A method for improving the production of steroid drug precursors by blocking the triacylglycerol synthesis pathway, a genetically engineered bacterium, and applications thereof
By knocking out the tgs1 and dosR genes in neo-Medicabacterium neogenous, blocking the TAG synthesis pathway, the bacterial growth inhibition and energy metabolism imbalance in the production of steroid hormone drug intermediates by microbial method are solved, and the conversion rate and production efficiency are improved.
Patent Information
- Application Number
- CN202510442548.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-10
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2045-04-10
AI Technical Summary
The prior art When producing steroid hormone drug intermediates in microbial methods, it faces the problems of inhibition of bacterial growth and imbalance in energy metabolism, resulting in low conversion rate and low production efficiency, especially the reduction of strain vitality under environmental stress.
By knocking out the key gene tgs1 of the TAG synthesis pathway and the transcriptional regulator dosR in the fast-growing neoproterozoa auricobacteria MNR M3, the genetically engineered strains MNR-ΔdosR and MNR-Δtgs1 were constructed to block the TAG synthesis pathway and improve energy metabolism and conversion rates.
It significantly improves the conversion rate and intracellular energy substance content of steroid hormone drug intermediates, solves the problem of bacterial growth inhibition, and improves the production efficiency and molar generation rate of AD.
Smart Images

Figure CN119955702B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of biocatalysis and biotechnology, and in particular relates to a method, a genetically engineered bacterium and an application for improving the production of steroid drug precursors by blocking the triacylglycerol synthesis pathway. Background Art
[0002] Steroid hormones are widely used as clinical drugs because they are small in molecular weight and large in liposolubility, and can easily enter cells and cause a series of biochemical reactions. Currently, steroid hormones have become the second largest class of drugs after antibiotics. Among them, 4-androstene-3,17-dione (AD) is the starting material for the production of almost all steroid hormone drugs, and can be used to synthesize various steroid drugs such as cortisone, progesterone, and testosterone. Currently, the market demand for AD has exceeded 1 billion US dollars.
[0003] Currently, the microbial transformation method is mainly used for the production of AD. The biological production of AD uses the enzyme system of microorganisms to modify specific parts of the substrate. Compared with the traditional chemical method, the microbial transformation method has the advantages of environmental friendliness and high substrate specificity. In industrial production, the method of using Mycobacterium spp. to degrade the side chain of phytosterols to produce value-added synthetic products such as AD and other steroid hormone intermediates has attracted much attention.
[0004] Mycobacterium sp. MNR M3 faces a large number of environmental stress problems such as insufficient oxygen uptake, toxicity of substrates and products to the strain during the process of degrading phytosterols. These biotic and abiotic stresses during the production process always affect the production efficiency of AD and ultimately affect the fermentation performance of the strain. Uneven energy supply during the process of degrading phytosterols will also lead to growth inhibition of the bacteria. Therefore, the most crucial issue now is to solve the problem of growth inhibition of the bacteria.
[0005] The transcriptional regulator DosR and the triacylglycerol synthase tgs1 have the ability to regulate the TAG pathway and can initiate the energy metabolism mechanism to respond to adverse environments, but there is no relevant research on the relationship between DosR, Tgs1 and the TGA pathway in the existing technology.
[0006] For the improvement of the AD conversion rate, current technologies usually use genetic engineering to intervene in the key genes of the metabolic pathway. However, the engineered bacteria still show a decrease in vitality during fermentation, which affects the performance of the strains in the later stage of fermentation. This is also the reason why AD cannot be mass-produced. When M. tuberculosis is under environmental stress, the growth and metabolic activity of the bacteria decrease, and the synthesis of triacylglycerol (TAG) is enhanced through energy metabolism transfer to store energy and enter the dormant mode. DosR activates the initiation of this energy metabolism transfer mechanism by regulating the key enzyme of the TAG synthesis pathway, promoting the flow of acetyl-CoA to the TAG synthesis pathway to respond to environmental stress. The regulatory protein of DosR in the TAG synthesis pathway is the triacylglycerol synthase tgs1. The loss of tgs1 activity will lead to a significant decrease in the intracellular TAG content of the strain. Blocking the TAG pathway confirms its role in energy metabolism transfer during the conversion of phytosterols. Summary of the Invention
[0007] An object of the present invention is to overcome the deficiencies in the prior art and provide a method, genetically engineered bacteria and application for improving the production of steroidal drug precursors by blocking the triacylglycerol synthesis pathway.
[0008] The technical solution adopted by the present invention to solve its technical problems is:
[0009] One of the technical solutions provided by the present invention is two strains of engineered bacteria capable of producing intermediates of steroidal hormones. The two strains are obtained by knocking out the key genes affecting the TAG synthesis pathway in the starting strain; the key genes affecting the TAG synthesis pathway include: the key enzyme tgs1 and the transcriptional regulator dosR;
[0010] Furthermore, the effects of the two strains of genetically engineered bacteria on the growth of the bacteria and AD conversion;
[0011] Furthermore, the effects of blocking the TAG synthesis pathway by the two strains of genetically engineered bacteria on the content of key energy substances in the strains;
[0012] Furthermore, the starting strain is a strain capable of producing intermediates of steroidal hormones;
[0013] The intermediates of steroidal hormones include, but are not limited to, androst-4-ene-3,17-dione (AD), androst-1,4-diene-3,17-dione (ADD), 9α-hydroxyandrost-4-ene-3,17-dione (9α-OH-AD), etc.;
[0014] Furthermore, the starting strain is Escherichia coli BL21 strain, Mycobacterium tuberculosis, Mycobacterium neoaurum, etc.;
[0015] Preferably, the starting strain is the fast-growing Mycobacterium sp. MNR M3, which is selected from Chinese Patent CN115216435A, Application No. 202210421339.3, a method for improving sterol conversion by enhancing intracellular cofactor metabolism and sugar metabolism;
[0016] More preferably, the two genetically engineered strains capable of producing steroid hormone intermediates are obtained by using the fast-growing Mycobacterium sp. MNR M3 as the starting strain and knocking out tgs1 and dosR respectively;
[0017] Furthermore, the key enzyme tgs1 affecting the TAG synthesis pathway has a nucleotide sequence as shown in SEQ ID NO.1;
[0018] Furthermore, the transcriptional regulator dosR affecting the TAG synthesis pathway has a nucleotide sequence as shown in SEQ ID NO.2;
[0019] Furthermore, the above-mentioned genetically engineered strain is obtained by knocking out the key enzyme tgs1 and the transcriptional regulator dosR affecting the TAG synthesis pathway through knockout vectors respectively;
[0020] Furthermore, the above-mentioned genetic engineering knockout vector is a bacterial knockout vector;
[0021] Preferably, the above-mentioned bacterial knockout vector is a Mycobacterium knockout vector;
[0022] Furthermore, the above-mentioned genetic engineering expression vector is a bacterial expression vector;
[0023] Preferably, the above-mentioned bacterial expression vector is a Mycobacterium expression vector;
[0024] More preferably, the above-mentioned Mycobacterium expression vectors are pMV306 and pMV261 Mycobacterium-Escherichia coli shuttle expression vectors; the above-mentioned Mycobacterium knockout vector contains all or part of the sequences of plasmids p2NIL and pGOAL19.
[0025] The second technical solution provided by the present invention is to provide a method for constructing the above-mentioned genetically engineered strain, including the following steps:
[0026] (1) Preparation of MNR M3 competent cells: Inoculate the fast-growing Mycobacterium sp. MNR M3 into LB medium and culture it at 30 °C until the OD 600 reaches 1.0. Transfer it to the seed medium at an inoculation amount of 10% of the medium volume for secondary seed culture; after 24 h, add glycine with a mass concentration of 2% and continue to culture at 30 °C and 200 rpm for 24 h. Centrifuge and collect the cells at 4 °C, and rinse and suspend the cells with pre-cooled glycerol with a volume concentration of 10% at 1 time, 3 / 4 times, 1 / 2 times, and 1 / 4 times the volume of the seed solution respectively, and then centrifuge at 4 °C. Finally, suspend the cells with glycerol with a volume concentration of 10% at 1 / 25 times the volume to obtain MNR M3 competent cells, and aliquot and store them;
[0027] Among them, the composition of the seed medium: K2HPO4 0.1 - 3 g / L, MgSO4 0.1 - 3 g / L, ammonium ferric citrate 0.01 - 0.2 g / L, citric acid 1 - 5 g / L, ammonium nitrate 1 - 5 g / L, glycerol 5 - 50 g / L, glucose 5 - 50 g / L, CaCO3 1 - 5 g / L, and the rest is water, pH 6.0 - 7.5;
[0028] The composition of the fermentation medium: K2HPO4 0.1 - 3 g / L, MgSO4 0.1 - 3 g / L, ammonium ferric citrate 0.01 - 0.2 g / L, citric acid 1 - 5 g / L, diammonium hydrogen phosphate 1 - 10 g / L, glucose 5 - 50 g / L, phytosterol 1 - 50 g / L, and the rest is water, pH 6.0 - 7.5;
[0029] (2) Construction of knockout plasmids: Design upstream and downstream arm primers for the dosR and tgs1 genes, and use the genomic DNA of MNR M3 as a template to amplify the upstream and downstream homologous arms of dosR and tgs1; the upstream and downstream arm primers for the dosR and tgs1 genes are primers DosR-UP-F, DosR-UP-R, DosR-down -F, DosR-down-R, Tgs1-UP-F, Tgs1-UP-R, Tgs1-down-F, Tgs1-down-R, and their nucleotide sequences are shown in SEQ ID NO.3 to SEQ ID NO.10 in sequence;
[0030] Amplify the upstream and downstream homologous arm genes of the target genes dosR and tgs1 respectively by PCR technology and ligate them onto the Mycobacterium gene knockout plasmid p2NIL digested with BamHⅠ and HindⅢ; then, digest the above plasmid and pGOAL19 plasmid with PacI respectively and ligate them with T4 ligase to construct gene knockout plasmids pKO-dosR and pKO-tgs1, and verify them by digestion;
[0031] (3) 10 μL of pKO-dosR and pKO-tgs1 knockout plasmids were respectively added to 100 μL of MNR M3 competent cells, incubated for 30 minutes, and then transferred to an electroporation cuvette for electroporation; under the electroporation conditions of 2 kV / cm, 25 μF, and 720 Ω, electroporation was performed for 3 - 6 ms, followed by incubation on ice for 5 min. Then, the mixture was transferred to a newly sterilized 1.5 mL centrifuge tube and 500 μL of freshly sterilized LB medium was added. The cells were resuscitated at 30 °C and 200 rpm for 3 - 24 hours; the cells were spread on LB solid medium containing hyg 50 μg / ml, Kan 20 μg / ml, and X-gal 50 μg / ml and cultured for 5 - 7 days. Blue colony-containing strains were picked, and PCR verification was performed using the upstream forward primers DosR-UP-F / Tgs1-UP-F and the downstream reverse primers DosR-down-R / Tgs1-down-R to obtain single crossover strains; the verified single crossover strains were respectively spread on sucrose plates with a mass concentration of 2% and cultured in an inverted position at 30 °C for 3 - 7 days. White colony-containing strains were picked, genomic DNA was extracted, and PCR verification was performed using the upstream forward primers DosR-UP-F / Tgs1-UP-F and the downstream reverse primers DosR-down-R / Tgs1-down-R. After successful verification, the dosR gene deletion strain was named MNR-ΔdosR, and the tgs1 gene deletion strain was named MNR-Δtgs1.
[0032] The third technical solution provided by the present invention is the application of the genetically engineered bacterium described in Technical Solution 1 in the production of steroid hormone drug intermediates, particularly in the production of AD.
[0033] The method for producing 4-androstene-3,17-dione using the genetically engineered bacterium as described above includes the following steps:
[0034] The seed culture solution of the genetically engineered bacterium was transferred to a fermentation medium at an inoculation amount of 2 - 10%, and cultured at 25 - 35 °C and 50 - 200 rpm for 24 - 168 h.
[0035] Further, the yield of 4-androstene-3,17-dione can reach 0.3 - 30 g / L, and the molar conversion rate can reach 50% - 100%.
[0036] Further, the formula of the fermentation medium is: K2HPO4 0.1 - 3 g / L, MgSO4 0.1 - 3 g / L, ammonium ferric citrate 0.01 - 0.2 g / L, citric acid 1 - 5 g / L, diammonium hydrogen phosphate 1 - 10 g / L, glucose 5 - 50 g / L, phytosterol 1 - 50 g / L, with the rest being water, and the pH is 6.0 - 7.5;
[0037] The formula of the seed culture medium is as follows: K2HPO4 0.1 - 3 g / L, MgSO4 0.1 - 3 g / L, ammonium ferric citrate 0.01 - 0.2 g / L, citric acid 1 - 5 g / L, ammonium nitrate 1 - 5 g / L, glycerol 5 - 50 g / L, glucose 5 - 50 g / L, CaCO3 1 - 5 g / L, with the rest being water, and the pH is 6.0 - 7.5.
[0038] The advantages and positive effects achieved by the present invention are as follows:
[0039] 1. By separately knocking out the key transcriptional regulatory factor dosR and the key synthetic enzyme tgs1 in the TAG synthesis pathway in the steroid hormone intermediate-producing bacterium MNR M3, the recombinant strains MNR-ΔdosR and MNR-Δtgs1 are obtained. During the fermentation process, the molar production rate of AD of MNR-ΔdosR and MNR-Δtgs1 is higher than that of MNR. Among them, at 72 h of fermentation, the molar production rate of AD of MNR-ΔdosR is increased by 19.89% compared with the original strain, which is 1.51 times the molar production rate of AD of MNR; the intracellular acetyl-CoA content of MNR-ΔdosR and MNR-Δtgs1 is significantly increased compared with the original strain MNR. At 72 h of fermentation, the intracellular acetyl-CoA content of MNR-ΔdosR and MNR-Δtgs1 is increased by 49.97% and 43.46% respectively compared with MNR. Further, the intracellular ATP content of MNR-ΔdosR and MNR-Δtgs1 is significantly increased. Among them, at 48 h of conversion, the intracellular ATP content of MNR-ΔdosR and MNR-Δtgs1 is increased by 41.93% and 22.46% respectively compared with MNR.
[0040] 2. The present invention first proves the role of the transcriptional regulatory factor DosR and the key synthetic enzyme tgs1 in the production of steroid drug precursors using phytosterols. The present invention significantly improves the conversion rate of AD, and the effect of MNR-ΔdosR is the most obvious, with the AD conversion rate increased by 9.49% compared with the starting strain MNR in the same period.
[0041] 3. The present invention solves the problem that in the production of steroid drug precursors by the microbial method, insufficient intracellular energy supply in the early stage of fermentation leads to low conversion efficiency and then high prices of steroid drug precursors, providing a new method for improving the production capacity of steroid hormone intermediate-producing strains. This method can also be used for other industrial production strains and has broad application value. The present invention solves the problem that in the production of steroid hormone intermediates, the viability of the strain decreases due to environmental stress, resulting in low yields of steroid hormone intermediates. Description of the Drawings
[0042] Figure 1Verification diagram of the genotype of the dosR knockout bacteria in the present invention;
[0043] Among them, lane M is the DNA standard marker, lane 1 is the amplification band containing the complete dosR gene, and lane 2 is the amplification band containing the dosR gene with a 500bp deletion after knockout (the starting strain has an amplification band at 2729bp, and the knockout strain has a band at 2329bp due to the deletion of dosR, and the deleted 500bp is dosR);
[0044] Figure 2 Verification diagram of the genotype of the tgs1 knockout bacteria in the present invention;
[0045] Among them, lane M is the DNA standard marker, lane 2 is the amplification band containing the complete tgs1 gene, and lane 1 is the amplification band containing the tgs1 gene with a 1239bp deletion after knockout (the starting strain has an amplification band at 2589bp, and the knockout strain has a band at 1350bp due to the deletion of tgs1, and the deleted 1239bp is tgs1);
[0046] Figure 3 Variation diagram of the intracellular TAG content of the strains MNR-ΔdosR, MNR-Δtgs1, and MNR in the present invention;
[0047] Figure 4 Variation diagram of the intracellular acetyl-CoA content of MNR-ΔdosR, MNR-Δtgs1, and MNR in the present invention;
[0048] Figure 5 Variation diagram of the intracellular ATP content of MNR-ΔdosR, MNR-Δtgs1, and MNR in the present invention;
[0049] Figure 6 Variation diagram of the AD molar production rate of MNR-ΔdosR, MNR-Δtgs1, and MNR in the present invention. Detailed implementation manners
[0050] The following further illustrates the present invention in conjunction with embodiments. The following embodiments are narrative and not restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.
[0051] All kinds of experimental operations involved in the specific embodiments are conventional techniques in the art. For parts not specifically annotated in this article, those of ordinary skill in the art can refer to various common reference books, scientific and technological literatures, or relevant specifications, manuals, etc. before the filing date of the present invention application for implementation.
[0052] A genetically engineered bacterium capable of performing sterol conversion, which is obtained by knocking out the key genes affecting the TAG synthesis pathway in the starting strain;
[0053] The starting strain is a strain with the ability to produce steroid hormone intermediates.
[0054] Preferably, the starting strains include Escherichia coli BL21 strain, Mycobacterium tuberculosis, and Mycobacterium neoaurum;
[0055] Alternatively, the steroid hormone intermediates include androst-4-ene-3,17-dione (AD), androst-1,4-diene-3,17-dione (ADD), and 9α-hydroxyandrost-4-ene-3,17-dione (9α-OH-AD).
[0056] Preferably, the strain uses the fast-growing Mycobacterium sp. MNR M3 as the starting strain, which is selected from Chinese Patent CN115216435A, Application No. 202210421339.3, a method for improving sterol conversion by enhancing intracellular cofactor metabolism and sugar metabolism.
[0057] Preferably, the key genes of the TAG synthesis pathway include: the transcriptional regulator dosR and the key enzyme tgs1. The nucleotide sequence of the key enzyme tgs1 is shown in SEQ ID NO.1, and the nucleotide sequence of the transcriptional regulator dosR is shown in SEQ ID NO.2.
[0058] The method for constructing the genetic engineering bacterium as described above includes the following steps:
[0059] (1) Preparation of MNR M3 competent cells: Inoculate Mycobacterium sp. MNR M3 into LB medium and culture at 30 °C until the OD 600 reaches 1.0, transfer it to the seed medium at an inoculation amount of 10% of the medium volume for secondary seed culture; after 24 h, add glycine with a mass concentration of 2% and continue to culture at 30 °C and 200 rpm for 24 h. Centrifuge to collect the cells at 4 °C, wash and resuspend the cells with pre-cooled glycerol with a volume concentration of 10% at 1-fold, 3 / 4-fold, 1 / 2-fold, and 1 / 4-fold of the seed liquid volume respectively and centrifuge at 4 °C. Finally, resuspend the cells with glycerol with a volume concentration of 10% at 1 / 25-fold volume to obtain MNR M3 competent cells, and aliquot and store them;
[0060] Among them, the composition of the seed culture medium is as follows: K2HPO4 0.1 - 3 g / L, MgSO4 0.1 - 3 g / L, ammonium ferric citrate 0.01 - 0.2 g / L, citric acid 1 - 5 g / L, ammonium nitrate 1 - 5 g / L, glycerol 5 - 50 g / L, glucose 5 - 50 g / L, CaCO3 1 - 5 g / L, and the rest is water, with a pH of 6.0 - 7.5;
[0061] The composition of the fermentation culture medium is as follows: K2HPO4 0.1 - 3 g / L, MgSO4 0.1 - 3 g / L, ammonium ferric citrate 0.01 - 0.2 g / L, citric acid 1 - 5 g / L, diammonium hydrogen phosphate 1 - 10 g / L, glucose 5 - 50 g / L, phytosterol 1 - 50 g / L, and the rest is water, with a pH of 6.0 - 7.5;
[0062] (2) Construction of knockout plasmids: Design upstream and downstream arm primers for the dosR and tgs1 genes, and use the genomic DNA of MNR M3 as a template to amplify the upstream and downstream homologous arms of dosR and tgs1; the upstream and downstream arm primers for the dosR and tgs1 genes are primers DosR-UP-F, DosR-UP-R, DosR-down -F, DosR-down-R, Tgs1-UP-F, Tgs1-UP-R, Tgs1-down-F, Tgs1-down-R, and their nucleotide sequences are shown in SEQ ID NO.3 to SEQ ID NO.10 in sequence;
[0063] Amplify the upstream and downstream homologous arm genes of the target genes dosR and tgs1 respectively by PCR technology and ligate them onto the Mycobacterium gene knockout plasmid p2NIL digested with BamHⅠ and HindⅢ; then, digest the above plasmid and pGOAL19 plasmid with PacI respectively and ligate them with T4 ligase to construct the gene knockout plasmids pKO-dosR and pKO-tgs1, and verify by enzyme digestion;
[0064] (3) 10 μL of pKO-dosR and pKO-tgs1 knockout plasmids were separately added to 100 μL of MNR M3 competent cells, incubated for 30 minutes, and then transferred to an electroporation cuvette for electroporation. After electroporation at 2 kV / cm, 25 μF, and 720 Ω for 3 - 6 ms, the cells were placed on ice for 5 minutes, transferred to a newly sterilized 1.5 mL centrifuge tube, and 500 μL of freshly sterilized LB medium was added. The cells were resuscitated at 30 °C and 200 rpm for 3 - 24 hours, spread on LB solid medium containing 50 μg / ml hyg, 20 μg / ml Kan, and 50 μg / ml X-gal, and cultured for 5 - 7 days. Blue colonies were picked, and the single crossover strains were verified by PCR using the upstream forward primers DosR-UP-F / Tgs1-UP-F and the downstream reverse primers DosR-down-R / Tgs1-down-R respectively. The verified single crossover strains were separately spread on 2% sucrose plates and incubated at 30 °C in an inverted position for 3 - 7 days. White colonies were picked, genomic DNA was extracted, and PCR verification was performed using the upstream forward primers DosR-UP-F / Tgs1-UP-F and the downstream reverse primers DosR-down-R / Tgs1-down-R respectively. After successful verification, the dosR gene deletion strain was named MNR-ΔdosR, and the tgs1 gene deletion strain was named MNR-Δtgs1.
[0065] Application of the genetically engineered bacteria as described above in steroid transformation.
[0066] Preferably, the steroid is 4-androstene-3,17-dione.
[0067] A method for producing 4-androstene-3,17-dione using the genetically engineered bacteria as described above, comprising the following steps:
[0068] The seed culture solution of the genetically engineered bacteria was transferred to a fermentation medium at an inoculation amount of 2 - 10%, and cultured at 25 - 35 °C and 50 - 200 rpm for 24 - 168 h.
[0069] Preferably, the yield of 4-androstene-3,17-dione can reach 0.3 - 30 g / L, and the molar conversion rate can reach 50% - 100%.
[0070] Preferably, the formula of the fermentation medium is: K2HPO4 0.1 - 3 g / L, MgSO4 0.1 - 3 g / L, ammonium ferric citrate 0.01 - 0.2 g / L, citric acid 1 - 5 g / L, diammonium hydrogen phosphate 1 - 10 g / L, glucose 5 - 50 g / L, phytosterol 1 - 50 g / L, the rest is water, pH 6.0 - 7.5;
[0071] The formula of the seed culture medium is as follows: K2HPO4 0.1 - 3 g / L, MgSO4 0.1 - 3 g / L, ammonium ferric citrate 0.01 - 0.2 g / L, citric acid 1 - 5 g / L, ammonium nitrate 1 - 5 g / L, glycerol 5 - 50 g / L, glucose 5 - 50 g / L, CaCO3 1 - 5 g / L, with the rest being water, and the pH is 6.0 - 7.5.
[0072] Specifically, the related preparation and detection are as follows:
[0073] Some of the amplification primers involved in the embodiments of the present invention are as follows:
[0074] DosR upper arm primers DosR-UP-F and DosR-UP-R:
[0075] DosR-UP-F: cataaactaccgcattaaagcttcggaaagatccccggc;
[0076] DosR-UP-R: ttcttcaccgtcttctcggcgagcgcctcggcgaccgtgc;
[0077] DosR lower arm primers DosR-down -F and DosR-down-R:
[0078] DosR-down -F: gccgagaagacggtgaagaa;
[0079] DosR-down-R: actatagaatacataggatcccgcttcacccgcgcagtc.
[0080] Tgs1 upper arm primers Tgs1-UP-F and Tgs1-UP-R:
[0081] Tgs1-UP-F: taaactaccgcattaaagcttgaggcagcgccgcagaccgc;
[0082] Tgs1-UP-R: gttgtacgactcatagccgagcccaccg;
[0083] Tgs1 lower arm primers Tgs1-down-F and Tgs1-down-R:
[0084] Tgs1-down-F: tcggctatgagtcgtacaacggatgctctactT;
[0085] Tgs1-down-R: actatagaatacataggatccatggaggtggggatcaggtt。
[0086] For the experimental methods without specific conditions in the following examples, they are usually carried out according to conventional conditions, such as those described in "Molecular Cloning: A Laboratory Manual (4th Edition)" (Science Press, 2017).
[0087] The present invention will be further explained and illustrated through specific examples below.
[0088] Example 1 Construction of Engineering Bacteria with Deletion of DosR and Tgs1 Coding Genes
[0089] Construct a Mycobacterium gene knockout plasmid, electrotransform it into Mycobacterium competent cells, and perform double-antibiotic screening using hygromycin and kanamycin while simultaneously performing blue-white screening. Screen the correctly screened strains on a sucrose plate and simultaneously perform a kanamycin resistance re-screen to obtain gene knockout positive clones. Verify the gene knockout clones using the PCR method. The specific steps are as follows:
[0090] 1. Preparation of MNR M3 competent cells: Inoculate the MNR M3 strain (the strain is Mycobacterium sp. MNR M3, a rapidly growing new golden mycolic acid bacillus, which is selected from Chinese Patent CN115216435A, application number 202210421339.3, a method for improving sterol conversion by strengthening intracellular cofactor metabolism and sugar metabolism) into LB medium and culture it at 30 °C until the OD 600 is about 1.0, transfer it to the seed medium at an inoculation amount of 10% of the medium volume for secondary seed culture; after 24 h, add glycine with a mass concentration of 2% and continue to culture at 30 °C and 200 rpm for 24 h. Centrifuge the cells at 4 °C to collect the cell mass, wash and resuspend the cell mass with pre-cooled glycerol with a volume concentration of 10% at 1 times, 3 / 4 times, 1 / 2 times, and 1 / 4 times the volume of the seed liquid respectively and centrifuge at 4 °C. Finally, add glycerol with a volume concentration of 10% at 1 / 25 times the volume to resuspend the cell mass and aliquot for storage.
[0091] Composition of the seed medium: K2HPO4 0.1 - 3 g / L, MgSO4 0.1 - 3 g / L, ammonium ferric citrate 0.01 - 0.2 g / L, citric acid 1 - 5 g / L, ammonium nitrate 1 - 5 g / L, glycerol 5 - 50 g / L, glucose 5 - 50 g / L, CaCO3 1 - 5 g / L, the rest is water, pH 6.0 - 7.5.
[0092] Composition of fermentation medium: K2HPO4 0.1 - 3 g / L, MgSO4 0.1 - 3 g / L, ammonium ferric citrate 0.01 - 0.2 g / L, citric acid 1 - 5 g / L, diammonium hydrogen phosphate 1 - 10 g / L, glucose 5 - 50 g / L, phytosterol 1 - 50 g / L, the rest is water, pH 6.0 - 7.5.
[0093] 2. Construction of knockout plasmid: Design upstream and downstream arm primers for dosR and tgs1 genes. Using the genomic DNA of M3 (Mycobacterium sp. MNR M3, the genomic DNA of the starting strain) as a template, amplify the upstream and downstream homologous arms of dosR and tgs1.
[0094] Amplify the upstream and downstream homologous arm genes of the target genes dosR and tgs1 respectively by PCR technology, and ligate them onto the Mycobacterium gene knockout plasmid p2NIL digested with BamHⅠ and HindⅢ using the Minerva Super Fusion Cloning Kit seamless cloning kit. Then, digest the above plasmid and pGOAL19 plasmid with PacI respectively and ligate them using T4 ligase to construct the gene knockout plasmids pKO - dosR and pKO - tgs1, and verify by enzyme digestion.
[0095] 3. Take 10 μL of pKO - dosR and pKO - tgs1 knockout plasmids respectively and add them to 100 μL of M3 competent cells. After placing for 30 minutes, transfer them into an electroporation cuvette for electroporation. Under the conditions of 2 kV / cm, 25 μF, and 720 Ω, electroporate for 3 - 6 ms, then place on ice for 5 min, and then transfer them into a newly sterilized 1.5 mL centrifuge tube and add 500 μL of freshly sterilized LB medium. Resuscitate at 30℃ and 200 rpm for 3 - 24 hours. Spread them on an LB solid medium containing hyg 50 μg / ml, Kan 20 μg / ml, and X - gal 50 μg / ml and culture for 5 - 7 days. Pick the colonies with blue spots, and verify them as single - crossover strains using the upstream forward primer (DosR - UP - F / Tgs1 - UP - F) and the downstream reverse primer (DosR - down - R / Tgs1 - down - R) respectively by PCR. Spread the verified single - crossover bacteria on a 2% sucrose plate with a mass concentration, invert and culture at 30℃ for 3 - 7 days, pick the white colonies, extract the genomic DNA, and verify using the upstream forward primer (DosR - UP - F / Tgs1 - UP - F) and the downstream reverse primer (DosR - down - R / Tgs1 - down - R) respectively by PCR ( Figure 1 、 Figure 2), the dosR gene deletion strain was named MNR-ΔdosR, and the tgs1 gene deletion strain was named MNR-Δtgs1.
[0096] Example 2 Comparison of intracellular TAG content of MNR, MNR-ΔdosR, and MNR-Δtgs1 strains
[0097] 1. Detection of TAG content
[0098] Culture MNR (MNR M3), MNR-ΔdosR, and MNR-Δtgs1 according to the method of Example 1. Collect 1 mL of fermentation broth, centrifuge at 12,000 r / min at 4 °C for 2 min, and discard the supernatant. After washing twice with pre-cooled 1×PBS, add 200 μL of RIPA, freeze-thaw repeatedly in liquid nitrogen 3 times, then add 800 mL of sterile water, and ultrasonically disrupt for 10 min using an ultrasonic disruptor with the working condition of ultrasonicating for 10 s every 5 s. Extract the intracellular TAG of the bacteria using isopropanol, and analyze the intracellular triglyceride content according to the method of the triglyceride quantitative detection kit.
[0099] 2. Result comparison
[0100] By measuring the intracellular TAG content of the recombinant strains MNR-ΔdosR and MNR-Δtgs1 and comparing them with MNR ( Figure 3 ). It can be found that during the fermentation process, the intracellular TAG content of MNR-ΔdosR and MNR-Δtgs1 both decreased significantly compared with that of MNR. Among them, the TAG content of MNR-ΔdosR, at 48 h of fermentation, decreased from 3.81 μmol / g DCW of the starting strain MNR to 2.47 μmol / g DCW, a decrease of 35.43% compared with MNR. The TAG content of MNR-Δtgs1 was the lowest, being 4.26 μmol / g DCW at 72 h of fermentation, and its TAG content decreased by 36.78% compared with 5.70 μmol / g DCW of MNR.
[0101] Example 3 Comparison of intracellular acetyl-CoA content of MNR-ΔdosR, MNR-Δtgs1, and MNR
[0102] 1. Detection of intracellular acetyl-CoA content
[0103] Cultivate MNR (MNR M3), MNR-ΔdosR, and MNR-Δtgs1 according to the method of Example 1. At regular intervals, take the fermentation broth, centrifuge to collect 0.1 g of bacterial cells, quickly freeze and pulverize them, and perform protein deproteinization on the samples by PCA precipitation, and then use them for acetyl-CoA detection. The acetyl-CoA detection kit was purchased from Merck Life Sciences (acetyl-CoA kit MAK039) and used for the determination of intracellular acetyl-CoA content according to the reagent ratio in Table 1.
[0104] First, sample preparation and background removal: Take 50 μL of the standard product and place it in the standard well. Take 50 μL of the sample and add it to the sample well and the sample background well respectively. To correct the background generated by free coenzyme A and succinyl coenzyme, add 10 μL of acetyl-CoA quencher to the standard well, the sample well, and the sample background well. Incubate at room temperature for 5 minutes. Then add 2 μL of the quenching removal agent as described in the instruction manual, mix well, and incubate for another 5 minutes.
[0105] Second, prepare the reaction mixture according to the protocol in Table 1. Add 50 μL of the standard well and sample well reaction mixture to each standard well and sample well, and add 50 μL of the background reaction mixture to each background sample well. Mix them evenly using a horizontal shaker or pipette, and incubate the reactants in the dark at 37 °C for 10 minutes. Finally, use an enzyme-linked immunosorbent assay (ELISA) reader to measure the fluorescence intensity, with a maximum excitation wavelength of 535 nm and an emission wavelength of 587 nm.
[0106] Table 1 Reaction mixture (reagents from the acetyl-CoA detection kit)
[0107]
[0108] 2. Result comparison
[0109] The synthesis of TAG in Mycobacterium phlei starts with the conversion of acetyl-CoA. The intracellular acetyl-CoA content of the recombinant strains MNR-ΔdosR and MNR-Δtgs1 is significantly higher than that of the original strain MNR. Among them, at 72 h of fermentation, the intracellular acetyl-CoA contents of MNR-ΔdosR and MNR-Δtgs1 are 6.75 μmol / g DCW and 6.47 μmol / g DCW respectively, which are 49.97% and 43.46% higher than that of MNR (4.51 μmol / g DCW). At the same time, at 24 h of conversion, the intracellular acetyl-CoA content of MNR-ΔdosR is 3.73 μmol / g DCW, which is significantly increased by 22.56% compared with 2.97 μmol / g DCW of MNR ( Figure 4 )
[0110] Example 4 Comparison of intracellular ATP contents of MNR, MNR-ΔdosR, and MNR-Δtgs1
[0111] 1. Detection of ATP content
[0112] Culture MNR (MNR M3), MNR-ΔdosR, and MNR-Δtgs1 according to the method of Example 1. Take 100 μL of the fermentation broth every 24 h and place it in a black 96-well plate. Add an equal volume of BacTiter-Glo TM buffer to the sample wells. Incubate with shaking at 25°C and 100 r / min for 5 min. Detect the fluorescence value with a microplate reader in the Luminescence mode, using a sterile medium as a blank control. Calculate the ATP concentration corresponding to the fluorescence value using the standard curve.
[0113] 2. Result comparison
[0114] The differences in the intracellular ATP content between MNR-ΔdosR and MNR-Δtgs1 and the original strain MNR were compared ( Figure 5 ). The results showed that compared with MNR, the intracellular ATP content of MNR-ΔdosR and MNR-Δtgs1 was significantly increased. Among them, at 48 h of transformation, the intracellular ATP contents of MNR-ΔdosR and MNR-Δtgs1 were 5.90 μmol / g DCW and 5.07 μmol / g DCW, respectively, which were increased by 41.93% and 22.46% compared with 4.15 μmol / g DCW of MNR. In summary, the blocking of the TAG synthesis pathway reduced the shunt of acetyl-CoA, allowing more acetyl-CoA to enter the TCA cycle, promoting ATP production, and thus increasing the biomass of the strain in the early stage of transformation.
[0115] Example 5 Comparison of the molar production rate of AD of MNR, MNR-ΔdosR, and MNR-Δtgs1
[0116] 3. Detection of the molar production rate of AD
[0117] Carry out AD production using MNR (MNR M3), MNR-ΔdosR, and MNR-Δtgs1 strains according to the method of Example 1. Take 0.8 mL of the sample under sterile conditions during the production process.
[0118] Detection of AD production: Ultrasonically extract the sampled solution with an equal volume of ethyl acetate, centrifuge at 10000 rpm for 10 min, take 0.1 mL of the supernatant and place it in a 1.5 mL tube. After natural drying, dissolve it with the mobile phase, filter through a 0.22 μm membrane, and then perform high-performance liquid chromatography analysis. Chromatographic conditions: C18 column, the mobile phase is methanol:water (4:1, volume ratio), the flow rate is 1 mL / min, the column temperature is 30°C, and the detection wavelength is 254 nm. The calculation formula for the molar conversion rate is:
[0119] Molar yield % = (Cp × Ms) / (Cs × Mp) × 100%, where Cp is the product concentration (g / L), Cs is the substrate concentration (g / L), Mp is the molar mass of the product, and Ms is the molar mass of the substrate.
[0120] 4. Result comparison
[0121] The AD molar production rates of MNR-ΔdosR and MNR-Δtgs1 are both higher than that of MNR. Among them, at 72 h of fermentation, the AD molar production rate of MNR-ΔdosR is 53.01%, which is 19.89% higher than that of the original strain and 1.51 times that of the MNR AD molar production rate ( Figure 6 ). At the same time, the highest AD molar production rate of MNR-ΔdosR is 93.27%, which is 9.49% higher than that of the original strain. Before the end of fermentation, the AD molar production rate of MNR-Δtgs1 is higher than that of MNR, but the highest AD molar production rate is only 1.9% higher than that of the original strain.
[0122] In summary, in the present invention, the recombinant strains MNR-ΔdosR and MNR-Δtgs1 are obtained by knocking out the key transcriptional regulator dosR of the TAG synthesis pathway and the key enzyme tgs1 for synthesis in the steroid hormone intermediate-producing bacterium MNR M3, respectively, solving the problem of growth inhibition of the bacteria. There is no relevant research on the relationship between DosR, Tgs1 and the TAG pathway in the prior art. The present invention improves the energy supply in the early stage of strain transformation for the first time, alleviates the growth inhibition of the strain, and significantly improves the conversion rate of AD. Among them, the effect of MNR-ΔdosR is the most obvious, and the AD conversion rate is increased by 9.49% compared with the starting strain MNR in the same period.
[0123] The relevant sequences are as follows:
[0124] SEQ ID NO.1 (affecting the key enzyme tgs1 of the TAG synthesis pathway):
[0125] GTGGTGAAGGTATTTCTGGTCGAcgaccatgaggtcgtccggcgtggactgatcgacctgctcggctccgatcccgacctcgaggttgtgggggaggcgggcacggtcgccgaggcgctcgccagaattcctgccgtgcggcccgaggtcgccgtgctcgatgtccggttacccgatggcaacggcatcgagctgtgccgcgatctgctctccgagcttcccgatctgcgctgtctgatgctcacctcgttcacctccgacgaagccatgctcgatgccatcctggccggcgccagtggatacgtcgtcaaggacatcaagggcctggaactggccaacgccatcaaggaggtcggggcaggtcgctcgttgctcgacaatcgggccgccgcggcgctgatggccaatctgcgcggtgccgccgagcgtgctgacccgctgaccgggctgaccgagcaggagcgcaccctgctgcacctgttgtccgagggcctcaccaaccgccagatcgcggccaggatgttcctcgccgagaagacggtgaagaactacgtgtccaggttgcttgccaagctcgggatggaacgccgcacgcaggcagcggttttcgcgtccaagctggaatggggagagagcgggcgcggccgttcagcactGCCACTCGACGACCGTTGA
[0126] SEQ ID NO.2 (Transcriptional regulatory factor dosR affecting the TAG synthesis pathway):
[0127]
[0128] Although embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will understand that: various substitutions, changes, and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the content disclosed in the embodiments.
Claims
1. A genetically engineered bacterium capable of performing sterol conversion, characterized in that: The strain is based on Mycobacterium neoaurum Mycobacterium sp. MNR M3 as the starting strain, and is obtained by separately knocking out tgs1 and dosR respectively; The key enzyme tgs1 has a nucleotide sequence as shown in SEQ ID NO.1, and the transcriptional regulator dosR has a nucleotide sequence as shown in SEQ ID NO.
2.
2. The method for constructing a genetically engineered bacterium according to claim 1, characterized in that: comprising the following steps: (1)Preparation of MNR M3 competent cells: Inoculate Mycobacterium neoaurum acid-fast bacilli Mycobacterium sp. MNR M3 into LB medium and culture at 30 °C until the OD 600 reaches 1.
0. Transfer it to the seed medium at an inoculation amount of 10% of the medium volume for secondary seed culture; after 24 h, add glycine with a mass concentration of 2% and continue to culture at 30 °C and 200 rpm for 24 h. Centrifuge to collect the bacterial cells at 4 °C, and wash and resuspend the bacterial cells with pre-cooled glycerol with a volume concentration of 10% at 1 time, 3 / 4 times, 1 / 2 times, and 1 / 4 times the volume of the seed solution, respectively, and centrifuge at 4 °C. Finally, add glycerol with a volume concentration of 10% at 1 / 25 times the volume to resuspend the bacterial cells to obtain MNR M3 competent cells, and aliquot and store them; Among them, the composition of the seed culture medium: K2HPO4 0.1 - 3 g / L, MgSO4 0.1 - 3 g / L, ammonium ferric citrate 0.01 - 0.2 g / L, citric acid 1 - 5 g / L, ammonium nitrate 1 - 5 g / L, glycerol 5 - 50 g / L, glucose 5 - 50 g / L, CaCO3 1 - 5 g / L, the rest is water, pH 6.0 - 7.5; (2)Knockout plasmid construction: Design dosR and tgs1 up- and downstream arm primers of the gene, and use the genomic DNA of MNR M3 as a template to amplify dosR and tgs1 up- and downstream homologous arms; dosR and tgs1 The up- and downstream arm primers of the gene are primers DosR-UP-F, DosR-UP-R, DosR-down -F, DosR-down-R, Tgs1-UP-F, Tgs1-UP-R, Tgs1-down-F, Tgs1-down-R, and their nucleotide sequences are shown in SEQ ID NO.3 to SEQ ID NO.10 in sequence; Amplify the upstream and downstream homologous arm genes of the target gene dosR and tgs1 using PCR technology and ligate them onto the Mycobacterium gene knockout plasmid p2NIL digested with BamHⅠ and HindⅢ; then, digest the above plasmid and pGOAL19 plasmid with PacI and ligate them using T4 ligase to construct the gene knockout plasmids pKO- dosR and pKO- tgs1 , and verify by digestion; (3) Take 10 μL of pKO- dosR and pKO- tgs1 knockout plasmids and add them to 100 μL of MNR M3 competent cells. After placing for 30 minutes, transfer them into an electroporation cuvette for electroporation; under the electroporation conditions of 2 kV / cm, 25 μF, and 720 Ω, electroporate for 3 - 6 ms, then place on ice for 5 min, and then transfer into a newly sterilized 1.5 mL centrifuge tube and add 500 μL of freshly sterilized LB medium. Resuscitate at 30 °C and 200 rpm for 3 - 24 hours; spread on an LB solid medium containing hyg 50 μg / ml, Kan 20 μg / ml, and X-gal 50 μg / ml and culture for 5 - 7 days. Pick blue-spotted colonies and use the upstream forward primers DosR-UP-F / Tgs1-UP-F and the downstream reverse primers DosR-down-R / Tgs1-down-R for PCR verification to obtain single-exchange strains; spread the verified single-exchange bacteria on a sucrose plate with a mass concentration of 2% respectively, and culture them inverted at 30 °C for 3 - 7 days. Pick white colonies, extract the genomes, and use the upstream forward primers DosR-UP-F / Tgs1-UP-F and the downstream reverse primers DosR-down-R / Tgs1-down-R for PCR verification. After successful verification, the dosR gene deletion strain is named MNR-Δ dosR , and the tgs1 gene deletion strain is named MNR-Δ tgs1 .
3. The application of the genetically engineered bacterium according to claim 1 in steroid transformation, wherein the steroid is 4-androstene-3,17-dione.
4. A method for producing 4-androstene-3,17-dione using the genetically engineered bacterium as claimed in claim 1, characterized in that: comprising the following steps: Transfer the seed culture solution of the genetically engineered bacterium to the fermentation medium at an inoculation amount of 2 - 10%, and culture at 25 - 35°C and 50 - 200 rpm for 24 - 168 h.
5. The method according to claim 4, wherein: The yield of the 4-androstene-3,17-dione can reach 0.3 - 30 g / L, and the molar conversion rate can reach 50% - 100%.
6. The method according to claim 4 or 5, characterized in that: The formula of the fermentation medium is: K2HPO4 0.1 - 3 g / L, MgSO4 0.1 - 3 g / L, ammonium ferric citrate 0.01 - 0.2 g / L, citric acid 1 - 5 g / L, diammonium hydrogen phosphate 1 - 10 g / L, glucose 5 - 50 g / L, phytosterol 1 - 50 g / L, the rest is water, pH 6.0 - 7.5.
Citation Information
Patent Citations
Method for improving sterol conversion by enhancing intracellular cofactor metabolism and glycometabolism
CN115216435A
Genetically engineered bacterium of high-yield steroid precursor and application of genetically engineered bacterium
CN115838679A
Generation of new BCG vaccine strains protecting against the establishment of latent mycobacterium tuberculosis infection and reactivation from the latent or persistent state
US20090123492A1