Sweet cherry glycosyltransferase PavUGT48, its encoding gene and application

Abstract

The present invention provides a sweet cherry glycosyltransferase PavUGT48, its encoding gene, and applications. The amino acid sequence of the sweet cherry glycosyltransferase PavUGT48 is shown in SEQ ID No. 1, and the nucleotide sequence of the gene encoding the sweet cherry glycosyltransferase PavUGT48 is shown in SEQ ID No. 2. The sweet cherry glycosyltransferase PavUGT48 provided by the present invention can be used to catalyze cyanidin to produce cyanidin 3-O-glucoside and catalyze prunin to produce amygdalin, thereby improving the quality of sweet cherry fruit. It can be used to cultivate new high-quality sweet cherry varieties and industrially produce cyanidin 3-O-glucoside and amygdalin.

Description

Technical Field

[0001] The invention relates to the fields of fruit tree molecular biology and genetic engineering, and in particular to a sweet cherry glycosyltransferase PavUGT48, a coding gene thereof and an application thereof. Background Art

[0002] Sweet cherry (Prunus avium L.) is a stone fruit tree with the advantages of early maturity, bright color, rich nutrition, and high economic value. It is a highly profitable deciduous fruit tree species in northern my country. Fruit color is an important indicator of fruit quality and commercial value. The color of sweet cherry fruit is determined by the content of anthocyanins. Cyanidin 3-O-glucoside is one of the main anthocyanins in sweet cherry fruit.

[0003] UDP-glycosyltransferases (UGTs) are a class of glycosyltransferases that catalyze the glycosylation of compounds such as flavonoids, alkaloids, and terpenes using UDP-sugar as the glycosyl donor. Members of the UGT gene family have been identified in a variety of plants, including apples and peaches. UGTs have been shown to participate in various physiological processes, such as plant growth and development, by catalyzing the production of corresponding metabolites. UGT-mediated anthocyanin glycosylation is a key step in plant coloration. UGT78D5 from purple cabbage catalyzes the conversion of delphinidin to delphinidin 3-O-glucoside using UDP-glucose as the glycosyl donor. The catalytic synthesis pathway for amygdalin, a representative alkaloid, has been discovered in almonds. UGT94AF1 and UGT94AF2 play a key role in catalyzing the conversion of prunin to amygdalin.

[0004] Plant UGTs can also catalyze the conversion of multiple substrates simultaneously. Apple MdUGT78T2 can catalyze the conversion of quercetin and cyanidin to quercetin 3-O-galactoside and cyanidin 3-O-galactoside, respectively, using UDP-galactose as the sugar donor. However, reports on sweet cherry UDP-glycosyltransferases are limited, and their functions remain to be elucidated. Exploring the functions of sweet cherry UGTs could help provide solutions for improving sweet cherry fruit quality and cultivating new high-quality sweet cherry varieties. Summary of the Invention

[0005] In order to solve the above problems, the object of the present invention is to provide a sweet cherry glycosyltransferase PavUGT48, which can be used to improve the quality of sweet cherries.

[0006] Another object of the present invention is to provide a gene encoding sweet cherry glycosyltransferase PavUGT48.

[0007] The third object of the present invention is to provide an expression vector containing the gene of sweet cherry glycosyltransferase PavUGT48.

[0008] The fourth object of the present invention is to provide a host bacteria containing the gene of sweet cherry glycosyltransferase PavUGT48.

[0009] A fifth object of the present invention is to provide applications of sweet cherry glycosyltransferase PavUGT48, its encoding gene, expression vector or host bacteria.

[0010] The sixth object of the present invention is to provide an in vitro method for catalyzing cyanidin and prunin to generate cyanidin 3-O-glucoside and amygdalin, respectively.

[0011] The seventh object of the present invention is to provide an in vivo method for catalyzing cyanidin and prussin to produce cyanidin 3-O-glucoside and amygdalin, respectively.

[0012] In order to achieve the above object, the present invention provides a sweet cherry glycosyltransferase PavUGT48, the amino acid sequence of the sweet cherry glycosyltransferase PavUGT48 is shown in SEQ ID No.1

[0013] The present invention also provides a gene encoding the sweet cherry glycosyltransferase PavUGT48, the nucleotide sequence of which is shown in SEQ ID No. 2.

[0014] The present invention also provides an expression vector containing the gene of the sweet cherry glycosyltransferase PavUGT48.

[0015] Preferably, the expression vector is a prokaryotic expression vector or a transient expression vector.

[0016] The present invention also provides a host bacteria containing the gene of the sweet cherry glycosyltransferase PavUGT48.

[0017] The present invention also provides the use of the above-mentioned sweet cherry glycosyltransferase PavUGT48, or its encoding gene, expression vector or host bacteria in catalyzing cyanidin to produce cyanidin 3-O-glucoside.

[0018] The present invention also provides the above-mentioned sweet cherry glycosyltransferase PavUGT48, or the use of its encoding gene or expression vector or host bacteria in catalyzing the production of amygdalin from prunin.

[0019] The present invention also provides an in vitro method for catalyzing cyanidin and prussin to generate cyanidin 3-O-glucoside and amygdalin, respectively, comprising the following steps:

[0020] (1) constructing a prokaryotic expression vector containing the sweet cherry glycosyltransferase PavUGT48 gene and transforming it into Escherichia coli for prokaryotic induced expression to obtain recombinant bacteria containing the sweet cherry glycosyltransferase PavUGT48;

[0021] (2) isolating and purifying the sweet cherry glycosyltransferase PavUGT48 from the recombinant bacteria;

[0022] (3) Using the isolated and purified sweet cherry glycosyltransferase PavUGT48 to catalyze cyanidin to produce cyanidin 3-O-glucoside or catalyze prunin to produce amygdalin.

[0023] The present invention also provides another in vivo method for catalyzing cyanidin and prussin to generate cyanidin 3-O-glucoside and amygdalin, respectively, comprising the following steps:

[0024] (1) constructing a transient expression vector containing the sweet cherry glycosyltransferase PavUGT48 gene and transforming it into Agrobacterium to obtain a recombinant bacterium containing the sweet cherry glycosyltransferase PavUGT48;

[0025] (2) infecting plants with the recombinant bacteria containing the sweet cherry glycosyltransferase PavUGT48 to highly express the sweet cherry glycosyltransferase PavUGT48 in the plants;

[0026] (3) The sweet cherry glycosyltransferase PavUGT48 is used to catalyze cyanidin and prunin to generate cyanidin 3-O-glucoside and amygdalin, respectively, in the plant body.

[0027] The beneficial effects of the present invention are:

[0028] The present invention provides a sweet cherry glycosyltransferase PavUGT48, a coding gene thereof, and an application thereof. The sweet cherry glycosyltransferase PavUGT48 can be used to improve the quality of sweet cherry fruits, cultivate high-quality new sweet cherry varieties, and promote the factory production of cyanidin 3-O-glucoside and amygdalin. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The sweet cherry glycosyltransferase PavUGT48 provided by the present invention is expressed in sweet cherry 'Lapins',

[0030] Analysis of expression levels in fruits of 'Raini' and 'Dalong' 1-9 weeks after anthesis.

[0031] Figure 2 This is the SDS-PAGE detection result of the purified PavUGT48 recombinant protein provided by the present invention.

[0032] Figure 3AThis is HPLC analysis of the in vitro catalysis of cyanidin to synthesize cyanidin 3-O-glucoside by the PavUGT48 protein provided by the present invention.

[0033] Figure 3B This is HPLC analysis of the in vitro catalysis of prunin to amygdalin by the PavUGT48 protein provided by the present invention.

[0034] Figure 4A The present invention provides a comparison photo of the sweet cherry fruit phenotype after transient expression of PavUGT48 and the fruit phenotype of the control.

[0035] Figure 4B This is an analysis of changes in the expression level of sweet cherry PavUGT48 after transient expression of PavUGT48 provided by the present invention.

[0036] Figure 4C Metabolomics clustering heat map analysis of PavUGT48 transiently expressed fruits and control fruits provided by the present invention.

[0037] Figure 4D This is an analysis of the changes in cyanidin 3-O-glucoside content in sweet cherry fruit after transient expression of PavUGT48 in the present invention.

[0038] Figure 4E This is an analysis of the changes in amygdalin content in sweet cherry fruit after transient expression of PavUGT48 in the present invention. DETAILED DESCRIPTION

[0039] The embodiments of the present invention will be described in detail and comprehensively below so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more precise definition of the protection scope of the present invention.

[0040] Cyanidin 3-O-glucoside is an active substance with antioxidant, anti-inflammatory, and heart and vision-protecting properties, possessing significant health benefits. It is also a key colorant in sweet cherries, providing the core pigment responsible for their red or purple-black color. Accumulating cyanidin 3-O-glucoside improves the appearance and quality of sweet cherries. Therefore, increasing cyanidin 3-O-glucoside content is crucial for enhancing the agricultural and economic value of sweet cherries.

[0041] Amygdalin is a natural active ingredient that plays an important role in anti-inflammatory, anti-tumor and immune regulation.

[0042] Overexpression of the sweet cherry glycosyltransferase PavUGT48 helps increase the content of cyanidin 3-O-glucoside in the fruit, promotes fruit coloring, and improves the appearance quality of the sweet cherry fruit. Overexpression of the sweet cherry glycosyltransferase PavUGT48 also helps increase the content of amygdalin, enhancing the medicinal and nutritional value of the fruit.

[0043] Material

[0044] 1. Plant materials: Sweet cherry fruits of 'Labins', 'Raini' and 'Dalong' varieties, 1 to 9 weeks after anthesis, were obtained from the Cherry Resource Garden of the Forestry and Fruit Research Institute, Beijing Academy of Agricultural and Forestry Sciences.

[0045] 2. Escherichia coli DH5α competent strain, Escherichia coli BL21 (DE3) expression competent strain and Agrobacterium tumefaciens EHA105 competent strain were all purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0046] 3. RNAprep Pure polysaccharide and polyphenol plant total RNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0047] 4. The reverse transcription kit HiScript III 1st Strand cDNA Synthesis Kit and the homologous recombination cloning kit ClonExpress II One Step Cloning Kit were purchased from Nanjing Novozymes Biotechnology Co., Ltd.

[0048] 5. PCR cloning high-fidelity enzymes were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.

[0049] 6. PCR primer synthesis and bacterial culture sequencing were completed by Sangon Biotech (Shanghai) Co., Ltd.

[0050] 7. The cyanidin, cyanidin 3-O-glucoside, prunin and amygdalin used in the substrate catalysis experiment were purchased from MedChemExpress.

[0051] 8. pTOPO plasmid was purchased from Beijing Adelaide Biotechnology Co., Ltd.

[0052] 9. High-yield plasmid small-scale rapid extraction kit was purchased from Beijing Adelaide Biotechnology Co., Ltd.

[0053] 10. AxyPrep DNA gel recovery kit was purchased from Axygen, USA.

[0054] 11.GST purification columns were purchased from Shanghai Bioengineering Co., Ltd.

[0055] 12. 1.5 mL EP tubes were purchased from Axygen, USA.

[0056] 13. Restriction endonucleases BamHI, XhoI, NdeI, XbaI and SacI were purchased from New England Biolabs, Inc., USA.

[0057] 14. pGEX-4T-1 vector and pRI101 vector were purchased from Beijing Coolbo Technology Co., Ltd.

[0058] 15.pTRV1 vector and pTRV2 vector were purchased from Beijing Xinghua Yueyang Biotechnology Co., Ltd.

[0059] 16.SuperStar Universal SYBR Master Mix was purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd.

[0060] Example 1 Cloning and expression analysis of sweet cherry glycosyltransferase PavUGT48 gene

[0061] 1. Fruit Total RNA Extraction and Reverse Transcription

[0062] Total RNA was extracted from 'Labins,' 'Raini,' and 'Dalong' sweet cherry fruits 1 to 9 weeks after anthesis according to the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit. 1 μg of total RNA was reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit according to the manufacturer's instructions. Both total RNA and cDNA were frozen at -80°C for subsequent gene cloning and real-time quantitative PCR (RT-qPCR).

[0063] "Post-flowering" is a horticultural term that refers to the period after a plant's peak bloom, when the flowers begin to fade and the plant transitions from flowering to fruiting or vegetative growth. For sweet cherries, small fruits are already forming a week after flowering.

[0064] 2. PavUGT48 gene cloning

[0065] SnapGene 3.2.1 software was used to design the upstream and downstream primer sequences for the PavUGT48 gene. The 'Raini' sweet cherry cultivar is the most commonly used variety for studying sweet cherry fruit quality and is readily available. Therefore, 'Raini' sweet cherry was selected as the experimental material for subsequent transient expression experiments. PCR amplification was performed using cDNA from 'Raini' sweet cherry fruit nine weeks after anthesis as the template. The upstream and downstream primer sequences used are as follows:

[0066] Upstream primer PavUGT48-F (SEQ ID No. 3):

[0067] 5'-ATGAATTCTTCTCAGCAAAGAAAATTCAGT-3'.

[0068] Downstream primer PavUGT48-R (SEQ ID No. 4):

[0069] 5'-TCATTCCTTTCGCATACAAAGTTGAATCAACTG-3'.

[0070] The PCR products were gel-tested, and fragments of the target size were recovered using the AxyPrep DNA Gel Recovery Kit. The recovered product was ligated with the pTOPO plasmid, then transformed into competent E. coli DH5α and sequenced. The PavUGT48 gene coding region sequence was obtained as shown in SEQ ID No. 2. The CDS sequence of this gene is 1371 bp long and encodes 456 amino acids, as shown in SEQ ID No. 1. The positive E. coli DH5α bacterial solution with correct sequencing was used to extract the plasmid using a high-yield plasmid small-scale rapid extraction kit for subsequent expression vector construction.

[0071] 3. RT-qPCR determination of gene expression

[0072] RT-qPCR experiments were performed using a QuantStudio 1 real-time fluorescence quantitative PCR instrument (Thermo Fisher, USA). The method of Feng et al. (Feng C, et al. Effects of water-saving ridging and film-covering cultivation methods on fruit anthocyanin biosynthesis in apple fruit. Scientia Horticulturae, 321 (2023), 112316) was used. The quantitative reaction system was 10 μL, containing 5 μL SuperStar Universal SYBR Master Mix, 1 μL cDNA template, 0.4 μL each of forward and reverse primers (10 mM), and 3.2 μL ddH2O. The reaction procedure was pre-denaturation: 95°C, 30s; denaturation: 95°C, 15s; annealing and extension: 60°C, 1min; denaturation, annealing and extension for a total of 40 cycles; the melting curve was set according to the QuantStudio 1 quantitative PCR instrument. The relative expression results were calculated using 2 -ΔΔCt Method: Calculation. The sweet cherry PavActin gene was used as a control gene to calculate relative expression. The primers used for quantification are as follows:

[0073] qPavUGT48-F (SEQ ID No. 5): 5'-GGTTTTTAGAGAGGGTGGGGGA-3'.

[0074] qPavUGT48-R (SEQ ID No. 6): 5'-CATAGGCATGGCTACAATTGGA-3'.

[0075] qPavActin-F (SEQ ID No. 7): 5'-CTCCTCTCAACCCTAAGGCTAACAG-3'.

[0076] qPavActin-R (SEQ ID No. 8): 5'-CAGTTGTACGACCACTGGCATACAG-3'.

[0077] The expression level of PavUGT48 gene in the fruits of sweet cherry cultivars 'Labins', 'Raini' and 'Dalong' was detected by RT-qPCR 1-9 weeks after flowering. Figure 1 As shown in the figure, different lowercase letters represent significant differences at the p < 0.05 level.

[0078] from Figure 1 As can be seen, the expression level of the PavUGT48 gene gradually increases with fruit growth and development. Starting five weeks after flowering, the expression level of the PavUGT48 gene in the three different sweet cherry cultivars increased significantly, with the expression level in the fruit of 'Dalong' significantly higher than that of the other two cultivars. The expression level of the PavUGT48 gene reached its highest level six weeks after flowering in 'Labins' and 'Dalong', increasing by approximately 3,500-fold and 5,500-fold, respectively, compared to one week after flowering. Afterward, the gene expression level gradually decreased. The expression level of the PavUGT48 gene reached its highest level eight weeks after flowering in 'Raini', increasing by approximately 400-fold compared to one week after flowering. These experimental results indicate that the PavUGT48 gene plays an important role in fruit development.

[0079] Example 2 Expression and in vitro catalysis of sweet cherry glycosyltransferase PavUGT48

[0080] 1. Construction of prokaryotic expression vector of target gene

[0081] Construction of Escherichia coli prokaryotic expression vector: Based on the pGEX-4T-1 vector sequence, select two restriction sites, BamHI (GGATCC) and XhoI (CTCGAG), design upstream and downstream primers of the target gene containing the restriction sites and partial vector sequences, and use high-fidelity enzymes for PCR amplification; linearize the pGEX-4T-1 vector with restriction endonucleases BamHI and XhoI, recover the PCR amplification product and the enzyme digestion product by gel recovery, and connect them using a homologous cloning recombination kit. React at 37°C for 30 minutes, and heat-shock the reaction product into Escherichia coli DH5α competent cells. Spread it on LB solid culture medium containing ampicillin. After 12 hours, pick a single clone and send it to a sequencing company for sequencing confirmation. The positive bacterial solution with correct sequencing is used to extract the plasmid for subsequent prokaryotic expression experiments. The primers for the construction of the Escherichia coli prokaryotic expression vector are as follows:

[0082] Upstream primer PavUGT48-4T-F (SEQ ID No. 9):

[0083] 5'-TCCGCGTGGATCCCCGGAATTCATGAATTCTTCTCAGCAAAGAAAATTC AGT-3'.

[0084] Downstream primer PavUGT48-4T-R (SEQ ID No. 10):

[0085] 5'-AGTCACGATGCGGCCGCTCGAGTTCCTTTCGCATACAAAGTTGAATCAA CTG-3'.

[0086] 2. Prokaryotic protein expression in Escherichia coli

[0087] Escherichia coli prokaryotic protein expression: Referring to the prokaryotic protein expression method of Feng et al. (Feng C, et al. MicroRNA156ab regulates apple plant growth and drought tolerance by targeting transcription factor MsSPL13. Plant Physiology, 192 (2023), 1836-1857), the correctly sequenced plasmid and the empty plasmid (pGEX-4T-1) without the target gene inserted were heat-shocked and transformed into the large intestine BL21 (DE3) expression strain. After being spread on LB (containing ampicillin) solid medium, they were cultured overnight at 37 ° C for 12 h. Positive colonies were picked and cultured in liquid LB medium containing ampicillin in large quantities. After induction of expression by IPTG, the bacterial solution was ultrasonically disrupted and centrifuged to obtain crude protein extract. The eluted protein was purified by GST purification column, and the purified target protein was divided into multiple 1.5 mL EP tubes and frozen in a -80 ° C refrigerator for subsequent experiments.

[0088] SDS-PAGE electrophoresis of recombinant proteins, such as Figure 2 As shown in the figure, M is the standard molecular weight of the protein; 1 is the uninduced protein; 2-4 are the induced and purified proteins. Figure 2 It can be seen that the size of the recombinant protein expressed by the prokaryotic expression vector is approximately 79 KDa, which is consistent with the expected molecular weight of the recombinant protein (including 26 KDa GST protein).

[0089] 3. Substrate catalysis verification

[0090] To further verify the glycosylation catalytic function of PavUGT48 protein on substrates, catalytic experiments were carried out using cyanidin and prunin as substrates.

[0091] Among them, cyanidin is catalyzed by PavUGT48 protein to produce cyanidin 3-O-glucoside, as shown in formula (I).

[0092]

[0093] Among them, prunin is catalyzed by PavUGT48 protein to produce amygdalin, as shown in formula (II).

[0094]

[0095] The specific steps of the substrate catalytic verification experiment are as follows: refer to the in vitro enzyme activity verification method of UGT protein by Yuan et al. (Yuan Z, et al. Four novelCit7GlcTs functional in flavonoid 7-O-glucoside biosynthesis are vital toflavonoid biosynthesis shunting in citrus. Horticulture Research, 11 (2024), uhae098). Cyanidin and prunin were selected as substrates for catalytic verification experiments. The total volume of the reaction system was 300 μL, containing 100 μL of phosphate buffer solution (PBS) with pH 5.7, 7.0 and 8.0, 50 μL of UDP glucose (UDP Glc, 3 mM), 100 μL of substrate (concentration of 1 mg mL -1 ) and 50 μL of purified PavUGT48 protein (concentration of 1.5 mg mL -1 ). The catalytic reaction was carried out at 25°C for 60 minutes. After the reaction, 200 μL of methanol (MeOH) was added to quench the reaction, followed by centrifugation at 12,000 rpm for 15 minutes. The supernatant was filtered with a 0.22 μm organic membrane into a 2 mL injection vial for HPLC analysis, and the glycosylation product was compared with a commercial standard. The liquid chromatography results are shown in Figure 3, where A catalyzes cyanidin to produce cyanidin-3-O-glucoside; B catalyzes prunasin to produce amygdalin. As can be seen from Figure 3, after adding different substrates, the PavUGT48 protein was able to detect respective product peaks at pH 7.0 and 8.0. After comparison with respective product standards, it was concluded that PavUGT48 has dual catalytic functions in sweet cherry fruit, that is, PavUGT48 can catalyze cyanidin and prunin to produce cyanidin 3-O-glucoside and amygdalin, respectively.

[0096] Example 3 In vivo catalysis of sweet cherry glycosyltransferase PavUGT48

[0097] To further verify whether PavUGT48 has the same catalytic function in vivo, transient overexpression and silenced expression were performed in sweet cherry 'Raini' fruit.

[0098] 1. Construction of fruit transient expression vector:

[0099] For transient overexpression, the pRI101 vector was used, and two restriction enzyme sites, NdeI (CATATG) and BamHI (GGATCC), were selected. Upstream and downstream primers of the target gene containing the restriction enzyme sites and partial vector sequences were designed, and PCR amplification was performed using a high-fidelity enzyme. The pRI101 vector was linearized with restriction endonucleases NdeI and BamHI. The experimental method was the same as in Example 2, and the transient overexpression vector PavUGT48-pRI101 of PavUGT48 was constructed by homologous cloning and recombination.

[0100] Upstream primer PavUGT48-101-F (SEQ ID No. 11): 5′-ttcttcactgttgatacatatgATGAATTCTTCTCAGCAAAGAAAATTCAGT-3′.

[0101] Downstream primer PavUGT48-101-R (SEQ ID No. 12): 5′-tgttgattcagaattcggatccTTCCTTTCGCATACAAAGTTGAATCAACTG-3′.

[0102] 2. Transient viral induced silencing The pTRV2 vector was used to select a PavUGT48-specific fragment, as shown in SEQ ID No. 13. Two restriction sites, XbaI (TCTAGA) and SacI (GAGCTC), were used to design target gene-specific upstream and downstream primers containing restriction sites and partial vector sequences. PCR amplification was performed using a high-fidelity enzyme; the pTRV2 vector was linearized with restriction endonucleases XbaI and SacI. According to Experimental Method Example 2, the transient silencing vector PavUGT48-pTRV2 of PavUGT48 was constructed by homologous cloning and recombination.

[0103] The primers used for the construction of transient expression vector are as follows:

[0104] Upstream primer PavUGT48-TRV-F (SEQ ID No. 14): 5′-TAAGGTTACCGAATTCTCTAGAGAGAAAGGTACCAGGGTTGAAGA-3′.

[0105] Downstream primer PavUGT48-TRV-R (SEQ ID No. 15): 5′-GGGCCTCGAGACGCGTGAGCTCTCAGCCTCCCGTTCTCG-3′.

[0106] 3. Transient Expression in Sweet Cherry Fruit

[0107] Referring to the method of Wang et al. (Wang Y, et al. Two B-box proteins, PavBBX6 / 9, positively regulate light-induced anthocyanin accumulation in sweet cherry. Plant Physiology, 192 (2023), 2030-2048), the PavUGT48-pRI101 recombinant plasmid and the pRI101 empty vector (as an overexpression control), the PavUGT48-pTRV2 recombinant plasmid, the pTRV2 empty vector (as a silent control) and the pTRV1 vector were respectively transformed into the Agrobacterium EHA105 competent strain. The bacterial solution carrying the recombinant plasmid and the empty vector was shaken and cultured in YEB liquid medium (containing rifampicin and kanamycin) at 28 ° C for 24 h. The bacterial solution was centrifuged and the cells were resuspended in a resuspension solution (10 Mm MES, 10 Mm MgCl2, 200 μM acetosyringone) to an OD600 of 0.6-0.8. Select sweet cherry fruits approximately 20 days after anthesis and slowly inject the suspension near the fruit stem until the entire fruit is filled. Overexpression and control suspensions are injected separately, while silenced and control suspensions are co-injected with pTRV1. Each combination includes three replicates. After injection, bag the fruit and label it. The bags are removed every other day, and samples are collected at maturity. The sampled fruit is photographed to record phenotype and immediately frozen in liquid nitrogen for subsequent testing.

[0108] Fruit phenotype Figure 4A As shown, OE-CK is the sweet cherry fruit after injection of Agrobacterium transformed with pRI101 empty vector (transient overexpression control group), OE-PavUGT48 is the sweet cherry fruit after injection of Agrobacterium transformed with PavUGT48-pRI101 recombinant plasmid for PavUGT48 overexpression, TRV-CK is the sweet cherry fruit after co-injection of Agrobacterium transformed with pTRV2 empty vector and Agrobacterium transformed with pTRV1 vector (transient silencing control group), TRV-PavUGT48 is the sweet cherry fruit after co-injection of Agrobacterium transformed with PavUGT48-pTRV2 recombinant plasmid and Agrobacterium transformed with pTRV1 vector (transient silencing group). Figure 4A It can be seen that compared with the control, the coloring of the sweet cherry fruit transiently overexpressing PavUGT48 deepened and its appearance quality improved, while the coloring of the sweet cherry fruit interfering with PavUGT48 was inhibited, affecting the fruit quality.

[0109] 4. RT-qPCR Determination of Gene Expression

[0110] The gene expression levels of the frozen sweet cherry fruits were measured by RT-qPCR using the method provided in 3. RT-qPCR measurement of gene expression levels in Example 1. The results are as follows Figure 4B As shown, * represents a significant difference at the p<0.05 level; ** represents a significant difference at the p<0.01 level. Figure 4B As can be seen, the PavUGT48 overexpression and silencing in sweet cherry fruits were 12.9 and 0.5 times higher than the control, respectively, and both were significantly different. This indicates that both overexpression and silencing of PavUGT48 can alter the quality of sweet cherry fruit.

[0111] 5. Determination of cyanidin 3-O-glucoside and amygdalin based on metabolomics

[0112] Metabolomics analysis of transiently expressed fruits was performed with reference to the fruit metabolomics method of Feng et al. (Feng C, et al. Effects of water-saving ridging and film-covering cultivation methods on fruit anthocyanin biosynthesis in apple fruit. Scientia Horticulturae, 321 (2023), 112316). The fruit samples to be tested were ground into powder in a liquid nitrogen grinder and placed in a vacuum freeze dryer to freeze until dry. 50 mg of freeze-dried powder was extracted with 1.2 mL of 70% methanol aqueous solution, vortexed and centrifuged, and filtered through a 0.22 μm organic membrane into a 2 mL injection bottle for UPLC-MS / MS metabolomics analysis.

[0113] like Figure 4C Shown is a heat map of cluster analysis of transient expression and control fruits. Figure 4C It can be seen that most of the metabolites in the overexpression and silence control groups were not much different and were clustered together first, indicating that the transient expression fruits and the control fruits can be clearly distinguished, and the three biological replicates within the group are good. The contents of cyanidin 3-O-glucoside and amygdalin were analyzed, such as Figure 4D and Figure 4E As shown, * represents a significant difference at the p<0.05 level; ** represents a significant difference at the p<0.01 level. Figure 4D and Figure 4EAs can be seen, compared with their respective controls, the levels of cyanidin 3-O-glucoside and amygdalin were significantly accumulated in the overexpressing sweet cherry fruits, while the levels of these two metabolites were significantly decreased in the silenced sweet cherry fruits. These results indicate that PavUGT48 can increase the content of cyanidin 3-O-glucoside in sweet cherry fruits, thereby deepening the color of the fruits and improving the appearance quality of the fruits. Furthermore, PavUGT48 can also promote the accumulation of amygdalin in the fruits, enhancing the medicinal value of the fruits.

[0114] As can be seen from the above examples, the present invention provides a sweet cherry glycosyltransferase PavUGT48, its encoding gene, and applications. The sweet cherry glycosyltransferase PavUGT48 can catalyze the synthesis of cyanidin from cyanidin 3-O-glucoside. Overexpression of the sweet cherry glycosyltransferase PavUGT48 can increase the content of cyanidin 3-O-glucoside in the fruit, promote fruit coloring, and help improve the nutritional value and appearance quality of the sweet cherry fruit. Furthermore, overexpression of the sweet cherry glycosyltransferase PavUGT48 can also help increase the content of amygdalin, thereby enhancing the medicinal and nutritional value of the fruit.

[0115] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

Claims

1. A sweet cherry glycosyltransferase PavUGT48 or a gene encoding the sweet cherry glycosyltransferase PavUGT48 or an expression vector containing the gene or a host bacteria containing the gene in catalyzing cyanidin to produce cyanidin 3-O-glucoside, characterized in that: The amino acid sequence of the sweet cherry glycosyltransferase PavUGT48 is shown in SEQ ID No. 1; the nucleotide sequence of the gene of the sweet cherry glycosyltransferase PavUGT48 is shown in SEQ ID No.

2.

2. A sweet cherry glycosyltransferase PavUGT48 or a gene encoding the sweet cherry glycosyltransferase PavUGT48 or an expression vector containing the gene or a host bacteria containing the gene in catalyzing the production of amygdalin from prunin, characterized in that: The amino acid sequence of the sweet cherry glycosyltransferase PavUGT48 is shown in SEQ ID No. 1; the nucleotide sequence of the gene of the sweet cherry glycosyltransferase PavUGT48 is shown in SEQ ID No.

2.

3. An in vitro method for catalyzing cyanidin and prussin to produce cyanidin 3-O-glucoside and amygdalin, respectively, characterized in that: The steps include: (1) constructing a prokaryotic expression vector containing the gene of sweet cherry glycosyltransferase PavUGT48 and transforming it into Escherichia coli for prokaryotic induced expression to obtain recombinant bacteria containing the sweet cherry glycosyltransferase PavUGT48; (2) isolating and purifying the sweet cherry glycosyltransferase PavUGT48 from the recombinant bacteria; (3) using the isolated and purified sweet cherry glycosyltransferase PavUGT48 to catalyze cyanidin to produce cyanidin 3-O-glucoside or catalyze prunin to produce amygdalin; The nucleotide sequence of the sweet cherry glycosyltransferase PavUGT48 gene is shown in SEQ ID No.

2.

4. An in vivo method for catalyzing cyanidin and prussin to produce cyanidin 3-O-glucoside and amygdalin, respectively, characterized in that: The steps include: (1) constructing a transient expression vector containing the gene of sweet cherry glycosyltransferase PavUGT48 and transforming it into Agrobacterium to obtain a recombinant bacterium expressing the sweet cherry glycosyltransferase PavUGT48; (2) infecting sweet cherries with the recombinant bacteria containing the sweet cherry glycosyltransferase PavUGT48, so that the sweet cherry glycosyltransferase PavUGT48 is highly expressed in the sweet cherries; (3) utilizing the sweet cherry glycosyltransferase PavUGT48 to catalyze cyanidin and prunin in the sweet cherry to generate cyanidin 3-O-glucoside and amygdalin, respectively; The nucleotide sequence of the sweet cherry glycosyltransferase PavUGT48 gene is shown in SEQ ID No. 2.

Images