimicrobial peptides and 0.8±0.14g of 100% component crude extract of antimicrobial peptides can be obtained per liter of Staphylococcus epidermidis fermentation broth.

[0113] (3) Protein content determination:

[0114] The protein content of the crude extract of antimicrobial peptides was determined by the BCA method. BSA solutions with concentrations of 0, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / mL were used as standard protein solutions. The standard protein content was used as the abscissa and the absorbance at 595 nm was used as the ordinate to draw a standard curve. The linear regression equation was y=0.6104x+0.1267(R 2 =0.9988). The crude extract was reconstituted with water to a concentration of 0.5 mg / mL and the protein content was determined.

[0115] It was calculated that the protein content of the precipitated component with 75% saturation was 56.23%, and the protein content of the precipitated component with 100% saturation was 42.27%, indicating that the collected components mainly belonged to proteins.

[0116] Example 8 UV spectroscopy determination of crude antimicrobial peptide extracts

[0117] The crude antimicrobial peptide extract (75% component and 100% component) solution was prepared with sterile distilled water to a concentration of 10 mg / mL, and subjected to ultraviolet spectral scanning analysis within a wavelength range of 190 to 600 nm.

[0118] Depend on Figure 7 and Figure 8 It can be seen that the 75% and 100% components of the antimicrobial peptide produced by Staphylococcus epidermidis CCSMS0776 have strong absorption peaks near 220nm, which is a unique absorption feature of peptide bonds in the far ultraviolet region, consistent with literature reports, and further proves that the antibacterial substance produced is a polypeptide substance.

[0119] Example 9 Determination of Antioxidant Capacity of Antimicrobial Peptide Crude Extracts

[0120] DPPH free radical scavenging assay: The 75% and 100% antimicrobial peptide crude extracts were prepared into 10, 8, 4, 2 and 1 mg / mL solutions respectively with sterile distilled water. The specific operation was the same as in Example 5.

[0121] Depend on Fig. 9 It can be seen that the crude extract of antimicrobial peptides produced by Staphylococcus epidermidis CCSMS0776 (75%, 100%) has a strong DPPH free radical scavenging rate, and it increases with the increase of concentration. The antioxidant capacity of the crude extract of antimicrobial peptides at 100% saturation is better than that of the crude extract of antimicrobial peptides at 75% saturation. The experimental results show that the antimicrobial peptides produced by Staphylococcus epidermidis CCSMS0776 have strong antioxidant capacity.

[0122] Example 10 Determination of antibacterial ability of crude antimicrobial peptide extracts

[0123] (1) Strain activation:

[0124] Take a small amount of freeze-dried bacterial powder of Staphylococcus epidermidis CCSMS0776, ATCC 35984 and ATCC 12228 stored at -80℃, streak on TSA agar plate, place in a 37℃ constant temperature incubator for aerobic culture for 18-20h, activate twice, and set aside. Take a small amount of freeze-dried bacterial powder of Propionibacterium acnes ATCC 11827 and ATCC 6919, streak on TSA blood agar plate, place in a 37℃ constant temperature incubator for anaerobically culture for 2-3d.

[0125] (2) Seed solution preparation:

[0126] Staphylococcus epidermidis CCSMS0776, ATCC 35984 and ATCC 12228 were inoculated into TSB liquid culture medium and cultured in a shaking incubator at 37°C for 18-20 hours; Propionibacterium acnes ATCC 11827 and ATCC 6919 were inoculated into TSB liquid culture medium and cultured anaerobically at 37°C for 2-3 days, and the OD of the fermentation broth was measured. 600 , adjusted to 1×10 6 CFU / mL is used as seed solution for later use.

[0127] (2) Determination of antibacterial ability:

[0128] The prepared antimicrobial peptide crude extract was dissolved in sterile water and diluted by the two-fold dilution method to prepare 12.5, 6.25, 3.125, 1.56250, 0.78125, 0.39063, 0.19531, and 0.09766 mg / mL solutions, respectively. The antibacterial activity was determined using TSB as a control and Propionibacterium acnes and Staphylococcus epidermidis as indicator bacteria.

[0129] Depend on Fig.10 and Fig.11 It can be seen that the 75% and 100% components showed obvious inhibitory effects on Propionibacterium acnes ATCC 11827 and ATCC 6919, among which the 75% component had an increased inhibitory effect on Propionibacterium acnes as the concentration of the crude antimicrobial peptide extract increased. The 75% component had an inhibition rate of 63% on Propionibacterium acnes ATCC 11827 at a concentration of 1.5625 mg / mL, and an inhibition rate of 70% on Propionibacterium acnes ATCC 6919; the 100% component had an inhibition rate of 50% on Propionibacterium acnes ATCC11827 at a concentration of 1.5625 mg / mL, and an inhibition rate of 60% on Propionibacterium acnes ATCC 6919, but the 75% component and the 100% component had no obvious inhibitory effect on Staphylococcus epidermidis, and as the concentration of the crude antimicrobial peptide extract increased, the growth of Staphylococcus epidermidis ATCC12228 was promoted.

[0130] The present invention provides a strain of Staphylococcus epidermidis isolated from healthy skin, and its fermentation supernatant, membrane filtration concentrate and crude antimicrobial peptide have good effects of inhibiting Propionibacterium acnes, providing new strain resources for the development of new antimicrobial peptides. The antimicrobial peptide of Staphylococcus epidermidis provided by the present invention has good inhibition of Propionibacterium acnes, but has no significant inhibition on the growth of Staphylococcus epidermidis, can specifically inhibit Propionibacterium acnes, regulate the skin microecological balance of acne patients, provide new solutions for the prevention and treatment of acne, and has broad application prospects in the treatment of acne.

[0131] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

[0132] The nucleic acid / amino acid sequences involved in this application include:

[0133] SEQ.ID.No.1 (universal primer 16s 27F):GAGAGTTTGATCCTGGCTCAG;

[0134] SEQ.ID.No.2 (Universal Primer 16s 1492R): CGGCTACCTTGTTACGACTT.

[0135] SEQ.ID.No.3 (16S rDNA nucleotide sequence of CCSMS0776):

[0136]

Claims

1. A strain of Staphylococcus epidermidis CCSMS0776 producing antimicrobial peptides, characterized in that: The Staphylococcus epidermidis was deposited in the China General Microbiological Culture Collection Center on June 5, 2024, with the collection number CGMCC 30873.

2. The antimicrobial peptide-producing Staphylococcus epidermidis CCSMS0776 according to claim 1, characterized in that: The 16S rDNA nucleotide sequence of the antimicrobial peptide-producing Staphylococcus epidermidis CCSMS0776 is shown in SEQ.ID.No.

3.

3. The antimicrobial peptide-producing Staphylococcus epidermidis CCSMS0776 according to claim 1, characterized in that: The fermentation supernatant of Staphylococcus epidermidis CCSMS0776 is prepared by: inoculating Staphylococcus epidermidis CCSMS0776 into a fermentation container and culturing to obtain a fermentation liquid; and centrifuging the fermentation liquid to remove the bacterial cells to obtain the fermentation supernatant of Staphylococcus epidermidis CCSMS0776.

4. The antimicrobial peptide-producing Staphylococcus epidermidis CCSMS0776 according to claim 3, characterized in that: The inoculation amount is 1.8-2.2% (V / V); the culture condition is 36-38°C.

5. The antimicrobial peptide-producing Staphylococcus epidermidis CCSMS0776 according to claim 4, characterized in that: The centrifugal conditions are 6000-10000 r / min, 5-10 min.

6. An antimicrobial peptide, characterized in that The antimicrobial peptide is derived from Staphylococcus epidermidis CCSMS0776 as claimed in claim 1.

7. An antimicrobial peptide according to claim 6, characterized in that: The preparation method of the antimicrobial peptide comprises the following steps: filtering the fermentation supernatant of the Staphylococcus epidermidis CCSMS0776 through an ultrafiltration membrane and precipitating by ammonium sulfate, collecting precipitate components with 75% and 100% saturation, dialyzing and freeze-drying to obtain the antimicrobial peptide.

8. Use of the Staphylococcus epidermidis CCSMS0776 and the fermentation supernatant thereof as claimed in claim 1, or the antimicrobial peptide as claimed in claim 5 in the preparation of antioxidant and antibacterial products.

9. The use according to claim 8, characterized in that: The product is any of the following types: 1) A product for improving acne; the product for improving acne is used to inhibit the growth of Propionibacterium acnes; 2) Products that regulate the balance of skin flora.

10. The use according to claim 8, characterized in that The product is at least any one of medicines, skin care products, and hair care products.

Images