Methods and compositions for treating premature termination cryptogram mediated conditions

Abstract

The present invention relates generally to modified tRNAs and the use of the modified tRNAs in mammalian cells to express functional gene products encoded by a gene containing a premature termination codon and / or to treat diseases mediated by premature termination cryptogons, such as Dravot Syndrome.

Description

[0001] This application is a divisional application of the Chinese invention patent application (application date: October 30, 2020; application number: 2020800909978 (International application number: PCT / US2020 / 058415); invention name: Methods and compositions for treating premature stop codon-mediated diseases).

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of and priority to U.S. Provisional Patent Application No. 62 / 929,428, filed on November 1, 2019, which is incorporated herein by reference in its entirety for all purposes. Field of the Invention

[0004] The present invention generally relates to methods and compositions for expressing gene products encoded by genes containing premature stop codons and / or treating disorders mediated by premature stop codons. Background Art

[0005] Protein synthesis is directed by a genetic code that includes 61 three-base-pair codons that encode amino acids that are incorporated into the protein being synthesized and three three-base-pair codons that terminate protein synthesis (called stop or termination codons). When a nucleic acid sequence encoding a protein mutates to contain a premature stop codon instead of a codon for the next amino acid, the resulting protein is prematurely terminated and is generally nonfunctional or less functional than the non-truncated or full-length protein. Such mutations, called nonsense mutations, are often associated with, or are causative agents for, many different genetic diseases.

[0006] Many disorders are associated with or caused by nonsense mutations. These include epilepsy such as Dravet syndrome, hereditary epilepsy with febrile seizures (GEFS), benign familial infantile epilepsy (BFIE), early infantile epileptic encephalopathy (EIEE), Lennox-Gastaut syndrome, Rett syndrome, PPM-X syndrome, Ohtawara syndrome, paroxysmal ataxia, hemiplegic migraine, idiopathic generalized epilepsy, FOXG1 syndrome, familial focal epilepsy with variable foci (FFEVF), childhood-onset epileptic encephalopathy, SYNGAP1-related intellectual disability, pyridoxine-dependent epilepsy, familial infantile myoclonic epilepsy (FIME), myoclonic astatic epilepsy, X-linked intellectual disability, partial epilepsy and paroxysmal ataxia, febrile seizures, autosomal dominant partial epilepsy with auditory features (ADPEAF), PNPO deficiency, progressive myoclonic epilepsy, action myoclonus-renal failure (AMRF), CDKL5 deficiency, and benign familial infantile seizures (BFIS).

[0007] For example, Dravet syndrome is a rare and catastrophic form of intractable epilepsy that begins in infancy. Initially, patients experience seizures that last for a long time. In their second year, other types of seizures begin to occur, which often coincide with developmental regression, probably due to repeated brain hypoxia. This can lead to poor development of language and motor skills. Mutations in the SCN1A (encoding voltage-gated sodium channel alpha subunit Nav1.1), SCN1B (encoding voltage-gated sodium channel beta1 subunit), SCN2A (encoding Nav1.2), SCN3A (encoding Nav1.3), SCN9A (encoding Nav1.7), GABRG2 (encoding gamma-aminobutyric acid receptor gamma 2 subunit), GABRD (encoding gamma-aminobutyric acid receptor delta subunit), and / or PCDH19 (encoding protocadherin-19) genes are associated with Dravet syndrome.

[0008] Dravet syndrome can be caused by, for example, nonsense mutations in the SCN1A gene, which produce premature stop codons and a lack or reduced amount of non-truncated or functional protein. The SCN1A gene normally encodes the alpha subunit of the neuronal voltage-gated sodium channel Na(V)1.1. In mouse models, loss-of-function mutations in SCN1A have been observed to result in reduced sodium currents and impaired excitability of hippocampal GABAergic interneurons.

[0009] Despite the efforts made to date, there is a need in the art for improved compositions and methods for treating diseases mediated by premature stop codons, including Dravet syndrome. Summary of the invention

[0010] The present invention is based in part on the discovery of tRNAs (e.g., inhibitory tRNAs) that allow the incorporation of amino acids into a gene product encoded by a gene in a mammalian cell at a position that would otherwise result in a truncated gene product caused by a premature stop codon (PTC) in the gene. The present invention is further based in part on the discovery that tRNAs that allow the incorporation of amino acids into a gene product encoded by a gene at a position that would otherwise result in a truncated gene product caused by a PTC in a gene, e.g., a tRNA described herein, can be used to treat a disease mediated by a PTC in a gene in a subject.

[0011] Thus, in one aspect, the invention provides a tRNA comprising a nucleotide sequence listed in Table 2. In certain embodiments, the tRNA comprises a tRNA comprising a nucleotide sequence selected from SEQ ID NOs: 19-21, 37, 39, 40, 44, 179, 181, 182, and 186.

[0012] In certain embodiments, the tRNA comprises, e.g., one or more naturally occurring nucleotide modifications selected from 5-methyluridine, 5-carbamoylmethyluridine, 5-carbamoyl-methyl-2-O-methyluridine, 5-methoxy-carbonylmethyluridine, 5-methoxycarbonylmethyl-2-thiouridine, pseudouridine, dihydrouridine, 1-methyladenosine, and inosine.

[0013] On the other hand, the invention provides an expression vector comprising a nucleotide sequence encoding any of the aforementioned tRNAs. In certain embodiments, the expression vector comprises 1, 2, 3, 4 or more than 4 copies of the nucleotide sequence encoding the tRNA. In certain embodiments, the expression vector comprises a nucleotide sequence corresponding to the genomic DNA sequence flanking the wild-type tRNA gene. For example, in certain embodiments, the expression vector comprises the nucleotide sequence listed in Table 4. In certain embodiments, the nucleotide sequence listed in Table 4 is selected from SEQ ID NO: 869-888. In certain embodiments, the nucleotide sequence listed in Table 4 is operably connected to the nucleotide sequence encoding the tRNA. In certain embodiments, in the expression vector, the nucleotide sequence listed in Table 4 is located at 5' of the nucleotide sequence encoding the tRNA. In certain embodiments, in the expression vector, the nucleotide sequence listed in Table 4 is adjacent to 5' (i.e., adjacent) of the nucleotide sequence encoding the tRNA.

[0014] On the other hand, the present invention provides an expression vector comprising a nucleotide sequence encoding a tRNA listed in Table 3, wherein the expression vector comprises 1, 2, 3, 4 or more copies of the nucleotide sequence encoding the tRNA. In certain embodiments, the tRNA comprises a nucleotide sequence selected from SEQ ID NO: 6-9, 11, 16-18, 22, 35, 36, 38, 45, 178, 180 and 187.

[0015] On the other hand, the present invention provides an expression vector comprising a nucleotide sequence encoding a tRNA listed in Table 3, wherein the expression vector further comprises a nucleotide sequence listed in Table 4. In certain embodiments, the tRNA comprises a nucleotide sequence selected from SEQ ID NO: 6-9, 11, 16-18, 22, 35, 36, 38, 45, 178, 180 and 187. In certain embodiments, the nucleotide sequence listed in Table 4 is selected from SEQ ID NO: 869-888. In certain embodiments, the nucleotide sequence listed in Table 4 is operably linked to the nucleotide sequence encoding the tRNA. In certain embodiments, in the expression vector, the nucleotide sequence listed in Table 4 is located at 5' of the nucleotide sequence encoding the tRNA. In certain embodiments, in the expression vector, the nucleotide sequence listed in Table 4 is adjacent to 5' (i.e., adjacent) of the nucleotide sequence encoding the tRNA.

[0016] In certain embodiments of any of the foregoing expression vectors, the expression vector is a viral vector, such as a DNA viral vector, such as an adeno-associated virus (AAV) vector.

[0017] On the other hand, the invention provides a pharmaceutical composition comprising any of the aforementioned tRNA or any of the aforementioned expression vectors, and a pharmaceutically acceptable excipient. In certain embodiments, the tRNA or expression vector is not conjugated or associated with another part, such as a carrier particle, such as an amino lipid particle. In certain embodiments, the composition does not include nanoparticles and / or amino lipid delivery compounds.

[0018] On the other hand, the present invention provides a method for expressing a functional gene product encoded by a gene containing a premature stop codon in a mammalian cell, the method comprising introducing an effective amount of any of the aforementioned tRNAs or expression vectors into the cell, thereby allowing the incorporation of amino acids into the gene product at a position that would otherwise result in a truncated gene product caused by the premature stop codon. In certain embodiments of any of the aforementioned methods, the gene is selected from the genes listed in Table 5 or Table 6. In certain embodiments, the gene is the SCN1A gene.

[0019] On the other hand, the present invention provides a method for expressing a functional gene product encoded by a gene containing a premature stop codon in a mammalian cell, the method comprising introducing an effective amount of a tRNA listed in Table 3 (e.g., a tRNA comprising a nucleotide sequence selected from SEQ ID NO: 6-9, 11, 16-18, 22, 35, 36, 38, 45, 178, 180 and 187), or an expression vector comprising a nucleotide sequence encoding the tRNA, into the cell, thereby allowing amino acids to be incorporated into the gene product at positions that would otherwise result in truncated gene products caused by premature stop codons, wherein the gene is a gene listed in Table 5. In certain embodiments, the gene is the SCN1A gene.

[0020] In certain embodiments of any of the foregoing methods, the cell contains less truncated gene products than cells without the tRNA. In certain embodiments, the cell contains a greater amount of functional gene products than cells without the tRNA.

[0021] In another aspect, the present invention provides a method for increasing the activity of a voltage-gated sodium channel encoded by an SCN1A gene containing a premature stop codon in a cell, the method comprising introducing an effective amount of any of the aforementioned tRNAs or any of the aforementioned expression vectors into the cell, thereby allowing the incorporation of an amino acid into the SCN1A gene product at a position that would otherwise result in a truncated SCN1A gene product caused by the premature stop codon.

[0022] In another aspect, the present invention provides a method for increasing the activity of a voltage-gated sodium channel encoded by an SCN1A gene containing a premature stop codon in a cell, the method comprising introducing an effective amount of a tRNA listed in Table 3 (e.g., a tRNA comprising a nucleotide sequence selected from SEQ ID NOs: 6-9, 11, 16-18, 22, 35, 36, 38, 45, 178, 180 and 187), or an expression vector comprising a nucleotide sequence encoding the tRNA, into the cell, thereby allowing amino acids to be incorporating into the SCN1A gene product at a position that would otherwise result in a truncated SCN1A gene product caused by a premature stop codon.

[0023] In certain embodiments of any of the foregoing methods, wherein the gene is a SCN1A gene, the SCN1A gene product produced using the tRNA is a functional SCN1A gene product. In certain embodiments, the functional SCN1A gene product has greater activity than a truncated SCN1A gene product. In certain embodiments, the functional SCN1A gene product is Na v 1.1 Protein. In certain embodiments, the functional SCN1A gene product comprises the amino acid sequence of any one of SEQ ID NOs: 863-868.

[0024] In certain embodiments of any of the foregoing methods, the cell is a human cell. In certain embodiments, the cell is a central nervous system cell, such as a neuron. In certain embodiments, the tRNA becomes aminoacylated in the cell.

[0025] In another aspect, the present invention provides a method for treating a disorder mediated by a premature stop codon in a subject in need thereof, wherein the subject has a gene containing a premature stop codon, the method comprising administering to the subject an effective amount of any of the aforementioned tRNAs or any of the aforementioned expression vectors, thereby treating the disorder in the subject. In certain embodiments, the disorder is selected from the disorders listed in Table 5 or Table 6.

[0026] In another aspect, the present invention provides a method for treating a disorder mediated by a premature stop codon in a subject in need thereof, wherein the subject has a gene containing a premature stop codon, the method comprising administering to the subject an effective amount of a tRNA listed in Table 3 (e.g., a tRNA comprising a nucleotide sequence selected from SEQ ID NO: 6-9, 11, 16-18, 22, 35, 36, 38, 45, 178, 180 and 187), or an expression vector comprising a nucleotide sequence encoding the tRNA, thereby treating the disorder in the subject, wherein the disorder is a disorder listed in Table 5.

[0027] In certain embodiments of any of the foregoing methods of treatment, the disorder is epilepsy, e.g., Dravet syndrome. In certain embodiments, the subject is a human. In certain embodiments, the method further comprises administering to the subject an effective amount of another agent, e.g., DIACOMIT ® (Stiripentol), EPIODOLEX ® (cannabidiol), ketogenic diet, ONFI ® (clobazam), TOPAMAX ® (topiramate), fenfluramine, or valproic acid.

[0028] In certain embodiments of any of the foregoing methods, wherein the gene is the SCN1A gene, the premature stop codon in the SCN1A gene is caused by a mutation or a combination of mutations selected from the group consisting of c.664C>T, c.1129C>T, c.1492A>T, c.1624C>T, c.1738C>T, c.1837C>T, c.2134C>T, c.2593C>T, c.3637C>T, c.3733C>T, c.3985C>T, c.4573C>T, c.5656C>T, and c.5734C>T. In certain embodiments, the premature stop codon is caused by a mutation selected from the group consisting of c.1738C>T and c.3985C>T.

[0029] These and other aspects and features of the present invention are described in the following detailed description and claims.

[0030] The present invention relates to the following embodiments:

[0031] 1. tRNA comprising the nucleotide sequence listed in Table 2.

[0032] 2. The tRNA of embodiment 1, wherein the tRNA comprises a nucleotide sequence selected from SEQ ID NOs: 19-21, 37, 39, 40, 44, 179, 181, 182, and 186.

[0033] 3. The tRNA of embodiment 1 or 2, wherein the tRNA comprises a naturally occurring nucleotide modification.

[0034] 4. The tRNA of any one of embodiments 1-3, wherein the tRNA comprises one or more nucleotide modifications selected from 5-methyluridine, 5-carbamoylmethyluridine, 5-carbamoyl-methyl-2-O-methyluridine, 5-methoxy-carbonylmethyluridine, 5-methoxycarbonylmethyl-2-thiouridine, pseudouridine, dihydrouridine, 1-methyladenosine and inosine.

[0035] 5. An expression vector comprising a nucleotide sequence encoding the tRNA according to any one of embodiments 1-4.

[0036] 6. The expression vector of embodiment 5, wherein the expression vector comprises 1, 2, 3, 4 or more copies of the nucleotide sequence encoding the tRNA.

[0037] 7. The expression vector of embodiment 5 or 6, wherein the expression vector further comprises the nucleotide sequence listed in Table 4.

[0038] 8. The expression vector of embodiment 7, wherein the expression vector comprises a nucleotide sequence selected from SEQ ID NO: 869-888.

[0039] 9. An expression vector comprising a nucleotide sequence encoding a tRNA listed in Table 3, wherein the expression vector comprises 1, 2, 3, 4 or more copies of the nucleotide sequence encoding the tRNA.

[0040] 10. An expression vector comprising a nucleotide sequence encoding the tRNA listed in Table 3, wherein the expression vector further comprises a nucleotide sequence listed in Table 4.

[0041] 11. The expression vector of embodiment 9 or 10, wherein the tRNA comprises a nucleotide sequence selected from SEQ ID NO: 6-9, 11, 16-18, 22, 35, 36, 38, 45, 178, 180 and 187.

[0042] 12. The expression vector of embodiment 10 or 11, wherein the expression vector comprises a nucleotide sequence selected from SEQ ID NO: 869-888.

[0043] 13. The expression vector of any one of embodiments 5-12, wherein the expression vector is a viral vector.

[0044] 14. The expression vector of embodiment 13, wherein the viral vector is a DNA viral vector.

[0045] 15. The expression vector of embodiment 13 or 14, wherein the viral vector is an adeno-associated virus (AAV) vector.

[0046] 16. A pharmaceutical composition comprising the tRNA of any one of embodiments 1-4 or the expression vector of any one of embodiments 5-15, and a pharmaceutically acceptable excipient.

[0047] 17. The pharmaceutical composition of embodiment 16, wherein the tRNA or expression vector is not conjugated or associated with another moiety.

[0048] 18. The pharmaceutical composition of embodiment 17, wherein the tRNA or expression vector is not conjugated or associated with a carrier particle.

[0049] 19. The pharmaceutical composition of embodiment 8, wherein the carrier particles are amino lipid particles.

[0050] 20. The pharmaceutical composition of any one of embodiments 15-19, wherein the composition does not comprise nanoparticles.

[0051] 21. The pharmaceutical composition of any one of embodiments 15-20, wherein the composition does not comprise an amino lipid delivery compound.

[0052] 22. A method for expressing a functional gene product encoded by a gene containing a premature stop codon in a mammalian cell, the method comprising introducing into the cell an effective amount of the tRNA of any one of embodiments 1-4 or the expression vector of any one of embodiments 5-15, thereby allowing the incorporation of an amino acid into the gene product at a position that would otherwise result in a truncated gene product caused by the premature stop codon.

[0053] 23. The method of embodiment 22, wherein the cell contains fewer truncated gene products than cells without the tRNA.

[0054] 24. The method of embodiment 22 or 23, wherein the cell contains a greater amount of functional gene product than a cell without the tRNA.

[0055] 25. The method of any one of embodiments 22-24, wherein the gene is a gene listed in Table 5 or Table 6.

[0056] 26. The method according to embodiment 25, wherein the gene is a gene listed in Table 5.

[0057] 27. A method for expressing a functional gene product encoded by a gene containing a premature stop codon in a mammalian cell, the method comprising introducing an effective amount of a tRNA listed in Table 3 or an expression vector comprising a nucleotide sequence encoding the tRNA into the cell, thereby allowing amino acids to be incorporated into the gene product at positions that would otherwise result in a truncated gene product caused by the premature stop codon, wherein the gene is a gene listed in Table 5.

[0058] 28. The method of embodiment 27, wherein the tRNA comprises a nucleotide sequence selected from SEQ ID NO: 6-9, 11, 16-18, 22, 35, 36, 38, 45, 178, 180 and 187.

[0059] 29. The method of any one of embodiments 22-28, wherein the gene is the SCN1A gene.

[0060] 30. A method for increasing the activity of a voltage-gated sodium channel encoded by an SCN1A gene containing a premature stop codon in a cell, the method comprising introducing an effective amount of the tRNA described in any one of embodiments 1-4 or the expression vector described in any one of embodiments 5-15 into the cell, thereby allowing amino acids to be incorporating into the SCN1A gene product at a position that would otherwise result in a truncated SCN1A gene product caused by the premature stop codon.

[0061] 31. A method for increasing the activity of a voltage-gated sodium channel encoded by an SCN1A gene containing a premature stop codon in a cell, the method comprising introducing an effective amount of a tRNA listed in Table 3, or an expression vector comprising a nucleotide sequence encoding the tRNA, into the cell, thereby allowing amino acids to be incorporating into the SCN1A gene product at a position that would otherwise result in a truncated SCN1A gene product caused by the premature stop codon.

[0062] 32. The method of embodiment 31, wherein the tRNA comprises a nucleotide sequence selected from SEQ ID NO: 6-9, 11, 16-18, 22, 35, 36, 38, 45, 178, 180 and 187.

[0063] 33. The method of any one of embodiments 29-32, wherein the SCN1A gene product produced using the tRNA is a functional SCN1A gene product.

[0064] 34. The method of embodiment 33, wherein the functional SCN1A gene product has greater activity than the truncated SCN1A gene product.

[0065] 35. The method of embodiment 33 or 34, wherein the functional SCN1A gene product is Na v 1.1 Egg white.

[0066] 36. The method of any one of embodiments 33-35, wherein the functional SCN1A gene product comprises any one of SEQ ID NOs: 863-868.

[0067] 37. The method of embodiment 36, wherein the functional SCN1A gene product comprises SEQ ID NO:863 or SEQ ID NO:864.

[0068] 38. The method of any one of embodiments 22-37, wherein the cells are human cells.

[0069] 39. The method of any one of embodiments 22-38, wherein the tRNA becomes aminoacylated in the cell.

[0070] 40. A method for treating a premature stop codon-mediated disorder in a subject in need thereof, wherein the subject has a gene containing a premature stop codon, the method comprising administering to the subject an effective amount of the tRNA of any one of embodiments 1-4 or the expression vector of any one of embodiments 5-15, thereby treating the disorder in the subject.

[0071] 41. The method of embodiment 40, wherein the condition is a condition listed in Table 5 or Table 6.

[0072] 42. The method of embodiment 41, wherein the condition is a condition listed in Table 5.

[0073] 43. A method for treating a disorder mediated by a premature stop codon in a subject in need thereof, wherein the subject has a gene containing a premature stop codon, the method comprising administering to the subject an effective amount of a tRNA listed in Table 3, or an expression vector comprising a nucleotide sequence encoding the tRNA, thereby treating the disorder in the subject, wherein the disorder is a disorder listed in Table 5.

[0074] 44. The method of embodiment 43, wherein the tRNA comprises a nucleotide sequence selected from SEQ ID NO: 6-9, 11, 16-18, 22, 35, 36, 38, 45, 178, 180 and 187.

[0075] 45. The method of any one of embodiments 40-44, wherein the disorder is Dravet syndrome.

[0076] 46. ​​The method of embodiment 45, wherein the method further comprises administering stiripentol, cannabidiol, a ketogenic diet, clobazam, topiramate, fenfluramine, or valproic acid to the subject.

[0077] 47. The method of embodiment 45 or 46, wherein the gene is SCN1A.

[0078] 48. The method of any one of embodiments 40-47, wherein the subject is human.

[0079] 49. The method of any one of embodiments 29-39 or 47, wherein the premature stop codon in the SCN1A gene is caused by a mutation selected from c.664C>T, c.1129C>T, c.1492A>T, c.1624C>T, c.1738C>T, c.1837C>T, c.2134C>T, c.2593C>T, c.3637C>T, c.3733C>T, c.3985C>T, c.4573C>T, c.5656C>T and c.5734C>T.

[0080] 50. The method described in embodiment 49, wherein the premature stop codon in the SCN1A gene is caused by a mutation selected from c.1738C>T and c.3985C>T. BRIEF DESCRIPTION OF THE DRAWINGS

[0081] The invention may be more fully understood with reference to the following drawings.

[0082] Figure 1Schematic diagram of a transcript (e.g., SCN1A transcript) containing a premature stop codon (PTC) that results in a truncated protein product (e.g., a protein product in a subject with Dravet syndrome). The native stop codon is represented as a shaded circle and the premature stop codon is represented as an unshaded circle. Expression of a suppressor tRNA (e.g., an anticodon-modified arginine tRNA) with its cognate amino acid (AA) allows read-through of the PTC and promotes expression of the full-length protein.

[0083] Figure 2A is the consensus tRNA secondary structure. The numbering of residues is based on the tRNA numbering system described in Steinberg et al. (1993) NUCLEICACIDS RES. 21:3011-15. Figure 2B is a table showing the modification profiles of tRNA sequences from the cytosol of some eukaryotic organisms. The ratios in the table represent Figure 2A The frequency of occurrence of the listed nucleotides at the indicated numbered positions. Abbreviations for modified residues are defined in Motorin et al. (2005) “Transfer RNA Modification,” ENCYCLOPEDIA OF LIFE SCIENCES, John Wily & Sons, Inc.

[0084] Figure 3 Schematic diagram of a dual fluorescent reporter gene construct containing three copies of red fluorescent protein (tdTomato), TEV protease, a 51 bp linker region containing PTC + / - 8 flanking codons, and three copies of green fluorescent protein (EGFP). Expression is driven by the promoter of the elongation factor EF-1α located upstream of the first copy of tdTomato. All copies of tdTomato, EGFP, and TEV protease are separated from each other by the TEV protease cleavage site (Glu-Asn-Leu-Tyr-Phe-Gln-(Gly / Ser)).

[0085] Figure 4 is to describe Arg TCA Figure 2 shows the read-through activity of suppressor tRNA in a Flp-In-293 cell line stably expressing a dual fluorescent reporter gene with a subject S-PTC linker region (SEQ ID NO: 29) derived from a clinically relevant SCN1A nonsense mutation associated with Dravet syndrome. TCASuppressor tRNA (SEQ ID NO: 1-25 and 35) transfected cells, and read-through activity was measured by flow cytometry in two independent experiments 24 hours after transfection. "Parent" means the original Flp-In-293 cell line without fluorescent reporter gene, "no PTC" means the Flp-In-293 cell line with the double fluorescent reporter gene of the subject S-PTC joint region pattern (SEQ ID NO: 194) lacking PTC, "EV" (empty vector) means cells transfected with expression constructs without tRNA, and "TCG" means cells transfected with expression constructs containing wild-type Arg-tRNA with TCG anticodon. Read-through activity is expressed as the percentage of live cells expressing tdTomato and EGFP higher than background (" double positive % "). Error bars represent the standard deviation of data.

[0086] Figure 5 is to describe Arg TCA Figure 3 shows the read-through activity of suppressor tRNA in the Flp-In-3T3 cell line stably expressing a dual fluorescent reporter with a R1407X-PTC linker region (SEQ ID NO: 30) derived from a clinically relevant SCN1A nonsense mutation associated with Dravet syndrome. TCA Suppressor tRNA (SEQ ID NO: 1-25) transfected cells, and read-through activity was measured by flow cytometry in three independent experiments 24 hours after transfection. "Parent" means the original 3T3 cell line without fluorescent reporter gene, "no PTC" means the 3T3 cell line of the dual fluorescent reporter gene of the R1407X-PTC joint region pattern (SEQ ID NO: 195) with lack of PTC, "simulation" means the cell of simulated transfection, "EV" (empty vector) means the cell transfected with the expression construct without tRNA or EGFP reporter gene, "TCG" means the cell transfected with the expression construct containing the wild-type Arg-tRNA with TCG anticodon. Read-through activity is expressed as the percentage of live cells expressing tdTomato and EGFP higher than the background (" double positive % "). Error bars represent the standard deviation of data.

[0087] Figure 6 is to describe Arg TCA Figure 2 shows the read-through activity of suppressor tRNA in Flp-In-3T3 cells transiently transfected with a dual fluorescent reporter with a subject N-PTC linker region (SEQ ID NO: 28) derived from a clinically relevant SCN1A nonsense mutation associated with Dravet syndrome. TCASuppressor tRNA (SEQ ID NO: 1-25 and 35) co-transfected cells, and read-through activity was measured by flow cytometry. "Mock" means simulated transfected cells, "no PTC" means cells transfected with a dual fluorescent reporter gene with a subject N-PTC linker region pattern (SEQ ID NO: 193) lacking PTC, "EV" (empty vector) means cells co-transfected with an expression construct without tRNA, and "TCG" means cells co-transfected with an expression construct containing a wild-type Arg-tRNA with a TCG anticodon. Read-through activity is measured by flow cytometry and is expressed as the percentage of live cells expressing tdTomato and EGFP above background ("double positive %").

[0088] Figure 7 is the Arg that describes the instructions TCA Figure 3 shows the read-through activity of suppressor tRNA in Neuro-2a (N2a) and Flp-In-293 (293) cells (measured by the percentage of GFP-positive cells). Expression constructs containing the EGFP-R96X-TGA reporter gene (SEQ ID NO: 31) and the indicated Arg TCA Cells were co-transfected with expression constructs for suppressor tRNAs (SEQ ID NOs: 1-22). "EGFP" indicates cells transfected with a version of the EGFP reporter gene lacking PTC, and "EGFP-PTC" indicates cells transfected with a single EGFP-R96X-TGA reporter gene. EGFP expression was analyzed by flow cytometry in 293 cells approximately 24 hours after transfection and in N2a cells approximately 48 hours after transfection. Read-through activity is expressed as the percentage of live cells expressing EGFP above background ("% GFP+"), and all values ​​are normalized to cells expressing EGFP lacking PTC.

[0089] Fig. 8A is a depiction of an experimental approach to measure suppressor tRNA activity using a construct containing an EGFP reporter gene with a PTC and a suppressor tRNA. The natural stop codon is represented as a shaded circle, and the premature stop codon is represented as an unshaded circle. The standard Arg-tRNA (with an anticodon that binds CGA) will result in no read-through of the PTC in EGFP, and a non-functional truncated EGFP protein. The suppressor tRNA (with an anticodon that binds UGA) allows the read-through of the PTC in EGFP, resulting in a full-length functional EGFP protein. Figure 8B is a schematic diagram of an exemplary reporter construct containing EGFP with a PTC and four copies of a suppressor tRNA.

[0090] Fig. 9Depicted are the expression vectors containing the EGFP-R96X-TGA reporter gene (SEQ ID NO: 31) and the indicated Arg TCA Fluorescence images of Neuro-2a cells transfected with expression constructs of suppressor tRNAs. The suppressor tRNAs were TCA-001 (SEQ ID NO: 11), TCA-113 (SEQ ID NO: 16), and TCA-115 (SEQ ID NO: 18). Each copy of the suppressor tRNA also contained 200 bp of upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 26) and 104 bp of downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 32). Images were taken approximately 24 hours after transfection. From left to right, the GFP controls are 1) wild-type EGFP alone, 2) TCA wild-type EGFP on an expression construct containing suppressor tRNA #001 (SEQ ID NO: 11), 3) the EGFP-R96X-TGA reporter gene alone, and 4) the EGFP-R96X-TGA reporter gene on an expression construct including four copies of the wild-type Arg-tRNA with an unmodified TCG anticodon.

[0091] Fig.10 Depicted are the expression vectors containing the EGFP-R96X-TGA reporter gene (SEQ ID NO: 31) and the indicated Arg TCA Fluorescence images of Flp-In-293 cells transfected with expression constructs of suppressor tRNAs. The suppressor tRNAs were TCA-001 (SEQ ID NO: 11), TCA-113 (SEQ ID NO: 16), and TCA-115 (SEQ ID NO: 18). Each copy of the suppressor tRNA also contained 200 bp of upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 26) and 104 bp of downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 32). Images were taken approximately 48 hours after transfection. From left to right, the GFP controls are 1) wild-type EGFP alone, 2) TCAwild-type EGFP on an expression construct containing suppressor tRNA #001 (SEQ ID NO: 11), 3) the EGFP-R96X-TGA reporter gene alone, and 4) the EGFP-R96X-TGA reporter gene on an expression construct including four copies of the wild-type Arg-tRNA with an unmodified TCG anticodon.

[0092] Fig.11 The results of flow cytometry analysis of the cells containing the EGFP-R96X-TGA reporter gene (SEQ ID NO: 177) and Arg TCA Fluorescence of Neuro-2a and Flp-In-293 cells transfected with an expression construct for suppressor tRNA #001 (SEQ ID NO: 11). The expression construct included one (1x), two (2x), or four (4x) copies of suppressor tRNA in the context of either (i) a U6 promoter including 19 bp upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 33) and 46 bp downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 34) ("U6") or (ii) 200 bp upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 26) and 200 bp downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 27) ("Flanking"). "Empty vector" indicates cells transfected with an expression construct without tRNA or EGFP reporter gene, and "EF1a:EGFP" indicates cells transfected with a version of the EGFP reporter gene lacking the PTC. Analysis was performed approximately 48 hours after transfection. Data are presented as a histogram showing the frequency distribution of data relative to the fluorescence intensity of live cells expressing EGFP above background.

[0093] Fig.12 Depicted are the expression of proteins expressed as proteins in the presence of an EGFP-R96X-TGA reporter gene (SEQ ID NO: 177) and Arg with the indicated copy numbers measured by flow cytometry. TCA The percentage of EGFP-positive cells and the average EGFP intensity of all living cells in Neuro-2a cells transfected with the expression construct of suppressor tRNA #001 (SEQ ID NO: 11) were analyzed. TCASuppressor tRNA #001 was in the context of either (i) a U6 promoter comprising 19 bp upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 33) and 46 bp downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 34) ("U6") or (ii) 200 bp upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 26) and 200 bp downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 27) ("Flanking"). "Empty vector" indicates cells transfected with expression constructs without tRNA or EGFP reporter gene, and "EF1a:EGFP" indicates cells transfected with a version of the EGFP reporter gene lacking the PTC. Analyses were performed approximately 48 hours after transfection. These figures summarize Fig.11 Data for Neuro-2a cells.

[0094] Fig.13 The results of flow cytometry analysis of the cells containing the EGFP-R96X-TGA reporter gene (SEQ ID NO: 31) and Arg TCA Fluorescence of Neuro-2a cells transfected with an expression construct for suppressor tRNA #001 (SEQ ID NO: 11). The expression construct included one (1x), two (2x), three (3x), or four (4x) copies of the suppressor tRNA. Each copy of the suppressor tRNA also contained 200 bp of upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 26) and 104 bp of downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 32) ("Flanking"). "CAG:EGFP" indicates cells transfected with a PTC-deficient EGFP reporter gene version, and "Mock" indicates cells transfected with a separate EGFP-R96X-TGA reporter gene. Analysis was performed approximately 48 hours after transfection. Data are displayed as histograms showing the frequency distribution of data relative to fluorescence intensity of all live cells ("G1 gate") and live cells expressing EGFP above background ("GFP+ gate").

[0095] Fig.14 The results of flow cytometry analysis of the cells containing the EGFP-R96X-TGA reporter gene (SEQ ID NO: 31) and Arg TCAFluorescence of Neuro-2a cells transfected with an expression construct for suppressor tRNA #113 (SEQ ID NO: 16). The expression construct included one (1x), two (2x), three (3x), or four (4x) copies of the suppressor tRNA. Each copy of the suppressor tRNA also contained 200 bp of upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 26) and 104 bp of downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 32) ("Flanking"). "CAG:EGFP" indicates cells transfected with a version of the EGFP reporter gene lacking PTC, and "Mock" indicates cells transfected with a separate EGFP-PTC reporter gene. Analysis was performed approximately 48 hours after transfection. Data are presented as histograms showing the frequency distribution of the data relative to the fluorescence intensity of all live cells ("G1 gate") and live cells expressing EGFP above background ("GFP+ gate").

[0096] Fig.15 The results of flow cytometry analysis of the cells containing the EGFP-R96X-TGA reporter gene (SEQ ID NO: 31) and Arg TCA Fluorescence of Neuro-2a cells transfected with an expression construct of suppressor tRNA #115 (SEQ ID NO: 18). The expression construct included one (1x), two (2x), three (3x), or four (4x) copies of the suppressor tRNA. Each copy of the suppressor tRNA also contained 200 bp of upstream flanking genomic DNA (SEQ ID NO: 26) from tRNA-Arg-TCG-1-1 and 104 bp of downstream flanking genomic DNA (SEQ ID NO: 32) from tRNA-Arg-TCG-1-1 ("Flanking"). "CAG:EGFP" indicates cells transfected with an EGFP reporter gene version lacking PTC, and "Mock" indicates cells transfected with a separate EGFP-R96X-TGA reporter gene. Analysis was performed approximately 48 hours after transfection. Data are displayed as histograms showing the frequency distribution of data relative to fluorescence intensity of all live cells ("G1 gate") and live cells expressing EGFP above background ("GFP+ gate").

[0097] Fig.16Depicted are the percentage of EGFP-positive cells among all live cells ("% Cells GFP+") and the average EGFP intensity in EGFP-positive cells ("GFP+ gate"), as measured by flow cytometry for Neuro-2a cells transfected with expression constructs containing the EGFP-R96X-TGA reporter gene (SEQ ID NO: 31) and the indicated number of copies of the indicated suppressor tRNAs. The suppressor tRNAs were TCA-001 (SEQ ID NO: 11), TCA-113 (SEQ ID NO: 16), and TCA-115 (SEQ ID NO: 18). "CAG:EGFP" indicates cells transfected with a version of the EGFP reporter gene lacking PTC, and "CAG:EGFP-PTC" indicates cells transfected with the EGFP-R96X-TGA reporter gene alone. These figures summarize Figure 13-15 The data in .

[0098] Fig.17 Depicted are the expression of proteins measured by flow cytometry using a genomic DNA sequence containing the EGFP-R96X-TGA reporter gene (SEQ ID NO: 31) and the indicated Arg with the indicated copy number and flanking sequences. TCAThe percentage of EGFP-positive cells in Neuro-2a cells transfected with expression constructs of suppressor tRNAs. The suppressor tRNAs are TCA-001 (SEQ ID NO: 11), TCA-113 (SEQ ID NO: 16), and TCA-115 (SEQ ID NO: 18). "U6" indicates the U6 promoter, which includes 19 bp upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 33) and 46 bp downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 34), "Flanking (±200 bp)" indicates 200 bp upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 26) and 200 bp downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 27), and "Flanking (+200 / -100 bp)" indicates 200 bp upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 26) and 104 bp downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 32) ("Flanking"). "Mock" indicates mock transfected cells, "Empty vector" indicates cells transfected with an expression construct without tRNA or EGFP reporter gene, "4xTCG" indicates cells transfected with an expression construct containing EGFP-R96X-TGA reporter gene and 4 copies of wild-type Arg-tRNA with TCG anticodon, and "CAG:EGFP" indicates cells transfected with a version of the EGFP reporter gene lacking PTC. All data are normalized to the positive control (CAG:EGFP). The graph shows the percentage of viable cells expressing GFP above background.

[0099] Fig.18 Is to describe Gln TTA Suppressor tRNAs are stably expressed in two independently derived Dmd mdx -PTC linker region (SEQ ID NO: 192) in the Flp-In-293 cell lines (#2 and #10). mdx -PTC linker region derived from a clinically relevant DMD nonsense mutation associated with Duchenne muscular dystrophy. TTACells were transfected with suppressor tRNA (SEQ ID NO: 36-48) and read-through activity was measured by flow cytometry 24 hours after transfection. "Parental" indicates the original Flp-In-293 cell line without a fluorescent reporter gene, and "No PTC" indicates a stable expression of Dmd with a lack of PTC. mdx -PTC linker region version (SEQ ID NO: 191), "TTG" indicates cells transfected with an expression construct containing a wild-type Gln-tRNA with a TTG anticodon. Read-through activity was measured by flow cytometry and expressed as the percentage of live cells expressing both tdTomato and EGFP over baseline ("% double + cells").

[0100] Fig.19 Is the Gln that depicts the instructions TTA A graph of the read-through activity of suppressor tRNAs (SEQ ID NOs: 36-48) in Neuro-2a cells co-transfected with an expression construct containing an EGFP-Q69X-TAA reporter gene (SEQ ID NO: 175). "Mock" represents mock-transfected cells, "EGFP" represents cells transfected with a version of the EGFP reporter gene lacking a PTC, "EV" (empty vector) represents cells transfected with an expression construct containing no tRNA or EGFP reporter gene, and "TTG" represents cells co-transfected with an EGFP-Q69X-TAA reporter gene and an expression construct containing a wild-type Gln-tRNA with a TTG anticodon. Read-through activity was measured by flow cytometry and is expressed as the percentage of live cells expressing GFP above background. Error bars represent the standard deviation of the data.

[0101] Fig. 20 Is the Gln that depicts the instructions TTA A graph of the read-through activity of suppressor tRNAs (SEQ ID NOs: 78-90) in Neuro-2a cells co-transfected with an expression construct containing an EGFP-Q69X-TAG reporter gene (SEQ ID NO: 176). "Mock" represents mock-transfected cells, "EGFP" represents cells transfected with a version of the EGFP reporter gene lacking a PTC, "EV" (empty vector) represents cells transfected with an expression construct containing no tRNA or EGFP reporter gene, and "TTG" represents cells co-transfected with an EGFP-Q69X-TAG reporter gene and an expression construct containing a wild-type Gln-tRNA with a TTG anticodon. Read-through activity was measured by flow cytometry and is expressed as the percentage of live cells expressing GFP above background. Error bars represent the standard deviation of the data.

[0102] Fig.21 Depicted are fluorescent images of Neuro-2a cells approximately 24 hours after transfection with an expression construct containing the EGFP-R96X-TGA reporter gene ("GFP-PTC"), wherein either (i) the indicated copy number of Arg TCA Inhibitor tRNA #115 (SEQ ID NO: 18), or (ii) treated with the indicated concentrations of ataluren, (iii) treated with the indicated concentrations of gentamicin, or (iv) treated with the indicated concentrations of G418. For all experimental conditions, cell culture medium was replaced with fresh medium approximately 6 hours after transfection, at which point the indicated drugs were added at the indicated concentrations. Controls in the left column were treated with cells containing wild-type EGFP ("WT-GFP") and the indicated drugs or the indicated number of copies of Arg TCA Transfection of suppressor tRNA expression constructs.

[0103] Fig. 22 is a graph depicting the percentage of GFP-positive cells measured by flow cytometry approximately 48 hours after transfection. Neuro-2a cells were transfected with an expression construct containing the EGFP-R96X-TGA reporter gene ("GFP-PTC") and either (i) including the indicated number of copies of Arg on the same construct. TCA Inhibitor tRNA #115 (SEQ ID NO: 18), or (ii) treated with the indicated concentrations of atarulen, (iii) treated with the indicated concentrations of gentamicin, or (iv) treated with the indicated concentrations of G418. For all experimental conditions, the cell culture medium was replaced with fresh medium approximately 6 hours after transfection, at which point the indicated drugs were added at the indicated concentrations. A reporter gene containing wild-type, PTC-free EGFP ("WT-GFP") was used as a control. "Mock" represents mock-transfected cells. "4XTCG" represents cells transfected with an expression construct containing four copies of wild-type Arg-tRNA with a TCG anticodon and the EGFP-R96X-TGA reporter gene. The graph shows the percentage of viable cells expressing EGFP above background. For cells expressing Arg TCA The percentage of cells expressing GFP ranged from 73.0% to 76.2% for cells treated with inhibitors, 0.7% to 1.6% for cells treated with ataluren, 0.9% to 4.9% for cells treated with gentamicin, and 6.7% to 26.7% for cells treated with G418.

[0104] Fig.23 Figure 2 is a graph of the chromatin concentrations measured by flow cytometry approximately 48 hours after transfection. Fig. 22Figure 2 shows the cell viability of Neuro-2a cells transfected with an expression construct containing the EGFP-R96X-TGA reporter gene ("GFP-PTC") and either (i) with an expression construct containing the indicated number of copies of Arg TCA Cells were transfected with an expression construct for suppressor tRNA #115 (SEQ ID NO: 18), or (ii) treated with the indicated concentrations of ataluren, (iii) treated with the indicated concentrations of gentamicin, or (iv) treated with the indicated concentrations of G418. For all experimental conditions, the cell culture medium was replaced with fresh culture medium approximately 6 hours after transfection, at which time the indicated drugs were added at the indicated concentrations. A reporter gene containing wild-type GFP without PTC ("WT-GFP") was used as a control. "Mock" represents cells that were mock-transfected. "4XTCG" represents cells transfected with an expression construct containing four copies of wild-type Arg-tRNA with a TCG anticodon and an EGFP-R96X-TGA reporter gene. Cell viability was assessed by flow cytometry using 7-aminoactinomycin D (7-AAD), a membrane-impermeable dye that is normally excluded from living cells.

[0105] Fig.24 Is the Gln that depicts the instructions CTA A graph of the read-through activity of suppressor tRNAs (SEQ ID NOs: 178-190) in Flp-In-293 cells transiently co-transfected with the indicated dual fluorescent reporter constructs containing a linker region (SEQ ID NOs: 889, 891, and 893) derived from three clinically relevant Gln(Q)-to-TAG PTC mutations (Q1397*, Q1504*, and Q1810*) in SCN1A associated with Dravet syndrome. "Mock" represents mock-transfected cells, "No PTC" represents cells transfected with a dual fluorescent reporter construct lacking PTCs (SEQ ID Nos: 890, 892, and 894), "EV" (empty vector) represents cells transfected with an expression construct containing no tRNA or fluorescent reporter, and "TTG" represents cells co-transfected with the indicated dual fluorescent reporter constructs and an expression construct containing a wild-type Gln-tRNA with a TTG anticodon. Read-through activity was measured by flow cytometry approximately 24 hours after transfection and expressed as the percentage of live cells expressing both tdTomato and EGFP above baseline ("% Double+ cells").

[0106] Fig.25 Is the Gln that depicts the instructions CTAFigure of read-through activity of suppressor tRNA (SEQ ID NO: 178-190) in Flp-In-293 cell lines containing integrated dual fluorescent reporter constructs containing a linker region (SEQ ID NO: 889), which is derived from a clinically relevant PTC mutation (Q1397*) in SCN1A associated with Dravet syndrome. "Mock" represents simulated transfected cells, "RFP-EGFP" represents an integrated version of the Flp-In-293 cell line containing a dual fluorescent reporter construct lacking PTC (SEQ ID NO: 890), "EV" (empty vector) represents cells transfected with expression constructs without tRNA or EGFP reporter genes, and "TTG" represents cells transfected with wild-type Gln-tRNA with TTG anticodon. Read-through activity was measured by flow cytometry approximately 24 hours after transfection and is expressed as the percentage of cells expressing both tdTomato and EGFP above background ("% double + cells").

[0107] Fig.26A Shown are the results of flow cytometry analysis of a 5-well plate containing the EGFP-R96X-TGA reporter gene and a single copy of Arg TCA The fluorescence of Neuro-2a cells transfected with the expression construct of suppressor tRNA #115 was TCASuppressor tRNA #115 was in the context of: (i) 200 bp upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 26) and 104 bp downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 32) ("Flanking 300"), (ii) 20 bp upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 895) and 17 bp downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 896) ("Flanking 20"), (iii) 10 bp upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 897) and 17 bp downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 898) ("Flanking 21"). 896) ("Flanking 10"), or (iv) 0 bp upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 and 17 bp downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 896) ("Flanking 0"). Details of the expression vectors are shown in Table 11. "GFP-PTC" indicates cells transfected with the EGFP-R96X-TGA reporter gene (SEQ ID NO: 31) alone, and "GFP" indicates cells transfected with a version of the EGFP reporter gene lacking PTC. Read-through activity was measured by flow cytometry approximately 24 hours after transfection. The data are shown as a histogram showing the frequency distribution of the data relative to the fluorescence intensity of cells expressing EGFP above background. Fig.26B Shows the Fig.26A Cells depicted in , the percentage of EGFP-positive cells among all live cells ("% GFP+") and the mean EGFP intensity among live cells expressing EGFP above background ("Mean GFP Signal").

[0108] Fig. 27 Schematic diagram of a construct used to test the effect of a 5' leader sequence on the readthrough of a suppressor tRNA to a premature termination codon (PTC). The construct contained (i) a 100 bp 5' leader sequence derived from genomic DNA located upstream of a tRNA gene that is highly expressed in HEK293 cells, (ii) a single copy of Arg TCA Suppressor tRNA #115 (SEQ ID NO: 18) or Gln TTA suppressor tRNA #163 (SEQ ID NO: 45), and (iii) an RNA polymerase III termination signal ("Term").

[0109] Fig.28 The indicated Arg measured by flow cytometry in Flp-In-293 cells approximately 24 hours after transfection are depicted. TCA Figure 2 shows the read-through activity of suppressor tRNA expression constructs. In the context of the indicated 100 bp upstream genomic DNA leader sequence (SEQ ID NO: 869-888), constructs containing (i) EGFP-R96X-TGA reporter gene (SEQ ID NO: 31) and (ii) Arg TCA Cells were co-transfected with a construct containing the suppressor tRNA #115 (SEQ ID NO: 18). "WT-EGFP" indicates cells transfected with a reporter gene containing wild-type GFP without PTC, "EV" (empty vector) indicates cells co-transfected with an expression construct without tRNA or EGFP reporter gene, "26 / 27" indicates cells co-transfected with the ArgTCA suppressor tRNA #115 (SEQ ID NO: 18) in the background of 200 bp upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 26) and 200 bp downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 27). The figure shows the percentage of viable cells expressing EGFP above background. For cells expressing Arg TCA In the suppressor cells, the percentage of cells expressing EGFP ranged from 17.2% to 33.7%, relative to 0.4% of the empty vector control.

[0110] Fig.29 The indicated Arg measured by flow cytometry in Flp-In-293 cells approximately 24 hours after transfection are depicted. TCA Figure 2 shows the read-through activity of suppressor tRNA expression constructs. In the context of the indicated 100 bp upstream genomic DNA leader sequence (SEQ ID NO: 869-888), constructs containing (i) EGFP-R96X-TGA reporter gene (SEQ ID NO: 31) and (ii) Arg TCACells were co-transfected with a construct containing the suppressor tRNA #115 (SEQ ID NO: 18). "WT-EGFP" indicates cells transfected with a reporter gene containing wild-type GFP without PTC, "EV" (empty vector) indicates cells co-transfected with an expression construct without tRNA or EGFP reporter gene, "26 / 27" indicates cells co-transfected with the ArgTCA suppressor tRNA #115 (SEQ ID NO: 18) in the background of 200 bp upstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 26) and 200 bp downstream flanking genomic DNA from tRNA-Arg-TCG-1-1 (SEQ ID NO: 27). The figure shows the average EGFP intensity in cells expressing EGFP above background. TCA The mean EGFP intensity of the suppressor cells ranged from 1990 to 4319, relative to 602 for the empty vector control.

[0111] Fig.30 Figure 3 is a graph depicting the indicated Gln measured by flow cytometry in Flp-In-293 cells approximately 24 hours after transfection. TTA Figure 2 shows the read-through activity of suppressor tRNA expression constructs. In the context of the indicated 100 bp upstream genomic DNA leader sequence (SEQ ID NO: 869-888), constructs containing (i) EGFP-Q69X-TAA reporter gene (SEQ ID NO: 175) and (ii) Gln TTA The cells were co-transfected with a construct containing the inhibitor tRNA #163 (SEQ ID NO: 45). "WT-EGFP" indicates cells transfected with a reporter gene containing wild-type GFP without PTC, "EV" (empty vector) indicates cells co-transfected with an expression construct without tRNA or EGFP reporter gene, and "173 / 174" indicates Gln in the background of 200 bp upstream flanking genomic DNA from tRNA-Gln-TTG-1-1 (SEQ ID NO: 173) and 200 bp downstream flanking genomic DNA from tRNA-Gln-TTG-1-1 (SEQ ID NO: 174). TTA The graph shows the percentage of live cells expressing EGFP above background. TTA In the suppressor cells, the percentage of cells expressing EGFP ranged from 21.4% to 35.7%, relative to 0.3% of the empty vector control.

[0112] Fig.31Figure 3 is a graph depicting the indicated Gln measured by flow cytometry in Flp-In-293 cells approximately 24 hours after transfection. TTA Figure 2 shows the read-through activity of suppressor tRNA expression constructs. In the context of the indicated 100 bp upstream genomic DNA leader sequence (SEQ ID NO: 869-888), constructs containing (i) EGFP-Q69X-TAA reporter gene (SEQ ID NO: 175) and (ii) Gln TTA The cells were co-transfected with a construct containing the inhibitor tRNA #163 (SEQ ID NO: 45). "WT-EGFP" indicates cells transfected with a reporter gene containing wild-type GFP without PTC, "EV" (empty vector) indicates cells co-transfected with an expression construct without tRNA or EGFP reporter gene, "173 / 174" indicates Gln in the background of 200 bp upstream flanking genomic DNA from tRNA-Gln-TTG-1-1 (SEQ ID NO: 173) and 200 bp downstream flanking genomic DNA from tRNA-Gln-TTG-1-1 (SEQ ID NO: 174). TTA The graph shows the average EGFP intensity in cells expressing EGFP above background. TTA The mean EGFP intensity of the suppressor cells ranged from 1702 to 3822, relative to 387 for the empty vector control.

[0113] Fig.32 It is a summary Figure 28-31 Table of results where values ​​have been normalized to cells transfected with wild-type GFP without PTC.

[0114] Fig.33 Graph depicting the percentage of EGFP-positive cells measured by flow cytometry in three independent experiments approximately 48 hours after transfection. Neuro-2a cells were transfected with an expression construct containing an EGFP-Q69X-TAA reporter gene ("EGFP-PTC") (SEQ ID NO: 175) and either (i) including the indicated number of copies of Gln on the same construct. TTAInhibitor tRNA #002 (SEQ ID NO: 36), or (ii) treated with the indicated concentrations of ataluren, (iii) treated with the indicated concentrations of gentamicin, or (iv) treated with the indicated concentrations of G418. For all experimental conditions, the cell culture medium was replaced with fresh culture medium approximately 6 hours after transfection, at which time the indicated drugs were added at the indicated concentrations. A reporter gene containing wild-type EGFP without PTC ("EGFP") was used as a control. "Mock" represents mock-transfected cells, "No tRNA" represents cells transfected with the indicated EGFP expression construct alone, and "4X-Gln-TTG" represents cells transfected with an expression construct containing four copies of wild-type Gln-tRNA with a TTG anticodon and the EGFP-Q69X-TAA reporter gene. The graph shows the percentage of viable cells expressing GFP above background. Error bars represent the standard deviation of the data. For cells expressing Gln TTA The percentage of cells expressing GFP ranged from 64.7% to 67.3% for the inhibitors, compared to 0.2% to 0.7% for the negative control, 0.4% to 0.6% for cells treated with ataluren, 0.4% for cells treated with gentamicin, and 1.7% to 4.5% for cells treated with G418.

[0115] Fig.34 Figure 2 is a graph of the chromatin profiles measured by flow cytometry approximately 48 hours after transfection. Fig.33 Neuro-2a cells were transfected with an expression construct containing the EGFP-Q69X-TAA reporter gene ("EGFP-PTC") (SEQ ID NO: 175) and either (i) including the indicated number of copies of Gln on the same construct. TTA Inhibitor tRNA #002 (SEQ ID NO: 36), or (ii) treated with indicated concentrations of ataluren, (iii) treated with indicated concentrations of gentamicin, or (iv) treated with indicated concentrations of G418. For all experimental conditions, the cell culture medium was replaced with fresh culture medium approximately 6 hours after transfection, at which time the indicated drugs were added at the indicated concentrations. A reporter gene containing wild-type EGFP without PTC ("EGFP") was used as a control. "Mock" represents mock-transfected cells, "No tRNA" represents cells transfected with the indicated EGFP expression construct alone, and "4X-Gln-TTG" represents cells transfected with an expression construct containing four copies of wild-type Gln-tRNA with a TTG anticodon and the EGFP-Q69X-TAA reporter gene. Cell viability was assessed by flow cytometry using 7-aminoactinomycin D (7-AAD), a membrane-impermeable dye that is normally excluded from living cells.

[0116] Fig.35 Graph depicting the percentage of EGFP-positive cells measured by flow cytometry in three independent experiments approximately 48 hours after transfection. Neuro-2a cells were transfected with an expression construct containing an EGFP-Q69X-TAG reporter gene ("EGFP-PTC") (SEQ ID NO: 176) and either (i) including the indicated number of copies of Gln on the same construct. CTA Inhibitor tRNA #196 (SEQ ID NO: 178), or (ii) treated with the indicated concentrations of ataluren, (iii) treated with the indicated concentrations of gentamicin, or (iv) treated with the indicated concentrations of G418. For all experimental conditions, the cell culture medium was replaced with fresh medium approximately 6 hours after transfection, at which time the indicated drugs were added at the indicated concentrations. A reporter gene containing wild-type EGFP without PTC ("EGFP") was used as a control. "Mock" represents mock-transfected cells, "No tRNA" represents cells transfected with the indicated EGFP expression construct alone, and "4X-Gln-TTG" represents cells transfected with an expression construct containing four copies of wild-type Gln-tRNA with a TTG anticodon and the EGFP-Q69X-TAA reporter gene. The graph shows the percentage of viable cells expressing GFP above background. For cells expressing Gln CTA The percentage of cells expressing GFP ranged from 73.1% to 78.2% for cells treated with inhibitors, compared with 0.5% to 0.8% for negative controls, 0.5% to 0.7% for cells treated with ataluren, 0.5% to 1.1% for cells treated with gentamicin, and 13.6% to 20.6% for cells treated with G418.

[0117] Fig.36 Figure 2 is a graph of the chromatin profiles measured by flow cytometry approximately 48 hours after transfection. Fig.35 Neuro-2a cells were transfected with an expression construct containing the EGFP-Q69X-TAG reporter gene ("EGFP-PTC") (SEQ ID NO: 176) and either (i) including the indicated number of copies of Gln on the same construct. CTAInhibitor tRNA #196 (SEQ ID NO: 178), or (ii) treated with indicated concentrations of ataluren, (iii) treated with indicated concentrations of gentamicin, or (iv) treated with indicated concentrations of G418. For all experimental conditions, the cell culture medium was replaced with fresh culture medium approximately 6 hours after transfection, at which time the indicated drugs were added at the indicated concentrations. A reporter gene ("EGFP") containing wild-type EGFP without PTC was used as a control. "Mock" represents mock-transfected cells, "no tRNA" represents cells transfected with the indicated EGFP expression construct alone, and "4X-Gln-TTG" represents cells transfected with an expression construct containing four copies of wild-type Gln-tRNA with TTG anticodon and EGFP-Q69X-TAA reporter gene. Cell viability was assessed by flow cytometry using 7-aminoactinomycin D (7-AAD), a membrane-impermeable dye that is normally excluded from living cells.

[0118] Fig.37A is a Western blot depicting rescue of full-length SCN1A protein expression by suppressor tRNA. Flp-In-293 cells were transfected with an expression construct (SEQ ID NO: 899) containing mouse SCN1A with a PTC (R1407X) with Arg(R) to TGA and a 3xFLAG tag peptide at the C-terminus (DYKDHD-G-DYKDHD-I-DYKDDDDK) ("SCN1a(R1407*)") and either (i) with a PTC containing Arg(R) to TGA TCA Cells were co-transfected with an expression construct ("Arg>TGA#115") for suppressor tRNA #115 (SEQ ID NO: 18) or (ii) treated with the indicated concentrations of ataluren, (iii) treated with the indicated concentrations of gentamicin, or (iv) treated with the indicated concentrations of G418. "SCN1a (wt)" indicates cells transfected with an expression construct containing wild-type mouse SCN1A and a 3xFLAG tag peptide at the C-terminus (SEQ ID NO: 898). Proteins were isolated 24 hours after transfection and SCN1A was detected using a monoclonal anti-FLAG M2 antibody. Molecular weights based on protein molecular weight markers are indicated on the left side of the gel. Fig.37B yes Fig.37A Quantification of the Western blot shown in . The intensity of the bands corresponding to the size of the full-length SCN1A protein was measured using ImageJ, and all intensity values ​​were normalized to the wild-type SCN1A protein (“SCN1a (wt)” lane). TCACells co-transfected with the suppressor tRNA expression vector expressed more than 70% of the full-length SCN1A expressed by cells transfected with the expression construct containing wild-type SCN1A.

[0119] Fig.38A is a Western blot depicting rescue of full-length SCN1A protein expression by suppressor tRNA. Flp-In-293 cells were transfected with (i) an expression construct containing mouse SCN1A with a PTC (R1407X) with Arg to TGA and a 3xFLAG tag peptide (DYKDHD-G-DYKDHD-I-DYKDDDDK) at the C-terminus (SEQ ID NO: 899) ("SCN1a(R1407*)") and (ii) #104 Arg TCA Suppressor tRNA (SEQ ID NO: 6) ("Sup#104"), #106 Arg TCA Suppressor tRNA (SEQ ID NO: 8) ("Sup#106"), or Arg TCA Suppressor tRNA #115 (SEQ ID NO: 18) ("Sup #115") was co-transfected. "SCN1a (wt)" indicates cells transfected with an expression construct containing wild-type mouse SCN1A and a 3xFLAG tag peptide at the C-terminus (SEQ ID NO: 898). Proteins were isolated 24 hours after transfection and SCN1A was detected using a monoclonal anti-FLAG M2 antibody. Molecular weights based on protein molecular weight markers are indicated on the left side of the gel. Fig.38B yes Fig.38A Quantification of the Western blot shown in . The intensity of the bands corresponding to the size of the full-length SCN1A protein was measured using ImageJ, and all intensity values ​​were normalized to the wild-type SCN1A protein (“SCN1a (wt)” lane). TCA Cells co-transfected with suppressor tRNA expressed greater than 30% (Sup#104), greater than 60% (Sup#106), or greater than 70% (Sup#115) of the full-length SCN1A expressed by cells transfected with expression constructs containing wild-type SCN1A.

[0120] Fig.39Ais a Western blot depicting rescue of full-length SCN1A protein expression by suppressor tRNA. Flp-In-293 cells were cultured in 6-well cell culture plates and treated with (i) an expression construct containing mouse SCN1A with a PTC (R1407X) with Arg to TGA and a 3xFLAG tag peptide (DYKDHD-G-DYKDHD-I-DYKDDDDK) at the C-terminus (SEQ ID NO: 899) ("SCN1a (R1407*)") and (ii) the indicated concentrations of Arg TCA Suppressor tRNA #115 (SEQ ID NO: 18) ("Arg>TGA#115") was co-transfected. 1x means 400 ng of Arg per well TCA Suppressor tRNA construct, 0.3x means 133 ng of Arg per well TCA Suppressor tRNA construct, 0.1x means 40 ng of Arg per well TCA Suppressor tRNA construct, 0.03x represents 13 ng of Arg per well TCA Suppressor tRNA constructs. "SCN1a (wt)" indicates cells transfected with an expression construct containing wild-type mouse SCN1A and a 3xFLAG tag peptide at the C-terminus (SEQ ID NO: 898). Proteins were isolated 24 hours after transfection and SCN1A was detected using a monoclonal anti-FLAG M2 antibody. Molecular weights based on protein molecular weight markers are indicated on the left side of the gel. Fig.39B yes Fig.39A Quantification of the Western blot shown in . The intensity of the band corresponding to the size of the full-length SCN1A protein was measured using ImageJ, and all intensity values ​​were normalized to the wild-type SCN1A protein ("SCN1a (wt)" lane).

[0121] Fig.40 Schematic diagram of the constructs packaged into AAV-PHP.eB capsids. Construct 262 contains wild-type EGFP driven by the EF1a promoter. Construct 269 contains EGFP-R96X-TGA (SEQ ID NO: 177) driven by the EF1a promoter and two copies of Arg in the context of 55 bp upstream flanking genomic DNA from tRNA-Tyr-GTA-5-1 (SEQ ID NO: 900). TCA Suppressor tRNA #115 (SEQ ID NO: 18) ("TCA-115"). Both constructs contain 5' and 3' ITR sequences from AAV2, which provide cis-acting elements for AAV replication and packaging.

[0122] Fig.41 Depicting the read-through activity of suppressor tRNA delivered by AAV. Fig.40 AAV-PHP.eB of the constructs shown was produced by Vigene Biosciences. 293 cells were pre-transfected with an expression construct containing the LY6A gene 48 hours before AAV transduction, which is required for robust transduction by AAV-PHP.eB. Cells were transduced at an MOI of 1E5 vg / cell. Where indicated, expression constructs containing the EGFP-R96X-TGA reporter gene (SEQ ID NO: 31) and an expression construct containing Arg TCA Cells were transfected with an expression construct of suppressor tRNA #115 (SEQ ID NO: 18). 72 hours after transduction, EGFP signals were quantified by immunofluorescence. Live cell images were captured on an EVOS FL Auto2 imaging system. CellProfiler software was used to segment and extract the integrated EGFP intensity of the nuclei in each image. These values ​​for all nuclei under each condition were averaged. The background average cumulative EGFP intensity from the negative control condition was subtracted from these averages, and all values ​​were normalized. The figure depicts normalized % GFP intensity, and all values ​​were normalized to cells transduced with AAV-PHP.eB containing construct 262.

[0123] Fig.42 The fluorescence of Neuro-2a cells used for ribosome footprinting profiling as measured by flow cytometry is shown. TCA The expression construct of suppressor tRNA #001 (SEQ ID NO: 11) ("Arg TCA Cells were transfected with (i) an expression construct containing a version of the EGFP reporter gene lacking PTC ("WT-EGFP").

[0124] Fig.43 Depicted Fig.42 Fold changes in 3'UTR read density distribution (as determined by ribosome profiling) between the two Neuro-2a cell populations shown in FIG. 1 and FIG. 2 were performed using (i) a reporter gene containing the EGFP-R96X-TGA (SEQ ID NO: 177) and Arg TCA The expression construct of suppressor tRNA #001 (SEQ ID NO: 11) ("Arg TCACells were transfected with (i) an expression construct containing an EGFP reporter gene version lacking the PTC (“WT-EGFP”). Cells were lysed approximately 48 hours post-transfection and subjected to ribosome footprinting profiling. Raw reads were trimmed of adapters using Trimmomatic and then noncoding RNAs were subtracted by aligning against the mouse mm10 ncRNA reference from Ensembl using bowtie2. The remaining reads were aligned against the mm10 mouse reference assembly from UCSC, again using bowtie2. Multiply mapped reads were discarded. The resulting final aligned read set was quantified using the RiboProfiling package in R and a custom Python script. Python was used to generate plots examining 3' UTR occupancy and fold change for each gene with 20 or more unique mapped reads, and the distribution of genes with each native stop codon was compared using a 2-sample Kolmogorov-Smirnov test. DETAILED DESCRIPTION OF THE INVENTION

[0126] The present invention is based in part on the discovery of tRNAs (e.g., inhibitory tRNAs) that allow the incorporation of an amino acid into a gene product encoded by a gene in a mammalian cell at a position that would otherwise result in a truncated gene product caused by a premature stop codon (PTC) in the gene. The present invention is further based in part on the discovery that tRNAs that allow the incorporation of an amino acid into a gene product encoded by a gene at a position that would otherwise result in a truncated gene product caused by a PTC in the gene can be used to treat a disease mediated by a PTC in a gene in a subject.

[0127] Thus, in one aspect, the invention provides a tRNA (eg, an isolated tRNA) comprising a nucleotide sequence listed in Table 2.

[0128] On the other hand, the present invention provides an expression vector comprising a nucleotide sequence encoding a tRNA (e.g., as listed in Tables 1-3). In certain embodiments, the expression vector comprises 1, 2, 3, 4 or more than 4 copies of a nucleotide sequence encoding a tRNA. In certain embodiments, the expression vector comprises a nucleotide sequence corresponding to a genomic DNA sequence flanking a wild-type tRNA gene. For example, in certain embodiments, the expression vector comprises a nucleotide sequence listed in Table 4.

[0129] In another aspect, the present invention provides a pharmaceutical composition comprising any of the above tRNAs or any of the above expression vectors and a pharmaceutically acceptable excipient.

[0130] In another aspect, the present invention provides a method for expressing a functional gene product encoded by a gene containing a premature stop codon in a mammalian cell, the method comprising introducing an effective amount of tRNA (e.g., as shown in Tables 1-3 below, e.g., comprising SEQ ID NO: 6-9, 11, 16-22, 35-40, 44, 45, 178-182, 186 or 187), or an expression vector comprising a nucleotide sequence encoding the tRNA, into the cell, thereby allowing amino acids to be incorporated into the gene product at positions that would otherwise result in truncated gene products caused by premature stop codons.

[0131] In some embodiments of any of the aforementioned methods, the cell contains fewer truncated gene products than the cell without the tRNA. For example, in certain embodiments, the cell contains less than about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80% or about 90% truncated gene products relative to the cell without the tRNA. In certain embodiments, the cell contains about 5% to about 80%, about 5% to about 60%, about 5% to about 40%, about 5% to about 20%, about 5% to about 10%, about 10% to about 80%, about 10% to about 60%, about 10% to about 40%, about 10% to about 20%, about 20% to about 80%, about 20% to about 60%, about 20% to about 40%, about 40% to about 80%, about 40% to about 60% or about 60% to about 80% truncated gene products relative to the cell without the tRNA. In certain embodiments, there is no detectable truncated gene product in the cell. The amount or expression of a truncated gene product can be measured by any method known in the art, such as Western blot or ELISA.

[0132] In certain embodiments, the cell contains a greater amount of functional gene product than a cell without the tRNA. For example, in certain embodiments, the method increases the amount of the functional gene product in the cell, tissue or subject by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 110%, about 120%, about 130%, about 140%, about 150%, about 160%, about 170%, about 180%, about 190%, about 200%, about 250%, about 300%, about 350%, about 400%, about 450% or about 500% relative to a cell, tissue or subject without the tRNA. In certain embodiments, the method increases the amount of a functional gene product in a cell, tissue or subject by about 20% to about 200%, about 20% to about 180%, about 20% to about 160%, about 20% to about 140%, about 20% to about 120%, about 20% to about 100%, about 20% to about 80%, about 20% to about 60%, about 20% to about 40%, about 40% to about 200%, about 40% to about 180%, about 40% to about 160%, about 40% to about 140%, about 40% to about 120%, about 40% to about 100%, about 40% to about 80%, about 40% to about 60%, about 20% to about 40%, about 40% to about 200%, about 40% to about 180%, about 40% to about 160%, about 40% to about 140%, about 40% to about 120%, about 40% to about 100%, about 40% to about 80%, about 40% to about 60%, about 60% to about 200%, about 60% to about 180%, about 40% to about 160%, about 40% to about 140%, about 40% to about 1 %, about 60% to about 120%, about 60% to about 100%, about 60% to about 80%, about 80% to about 200%, about 80% to about 180%, about 80% to about 160%, about 80% to about 140%, about 80% to about 120%, about 80% to about 100%, about 100% to about 200%, about 100% to about 180%, about 100% to about 160%, about 100% to about 140%, about 100% to about 120%, about 120% to about 200%, about 120% to about 180%, about 120% to about 160%, about 120% to about 140%, about 140% to about 200%, about 140% to about 180%, about 140% to about 160%, about 160% to about 200%, about 160% to about 180%, or about 180% to about 200%. The amount or expression of a functional gene product can be measured by any method known in the art, such as Western blot or ELISA.

[0133] In certain embodiments, the tRNA allows the incorporation of amino acids into gene products at positions corresponding to early stop codons (i.e., tRNA allows read-through of early stop codons), but tRNA does not allow the incorporation of a large number of amino acids into gene products at positions corresponding to natural stop codons (i.e., tRNA does not allow read-through of natural stop codons). For example, in certain embodiments, the disclosed tRNA does not increase the read-through of natural stop codons (or all natural stop codons) in cells, tissues, or subjects that have not yet been contacted with the tRNA, or increases the read-through by less than about 1%, about 2%, about 3%, about 4%, about 5%, about 10%, about 20%, about 30%, about 40%, or about 50%. The read-through of natural stop codons can be measured by any method known in the art, for example, ribosome profiling as described in Example 13 herein.

[0134] In certain embodiments of any of the above methods, the gene is selected from the genes listed in Table 5 or Table 6. In certain embodiments, the gene is the SCN1A gene.

[0135] On the other hand, the present invention provides a method for expressing a functional SCN1A gene product encoded by a SCN1A gene containing a premature stop codon in a cell, the method comprising introducing an effective amount of tRNA (e.g., as shown in Tables 1-3 below, e.g., comprising SEQ ID NO: 6-9, 11, 16-22, 35-40, 44, 45, 178-182, 186 or 187), or an expression vector comprising a nucleotide sequence encoding the tRNA, into the cell, thereby allowing amino acids to be incorporating into the SCN1A gene product at a position that would otherwise result in a truncated SCN1A gene product caused by a premature stop codon.

[0136] In another aspect, the present invention provides a method for increasing the activity of a voltage-gated sodium channel encoded by a SCN1A gene containing a premature stop codon in a cell, the method comprising introducing an effective amount of tRNA (e.g., as shown in Tables 1-3 below, e.g., comprising SEQ ID NO: 6-9, 11, 16-22, 35-40, 44, 45, 178-182, 186 or 187), or an expression vector comprising a nucleotide sequence encoding the tRNA, into the cell, thereby allowing amino acids to be incorporating into the SCN1A gene product at a position that would otherwise result in a truncated SCN1A gene product caused by the premature stop codon.

[0137] In another aspect, the present invention provides a method for treating a disorder mediated by a premature stop codon in a subject in need thereof, wherein the subject has a gene comprising a premature stop codon, the method comprising administering to the subject an effective amount of a tRNA (e.g., as shown in Tables 1-3 below, e.g., comprising SEQ ID NO: 6-9, 11, 16-22, 35-40, 44, 45, 178-182, 186 or 187), or an expression vector comprising a nucleotide sequence encoding a tRNA, thereby treating the disorder in the subject. In certain embodiments, the disorder is selected from the disorders listed in Table 5 or Table 6.

[0138] In another aspect, the present invention provides a method for treating Dravet syndrome in a subject in need thereof, wherein the subject has an SCN1A gene comprising a premature stop codon, the method comprising administering to the subject an effective amount of tRNA (e.g., as shown in Tables 1-3 below, e.g., comprising SEQ ID NO: 6-9, 11, 16-22, 35-40, 44, 45, 178-182, 186 or 187), or an expression vector comprising a nucleotide sequence encoding the tRNA, thereby treating Dravet syndrome in the subject.

[0139] I. tRNA and suppressor tRNA

[0140] During protein synthesis, transfer RNA (tRNA) delivers amino acids to ribosomes to be incorporated into growing protein (polypeptide) chains. The length of tRNA is generally about 70 to 100 nucleotides, and active tRNA contains 3'CCA sequence, which can be transcribed into tRNA during tRNA synthesis, or can be added later in post-transcriptional processing. In the aminoacylation process, the amino acid attached to a given tRNA molecule is covalently attached to the 2' or 3' hydroxyl of the 3' end ribose to form aminoacyl-tRNA (aa-tRNA). It is understood that amino acids can spontaneously migrate from 2'-hydroxyl to 3'-hydroxyl, and vice versa, but it is incorporated into growing protein chains at ribosomes from 3'-OH positions. The loop at the other end of the folded aa-tRNA molecule contains a sequence of three bases called anticodons. When this anticodon sequence hybridizes or base pairs with a complementary three-base codon sequence in a ribosome-bound messenger RNA (mRNA), the aa-tRNA binds to the ribosome and its amino acid is incorporated into the polypeptide chain being synthesized by the ribosome. Since all tRNAs that base pair with a specific codon are aminoacylated with a single specific amino acid, translation of the genetic code is affected by tRNA. Each of the 61 non-stop codons in the mRNA directs the binding of its cognate aa-tRNA and adds a single specific amino acid to the growing polypeptide chain being synthesized by the ribosome.

[0141] tRNA is usually highly conserved and usually functions across species. Therefore, tRNA derived from bacterial tRNA, non-mammalian eukaryotic tRNA or mammalian (e.g., human) tRNA can be used in the practice of the present invention. Nucleotide sequences encoding naturally occurring human tRNA are known and are generally available to those skilled in the art through sources such as Genbank. See also Sprinzl et al. (2005) Nucleic Acids Res. 33: D139-40; Buckland et al. (1996) Genomics 35(1): 164-71; Schimmel et al. (Eds.) (1979) "Transfer-RNA: Structure, Properties, and Recognition," Cold Spring Harbor Laboratory; Agris (1983) "The Modified Nucleosides of Transfer RNA, II," Alan R. Liss Inc. tRNA is usually highly conserved and usually functions across species.

[0142] Suppressor tRNA is a modified tRNA that inserts the appropriate amino acid at the site of a mutation in a protein-coding gene, such as a PTC. The use of the term in suppressor is based on the fact that in some cases the modified tRNA "suppresses" the phenotypic effects of the coding mutation. Suppressor tRNAs typically contain mutations (modifications) in the anticodon that alter the codon specificity, or at certain positions that alter the tRNA's aminoacylation properties (identity).

[0143] In certain embodiments, tRNA (e.g., suppressor tRNA) contains a modified anticodon region so that the modified anticodon hybridizes to a different codon relative to the corresponding naturally occurring anticodon. In certain embodiments, the modified anticodon hybridizes to a stop codon such as PTC, so that the tRNA incorporates amino acids into the gene product instead of terminating protein synthesis. In certain embodiments, the modified anticodon hybridizes to an early stop codon, so that the tRNA incorporates amino acids into the gene product at a position that would otherwise result in a truncated gene product caused by an early stop codon.

[0144] In certain embodiments, the tRNA includes an anticodon that hybridizes to a codon selected from UAG (i.e., an "amber" stop codon), UGA (i.e., an "opal" stop codon), and UAA (i.e., an "ochre" stop codon). In certain embodiments, the anticodon hybridizes to a codon selected from UGA to UAA. In certain embodiments, the anticodon hybridizes to UGA. In certain embodiments, the tRNA includes an anticodon that hybridizes to a non-standard stop codon, such as a 4-nucleotide codon (see, e.g., Moore et al. (2000) J. Mol. Biol. 298:195, and Hohsaka et al. (1999) J. Am. Chem. Soc. 121:12194).

[0145] In certain embodiments, tRNA is aminoacylated or can be aminoacylated by any natural amino acid. For example, tRNA may be aminoacylated by alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine and valine. In certain embodiments, tRNA can be aminoacylated by serine, leucine, glutamine or arginine. In certain embodiments, tRNA can be aminoacylated by glutamine or arginine. In certain embodiments, tRNA can be aminoacylated by arginine.

[0146] In certain embodiments, the tRNA (i) comprises an anticodon that hybridizes to a codon as shown in Table 1, and (ii) is aminoacylated or capable of being aminoacylated by an amino acid as shown in Table 1.

[0147] Table 1

[0148]

[0149]

[0150] In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence shown in Table 2. In certain embodiments, the tRNA comprises, consists essentially of, or consists of a nucleotide sequence shown in Table 2 having 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence shown in Table 2. In certain embodiments, the tRNA comprises, consists essentially of, or consists of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 19-21, 37, 39, 40, 44, 179, 181, 182, and 186, or a nucleotide sequence having 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 19-21, 37, 39, 40, 44, 179, 181, 182, and 186. It should be understood that throughout the description, in each case where a tRNA comprises, consists essentially of, or consists of a nucleotide sequence comprising one or more thymines (T), it is also contemplated that the tRNA comprises, consists essentially of, or consists of the same nucleotide sequence comprising uracil (U) replacing one or more of the thymines (T), or uracil (U) replacing all thymines (T). Similarly, in each case where a tRNA comprises, consists essentially of, or consists of a nucleotide sequence comprising one or more uracils (U), it is also contemplated that the tRNA comprises, consists essentially of, or consists of a nucleotide sequence comprising, consists essentially of, or consists of thymines (T) replacing one or more of the uracils (U), or thymines (T) replacing all uracils (U).

[0151] Table 2

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166] In certain embodiments, the tRNA comprises, consists essentially of, or consists of a nucleotide sequence shown in Table 3. In certain embodiments, the tRNA comprises, consists essentially of, or consists of a nucleotide sequence having 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a nucleotide sequence shown in Table 3. In certain embodiments, the tRNA comprises, consists essentially of, or consists of a nucleotide sequence selected from SEQ ID NOs: 6-9, 11, 16-18, 22, 35, 36, 38, 45, 178, 180, and 187, or a nucleotide sequence having 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a nucleotide sequence selected from 6-9, 11, 16-18, 22, 35, 36, 38, 45, 178, 180, and 187.

[0167] Table 3

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193]

[0194]

[0195]

[0196]

[0197]

[0198]

[0199]

[0200]

[0201]

[0202]

[0203]

[0204]

[0205]

[0206]

[0207]

[0208]

[0209]

[0210]

[0211]

[0212] In certain embodiments, the tRNA comprises, consists essentially of, or consists of a nucleotide sequence as shown in any one of Tables 8-10. In certain embodiments, the tRNA comprises, consists essentially of, or consists of a nucleotide sequence having 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to a nucleotide sequence in any one of Tables 8-10.

[0213] In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 6. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 7. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 8. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 9. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 11. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 16. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 17. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 18. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 19. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 20. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 21. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 22. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 35. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 36. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 37. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 38. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 39. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 40. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 44. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 45.In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 178. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 179. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 180. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 181. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 182. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 186. In certain embodiments, the tRNA comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 187.

[0214] In certain embodiments, the tRNA can comprise one or more mutations (e.g., nucleotide substitutions, deletions, or insertions) relative to a reference tRNA sequence (e.g., a tRNA disclosed herein). In certain embodiments, the tRNA can comprise, consist of, or consist essentially of a single mutation or a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more than 15 mutations. It is contemplated that the tRNA can comprise, consist of, or consist essentially of 1-15, 1-10, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-15, 2-10, 2-7, 2-6, 2-5, 2-4, 2-3, 3-15, 3-10, 3-7, 3-6, 3-5, or 3-4 mutations.

[0215] Sequence identity can be determined in various ways within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. BLAST (Basic Local Alignment Search Tool) analysis using the algorithm employed by programs blastp, blastn, blastx, tblastn and tblastx (Karlin et al., (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268; Altschul (1993) J. Mol. Evol. 36, 290-300; Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402) is customized for sequence similarity searches. For a discussion of basic issues in searching sequence databases, see Altschul et al. (1994) Nature Genetics 6:119-129. Those skilled in the art can determine the appropriate parameters for measuring the comparison, including any algorithm required for achieving maximum comparison on the full length of the sequence being compared. The search parameters of histogram, description, comparison, expectation (i.e., reporting the statistical significance threshold matched with the database sequence), cutoff value, matrix and filter are in default settings. The default scoring matrix used by blastp, blastx, tblastn and tblastx is the BLOSUM62 matrix (Henikoff et al., (1992) Proc. Natl. Acad. Sci. USA 89:10915-10919). Four blastn parameters can be adjusted as follows: Q=10 (gap creation penalty); R=10 (gap extension penalty); wink=1 (generate word hits at each wink.sup.th position in the query); and gapw=16 (setting the window width for generating gap comparisons). Equivalent Blastp parameter settings can be Q=9; R=2; wink =1; and gapw=32.Searches can also be performed using NCBI (National Center for Biotechnology Information) BLAST advanced option parameters (e.g.: -G, open gap cost [integer]: default = 5 for nucleotides / 11 for proteins; -E, extended gap cost [integer]: default = 2 for nucleotides / 1 for proteins; -q, penalty for nucleotide mismatch [integer]: default = -3; -r, reward for nucleotide match [integer]: default = 1; -e, expected value [real number]: default = 10; -W, wordlength [integer]: default = 11 for nucleotides / 28 for megablast / 3 for proteins; -y, decay (X) for blast expansion, in bits: default = 20 for blastn / 7 for others; -X, X decay value for gap alignments (in bits): default = 15 for all programs, not for blastn; and -Z, final X decay value for gap alignments (in bits): 50 for blastn, 25 for others). ClustalW for pairwise protein alignments can also be used (default parameters may include, e.g., a Blosum62 matrix and a gap open penalty = 10 and a gap extension penalty = 0.1). The Bestfit comparison between sequences provided in the GCG software package version 10.0 uses the DNA parameters GAP = 50 (gap creation penalty) and LEN = 3 (gap extension penalty), and the equivalent settings in the protein comparison are GAP = 8 and LEN = 2.

[0216] It is contemplated that the tRNA may comprise one or more modifications. Exemplary modified tRNAs include: acylated tRNAs; alkylated tRNAs; tRNAs containing one or more bases other than adenine, cytosine, guanine, or uracil; tRNAs covalently modified by attachment of specific ligands or antigenic, fluorescent, affinity, reactive, spectral, or other probe moieties; tRNAs containing one or more methylated or otherwise modified ribose moieties; aa-tRNAs aminoacylated with amino acids other than the 20 natural amino acids, including unnatural amino acids used as reagents, carriers of specific ligands, or as antigenic, fluorescent, reactive, affinity, spectral, or other probes; or any combination of these. Exemplary modified tRNA molecules are described in Soll et al. (1995) “tRNA: Structure, Biosynthesis, and Function,” ASM Press; El Yacoubi et al. (2012) Annu. Rev. Genet. 46:69-95; Grosjean et al. (1998) “Modification and Editing of RNA.” ASM Press; Hendrickson et al. (2004) Annu. Rev. Biochem. 73:147-176, 2004; Ibba et al. (2000) Annu. Rev. Biochem. 69:617-650; Johnson et al. (1995) Cold Spring Harbor Symp. Quant. Biol. 60:71-82; Johnson et al. (1982) J. Mol. Biol. 156:113-140; Crowley et al. (1994) Cell 78:61-71; Beier et al. (2001) NucleicAcids Res. 29:4767-4782; Torres et al. (2014) Trends Mol. Med. 20:306-314; Bjork et al. (1987) Annu. Rev. Biochem. 56:263-287; Schaffrath et al. (2017) RNA Biol. 14(9):1209-1222; and Johansson et al. (2008) Mol. Cell. Biol. 28(10):3301-12.

[0217] In certain embodiments, the tRNA comprises naturally occurring nucleotide modifications. Naturally occurring tRNAs contain a wide variety of post-transcriptionally modified nucleotides, which are described, for example, in Machnicka et al. (2014) RNA Biology 11(12): 1619-1629, and include, for example Figure 2BIn certain embodiments, the tRNA comprises one or more of the residues shown in . In certain embodiments, the tRNA comprises one or more of the residues selected from the group consisting of: 2'-O-methylguanosine or G at position 0; pseudouridine or U at position 1; 2'-O-methyladenosine, A, 2'-O-methyluridine, U, 2'-O-methylcytidine, C, 2'-O-methylguanosine, or G at position 4; N2-methylguanosine or G at position 6; N2-methylguanosine or G at position 7; 1-methyladenosine, A, 1-methylguanosine, G, or modified G at position 9; N2-methylguanosine or G at position 10; N4-acetylcytidine or C at position 12; pseudouridine, U, 2'-O-methylcytidine, or C at position 13; 1-methyladenosine, A, or modified A at position 14; dihydrouridine at position 16 (D) or U at position 17; D or U at position 17; 2'-O-methylguanosine or G at position 18; 3-(3-amino-3-carboxypropyl)uridine, D or U at position 20; 3-(3-amino-3-carboxypropyl)uridine, D, pseudouridine, U or modified U at position 20a; D, pseudouridine or U at position 20b; pseudouridine or U at position 25; pseudouridine, U, N2, N2-dimethylguanosine, N2-methylguanosine, G or modified G at position 26; pseudouridine, U, N2, N2-dimethylguanosine or G at position 27; pseudouridine or U at position 28; pseudouridine or U at position 30; pseudouridine or U at position 31; 2'-O-methylpseudouridine, 2'-O-methyluridine, pseudouridine, U, 2'-O-methylcytidine, 3-methylcytidine, C or modified C; inosine, A, 2-thiouridine, 2'-O-methyluridine, 5-(carboxyhydroxymethyl)uridine methyl ester, 5-carbamoylmethyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, pseudouridine, U, modified U, 2'-O-methylcytidine, 5-formyl-2'-O-methylcytidine, 5-methylcytidine, C, modified C, quinoline, mannosyl-quinoline, galactosyl-quinoline, 2'-O-methylguanosine or G at position 34; pseudouridine or U at position 35; pseudouridine, U or modified U at position 36; 1-methylinosine, 2-methylthio-N6-threonylaminoformyladenosine, N6-isopentenyladenosine, N6-methyl-N6-threonylaminoformyladenosine, N6-threonylaminoformyladenosine, A, modified A, 1-methylguanosine, peroxywhitinosine, whitinosine, G or modified G; pseudouridine, U, 5-methylcytidine, C or modified C at position 38; 1-methylpseudouridine, 2'-O-methylpseudouridine, 2'-O-methyluridine, pseudouridine, U, 2'-O-methylguanosine or G at position 39; pseudouridine, U, 5-methylcytidine or C at position 40; 2'-O-methyluridine, U or modified U at position 44; pseudouridine or U at position e11; pseudouridine or U at position e12;pseudouridine or U at position e14; 3-methylcytidine or C at position e2; 7-methylguanosine or G at position 46; D, U or modified U at position 47; D, U, 5-methylcytidine, C or modified C at position 48; A, modified A, 5-methylcytidine C or modified C at position 49; pseudouridine, U, 5-methylcytidine or C at position 50; 5,2'-O-dimethyluridine, 5-methyl Uridine, pseudouridine or U; pseudouridine or U at position 55; 1-methyladenosine, A or modified A at position 58; 2'-O-ribosyladenosine (phosphate), A, 2'-O-ribosylguanosine (phosphate), G or modified G at position 64; pseudouridine or U at position 65; pseudouridine, U, N2-methylguanosine or G at position 67; pseudouridine or U at position 68; and pseudouridine, U, 5-methylcytidine or C at position 72. A, C, G and U refer to unmodified adenine, cytosine, guanine and uracil, respectively. The numbering of residues is based on the tRNA numbering system described in Steinberg et al., (1993) Nucleic Acids Res. 21:3011-15. ;

[0218] In certain embodiments, the tRNA comprises one or more nucleotide modifications selected from 5-methyluridine, 5-carbamoylmethyluridine, 5-carbamoyl-methyl-2-O-methyluridine, 5-methoxy-carbonylmethyluridine, 5-methoxycarbonylmethyl-2-thiouridine, pseudouridine, dihydrouridine, 1-methyladenosine, and inosine.

[0219] II. Methods for preparing tRNA

[0220] tRNA molecules (eg, suppressor tRNAs) contemplated for use in the practice of the present invention can be produced by methods known in the art, including extracellular production by synthetic chemistry methods, intracellular production by recombinant DNA methods, or purification from natural sources.

[0221] For example, the DNA molecule encoding tRNA can be chemically synthesized or synthesized by a recombinant DNA method. For example, suitable synthetic nucleic acid primers can be used to synthesize or clone the sequence of tRNA from a library by conventional hybridization techniques or polymerase chain reaction (PCR) technology. The DNA molecule encoding tRNA obtained can be connected to other suitable nucleotide sequences, including, for example, expression control sequences to produce conventional gene expression constructs (i.e., expression vectors) encoding tRNA. The production of defined gene constructs is within the scope of routine techniques in this field. The nucleic acid encoding the desired tRNA can be incorporated (connected) into an expression vector, such as the expression vector described in the next section, and the expression vector can be introduced into a host cell by conventional transfection or transformation techniques. Exemplary host cells are Escherichia coli (E. coli) cells, Chinese hamster ovary (CHO) cells, human embryonic kidney 293 (HEK293) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., HepG2) and myeloma cells. The transformed host cell can grow under conditions that allow the host cell to express the gene encoding tRNA. Specific expression and purification conditions will vary depending upon the expression system employed.

[0222] Alternatively, the tRNA can be chemically synthesized or purified from a natural source by methods known in the art. When the tRNA is aminoacylated prior to introduction into a cell or administration to a subject, the tRNA can be aminoacylated with the desired amino acid by any method known in the art, including chemical or enzymatic aminoacylation.

[0223] III. Expression vector

[0224] The tRNA of interest can be expressed in the cell of interest by incorporating the gene encoding the tRNA of interest into a suitable expression vector. As used herein, "expression vector" refers to a vector comprising a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. The expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be provided by a host cell or in an in vitro expression system. Expression vectors include all vectors known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), reverse transposons (e.g., piggyback, sleeping beauty, and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating recombinant polynucleotides of interest.

[0225] In certain embodiments, the expression vector is a viral vector. The term "virus" as used herein refers to an obligate intracellular parasite that has no protein synthesis or energy generation machinery. Exemplary viral vectors include retroviral vectors (e.g., lentiviral vectors), adenoviral vectors, adeno-associated viral vectors, herpes virus vectors, epstein-barr virus (EBV) vectors, polyoma virus vectors (e.g., simian vacuolating virus 40 (SV40) vectors), pox virus vectors, and pseudotyped virus vectors.

[0226] The virus can be an RNA virus (having a genome consisting of RNA) or a DNA virus (having a genome consisting of DNA). In certain embodiments, the viral vector is a DNA viral vector. Exemplary DNA viruses include parvoviruses (e.g., adeno-associated viruses), adenoviruses, asfarviruses, herpes viruses (e.g., herpes simplex viruses 1 and 2 (HSV-1 and HSV-2), epstein-barr virus (EBV), cytomegalovirus (CMV)), papillomaviruses (e.g., HPV), polyomaviruses (e.g., simian vacuolating virus 40 (SV40)), and poxviruses (e.g., vaccinia virus, cowpox virus, smallpox virus, fowlpox virus, sheeppox virus, myxoma virus). In certain embodiments, the viral vector is an RNA viral vector. Exemplary RNA viruses include bunyaviruses (e.g., hantaviruses), coronaviruses, flaviviruses (e.g., yellow fever virus, West Nile virus, dengue virus), hepatitis viruses (e.g., hepatitis A virus, hepatitis C virus, hepatitis E virus), influenza viruses (e.g., influenza A virus, influenza B virus, influenza C virus), measles virus, mumps virus, norovirus (e.g., Norwalk virus), poliovirus, respiratory syncytial virus (RSV), retroviruses (e.g., human immunodeficiency virus-1 (HIV-1)), and toroviruses.

[0227] In certain embodiments, the expression vector comprises a regulatory sequence or a promoter operably linked to a nucleotide sequence encoding a tRNA. The term "operably linked" refers to the connection of a polynucleotide element in a functional relationship. When a nucleic acid sequence forms a functional relationship with another nucleic acid sequence, it is "operably linked". For example, if a promoter or enhancer affects the transcription of a gene, it is operably linked to the gene. Operably linked nucleotide sequences are generally continuous. However, since enhancers generally work when separated from promoters by several thousand bases, and intron sequences may have variable lengths, some polynucleotide elements may be operably linked but not directly flanking, and may even work in trans from different alleles or chromosomes.

[0228] The tRNA gene preferably has a strong promoter that is active in a variety of cell types. The promoter of the eukaryotic tRNA gene is usually present in the structural sequence encoding the tRNA molecule itself. Although there are elements regulating transcriptional activity in the 5' upstream region, the length of the active transcription unit may be much less than 500 base pairs.

[0229] Other exemplary promoters that can be used include, but are not limited to, retroviral LTR, SV40 promoter, human cytomegalovirus (CMV) promoter, U6 promoter, or any other promoter (e.g., cellular promoters, such as eukaryotic promoters, including but not limited to histone, pol III, and β-actin promoters). Other viral promoters that can be used include, but are not limited to, adenovirus promoters, TK promoters, and B19 parvovirus promoters. It will be apparent to those skilled in the art, based on the teachings contained herein, to select an appropriate promoter.

[0230] In certain embodiments, the expression vector comprises a tRNA coding sequence encoding a tRNA comprising, consisting essentially of, or consisting of a nucleotide sequence shown in Table 2 or Table 3. In certain embodiments, the expression vector comprises a tRNA coding sequence encoding a tRNA comprising, consisting essentially of, or consisting of a nucleotide sequence shown in Table 2 or Table 3 having 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the nucleotide sequence shown in Table 2 or Table 3.

[0231] In certain embodiments, in addition to the tRNA coding sequence, the expression vector further comprises a nucleotide sequence corresponding to the genomic DNA sequence flanking the wild-type tRNA gene (i.e., a DNA sequence from the same genome as the wild-type tRNA gene, and which is 5' or 3' of the wild-type tRNA gene in the genome, e.g., immediately adjacent to 5' or 3' of the wild-type tRNA gene in the genome). In certain embodiments, in addition to the tRNA coding sequence, the expression vector further comprises a nucleotide sequence corresponding to an exogenous promoter.

[0232] In certain embodiments, the expression vector comprises the nucleotide sequence shown in Table 4. In certain embodiments, the expression vector comprises a nucleotide sequence having 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the nucleotide sequence shown in Table 4. In certain embodiments, in the expression vector, the nucleotide sequence listed in Table 4 is operably linked to the nucleotide sequence encoding the tRNA. In certain embodiments, in the expression vector, the nucleotide sequence listed in Table 4 is located 5' or 3' (e.g., immediately 5' or immediately 3) of the nucleotide sequence encoding the tRNA. In certain embodiments, the expression vector comprises a nucleotide sequence selected from SEQ ID NOs: 869-888, or a nucleotide sequence having 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to a sequence selected from SEQ ID NOs: 869-888.

[0233] In certain embodiments, the expression vector is an expression vector described in Example 8 or Example 9 herein.

[0234] Table 4

[0235]

[0236]

[0237]

[0238]

[0239] Adeno-associated virus (AAV) vector

[0240] In certain embodiments, the expression vector is an adeno-associated virus (AAV) vector. AAV is a small, non-enveloped icosahedral virus belonging to the genus Dependiovirus and the family Parvoviridae. AAV has a single-stranded linear DNA genome of approximately 4.7 kb. AAV is able to infect dividing and resting cells of several tissue types, and different AAV serotypes exhibit different tissue tropisms.

[0241] AAV includes many serologically distinguishable types, including serotypes AAV-1 to AAV-12, and more than 100 serotypes from non-human primates (see, e.g., Srivastava (2008) J. Cell Biochem., 105(1):17–24, and Gao et al. (2004) J. Virol., 78(12), 6381–6388). The serotype of the AAV vector used in the present invention can be selected by those skilled in the art based on delivery efficiency, tissue tropism, and immunogenicity. For example, AAV-1, AAV-2, AAV-4, AAV-5, AAV-8, AAV-9 can be used for delivery to the central nervous system; AAV-1, AAV-8, AAV-9 can be used for delivery to the heart; AAV-2 can be used for delivery to the kidneys; AAV-7, AAV-8, and AAV-9 can be used for delivery to the liver; AAV-4, AAV-5, AAV-6, AAV-9 can be used for delivery to the lungs, AAV-8 can be used for delivery to the pancreas, AAV-2, AAV-5, and AAV-8 can be used for delivery to photoreceptor cells; AAV-1, AAV-2, AAV-4, AAV-5, and AAV-8 can be used for delivery to the retinal pigment epithelium; AAV-1, AAV-6, AAV-7, AAV-8, and AAV-9 can be used for delivery to skeletal muscle. In certain embodiments, the AAV capsid protein comprises a sequence as disclosed in U.S. Pat. No. 7,198,951, such as, but not limited to, AAV-9 (SEQ ID NOs: 1-3 of U.S. Pat. No. 7,198,951), AAV-2 (SEQ ID NOs: 4 of U.S. Pat. No. 7,198,951), AAV-1 (SEQ ID NOs: 5 of U.S. Pat. No. 7,198,951), AAV-3 (SEQ ID NOs: 6 of U.S. Pat. No. 7,198,951), and AAV-8 (SEQ ID NOs: 7 of U.S. Pat. No. 7,198,951). AAV serotypes identified from rhesus monkeys, such as rh.8, rh.10, rh.39, rh.43, and rh.74, are also encompassed in the present invention. In addition to natural AAV serotypes, modified AAV capsids have also been developed for improved delivery efficiency, tissue tropism, and immunogenicity. Exemplary native and modified AAV capsids are disclosed in U.S. Pat. Nos. 7,906,111, 9,493,788, and 7,198,951, and PCT Publication No. WO2017189964A2.

[0242] The wild-type AAV genome contains two 145-nucleotide inverted terminal repeats (ITRs) that contain signal sequences that direct AAV replication, genome encapsidation, and integration. In addition to the ITRs, the three AAV promoters p5, p19, and p40 drive the expression of two open reading frames encoding the rep and cap genes. The two rep promoters, plus the differential splicing of a single AAV intron, result in the production of four rep proteins (Rep78, Rep68, Rep52, and Rep40) from the rep gene. The Rep protein is responsible for genome replication. The Cap gene is expressed by the p40 promoter and encodes three capsid proteins (VP1, VP2, and VP3), which are splice variants of the cap gene. These proteins form the capsid of the AAV particles.

[0243] Because the cis-acting signals for replication, encapsidation, and integration are contained in the ITRs, some or all of the 4.3 kb internal genome can be replaced by exogenous DNA, for example, an expression cassette for an exogenous gene of interest. Therefore, in certain embodiments, the AAV vector comprises a genome comprising an expression cassette for an exogenous gene, flanked by 5' ITRs and 3' ITRs. The ITRs may be derived from the same serotype as the capsid or its derivatives. Alternatively, the ITRs may have a different serotype than the capsid, thereby generating a pseudotyped AAV. In certain embodiments, the ITRs are derived from AAV-2. In certain embodiments, the ITRs are derived from AAV-5. At least one ITR can be modified to mutate or delete a terminal resolution site, thereby allowing the generation of a self-complementary AAV vector.

[0244] The rep and cap proteins can be provided in trans, for example, on a plasmid, to produce an AAV vector. A host cell line that allows AAV replication must express the rep and cap genes, the ITR flanking expression cassette, and the helper functions provided by the helper virus, such as the adenoviral genes E1a, E1b55K, E2a, E4orf6, and VA (Weitzman et al., Adeno-associated virus biology. Adeno-Associated Virus: Methods and Protocols, pp. 1–23, 2011). Methods for generating and purifying AAV vectors have been described in detail (see, for example, Mueller et al., (2012) Current Protocols in Microbiology, 14D.1.1-14D.1.21, Production and Discovery of Novel Recombinant Adeno-Associated Viral Vectors). Many cell types are suitable for producing AAV vectors, including HEK293 cells, COS cells, HeLa cells, BHK cells, Vero cells, and insect cells (see, e.g., U.S. Pat. Nos. 6,156,303, 5,387,484, 5,741,683, 5,691,176, 5,688,676, and 8,163,543, U.S. Pat. Publication No. 20020081721, and PCT Publication Nos. WO00 / 47757, WO00 / 24916, and WO96 / 17947). AAV vectors are typically produced in these cell types from a plasmid containing an expression cassette flanked by ITRs and one or more additional plasmids that provide additional AAV and helper virus genes.

[0245] AAV of any serotype may be used in the present invention. Similarly, it is contemplated that any adenovirus type may be used, and one skilled in the art will be able to identify AAV and adenovirus types suitable for producing their desired recombinant AAV vector (rAAV). AAV particles may be purified, for example, by affinity chromatography, iodixanol gradients, or CsCl gradients.

[0246] The AAV vector can have a single-stranded genome of 4.7 kb in size or larger or smaller than 4.7 kb, including super-large genomes as large as 5.2 kb or as small as 3.0 kb. Therefore, in the case where the exogenous gene of interest to be expressed from the AAV vector is very small, the AAV genome can include a stuffer sequence. In addition, the vector genome can be substantially self-complementary, allowing rapid expression in cells. In certain embodiments, the genome of the self-complementary AAV vector comprises from 5' to 3': 5' ITR; a first nucleic acid sequence comprising a promoter and / or enhancer operably linked to the coding sequence of the gene of interest; a modified ITR that does not have a functional terminal dissociation site; a second nucleic acid sequence that is complementary or substantially complementary to the first nucleic acid sequence; and a 3' ITR. AAV vectors containing all types of genomes are suitable for the methods of the present invention.

[0247] Non-limiting examples of AAV vectors include pAAV-MCS (Agilent Technologies), pAAVK-EF1α-MCS (System Bio Catalog No. AAV502A-1), pAAVK-EF1α-MCS1-CMV-MCS2 (System Bio Catalog No. AAV503A-1), pAAV-ZsGreen1 (Clontech Catalog No. 6231), pAAV-MCS2 (Addgene plasmid #46954), AAV-Stuffer (Addgene plasmid #106248), pAAVscCBPIGpluc (Addgene plasmid #35645), AAVS1_Puro_PGK1_3xFLAG_Twin_Strep (Addgene plasmid #68375), pAAV-RAM-d2TTA::TRE-MCS-WPRE-pA (Addgene plasmid #63931), pAAV-UbC (Addgene plasmid #62806), pAAVS1-P-MCS (Addgene plasmid #80488), pAAV-Gateway (Addgene plasmid #32671), pAAV-Puro_siKD (Addgene plasmid #86695), pAAVS1-Nst-MCS (Addgene plasmid #80487), pAAVS1-Nst-CAG-DEST (Addgene plasmid #80489), pAAVS1-P-CAG-DEST (Addgene plasmid #80490), pAAVf-EnhCB-lacZnls (Addgene plasmid #35642), and pAAVS1-shRNA (Addgene plasmid #82697). These vectors can be modified for therapeutic use. For example, an exogenous gene of interest can be inserted into a multiple cloning site, and a selection marker (e.g., puro or a gene encoding a fluorescent protein) can be deleted or replaced by another (same or different) exogenous gene of interest. Other examples of AAV vectors are disclosed in U.S. Patent Nos. 5,871,982, 6,270,996, 7,238,526, 6,943,019, 6,953,690, 9,150,882, and 8,298,818, U.S. Patent Publication No. 2009 / 0087413, and PCT Publication Nos. WO2017075335A1, WO2017075338A2, and WO2017201258A1.

[0248] In certain embodiments, the expression vector is an AAV vector capable of targeting the nervous system, such as the central nervous system, of a subject, such as a human subject. Exemplary AAV vectors that can target the nervous system include AAV9 variants AAV-PHP.B (see, e.g., Deverman et al. (2016) Nat. Biotechnol. 34(2):204–209), AAV-AS (see, e.g., Choudhury et al. (2016) Mol. Ther. 24:726–35) and AAV-PHP.eB (see, e.g., Chan et al. (2017) Nat. Neurosci. 20:1172–79). Other exemplary AAV-based strategies for targeting the nervous system are described in Bedrook et al. (2018) Annu Rev Neurosci. 41:323-348. In certain embodiments, the AAV vector is an AAV-PHP.eB vector.

[0249] Lentiviral vectors

[0250] In certain embodiments, the viral vector can be a retroviral vector. Examples of retroviral vectors include Moloney murine leukemia virus vectors, spleen necrosis virus vectors, and vectors derived from retroviruses such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus. Retroviral vectors can be used as agents that mediate retroviral-mediated gene transfer into eukaryotic cells.

[0251] In certain embodiments, the retroviral vector is a lentiviral vector. Exemplary lentiviral vectors include viruses derived from human immunodeficiency virus-1 (HIV-1), human immunodeficiency virus-2 (HIV-2), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Jembrana disease virus (JDV), equine infectious anemia virus (EIAV), and caprine arthritis encephalitis virus (CAEV).

[0252] Retroviral vectors are usually constructed so that most of the sequences encoding viral structural genes are deleted and replaced by one or more genes of interest. Typically, structural genes (i.e., gag, pol, and env) are removed from the retroviral backbone using genetic engineering techniques known in the art. Therefore, the minimal retroviral vector contains from 5' to 3': 5' long terminal repeat (LTR), packaging signal, optional exogenous promoter and / or enhancer, exogenous gene of interest, and 3' LTR. If no exogenous promoter is provided, gene expression is driven by 5' LTR, which is a weak promoter and requires the presence of Tat to activate expression. Structural genes can be provided in separate multiple vectors used to make lentiviruses, thereby making the resulting virions replication defective. Specifically, for lentiviruses, the packaging system can include a single packaging vector encoding Gag, Pol, Rev, and Tat genes, and a third separate vector encoding the envelope protein Env (usually VSV-G because it has a wide range of infectivity). In order to improve the safety of the packaging system, the packaging vector can be split, with Rev expressed from one vector and Gag and Pol expressed from another vector. Tat can also be eliminated from the packaging system by using a retroviral vector containing a chimeric 5' LTR in which the U3 region of the 5' LTR is replaced by a heterologous regulatory element.

[0253] Genes can be incorporated into the proviral backbone in several general ways. The most straightforward construction is to replace the structural genes of the retrovirus with a single gene transcribed under the control of viral regulatory sequences within the LTR. Retroviral vectors have also been constructed that can introduce more than one gene into a target cell. Typically, in such vectors, one gene is under the regulatory control of the viral LTR, while the second gene is expressed either through splicing information or under the regulation of its own internal promoter.

[0254] Therefore, the new gene is flanked by 5' and 3' LTRs, which are used to promote transcription and polyadenylation of virion RNA, respectively. The term "long terminal repeat" or "LTR" refers to the domain of base pairs located at the end of retroviral DNA, which are directly repeated and contain U3, R and U5 regions in its native sequence context. LTR generally provides basic functions for the expression (e.g., promotion, initiation and polyadenylation of gene transcripts) and viral replication of retroviral genes. LTR contains many regulatory signals, including transcription control elements, polyadenylation signals and sequences required for viral genome replication and integration. The U3 region contains enhancers and promoter elements. The U5 region is a sequence between the primer binding site and the R region and contains a polyadenylation sequence. The R (repeat) region is flanked by U3 and U5 regions. In certain embodiments, the R region contains a transactivation response (TAR) genetic element, which interacts with a transactivator (tat) genetic element to enhance viral replication. This element is not required in embodiments in which the U3 region of the 5' LTR is replaced with a heterologous promoter.

[0255] In certain embodiments, the retroviral vector comprises a modified 5' LTR and / or 3' LTR. The modification of 3' LTR generally improves the safety of the lentiviral or retroviral system by making the virus replication defective. In a specific embodiment, the retroviral vector is a self-inactivating (SIN) vector. As used herein, a SIN retroviral vector refers to a replication-defective retroviral vector, in which the 3' LTR U3 region has been modified (e.g., by deletion or substitution) to prevent viral transcription from exceeding the first round of viral replication. This is because the 3' LTR U3 region is used as a template for the 5' LTR U3 region during viral replication, and therefore, in the absence of a U3 enhancer-promoter, viral transcripts cannot be prepared. In a further embodiment, the 3' LTR is modified so that the U5 region is replaced, for example, replaced by an ideal polyadenylation sequence. It should be noted that modifications to LTR, such as modifications to 3' LTR, 5' LTR, or both 3' and 5' LTR, are also considered useful in the practice of the present invention.

[0256] In certain embodiments, the U3 region of the 5' LTR is replaced with a heterologous promoter to drive transcription of the viral genome during viral particle production. Examples of heterologous promoters that can be used include, for example, simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (CMV) (e.g., immediate early), Moloney murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus (HSV) (thymidine kinase) promoters. Typical promoters are able to drive high levels of transcription in a Tat-independent manner. This replacement reduces the likelihood of recombination to generate replication-competent virus because there is no intact U3 sequence in the viral production system.

[0257] Adjacent to the 5' LTR are sequences necessary for reverse transcription of the genome (tRNA primer binding site) and sequences necessary for efficient packaging of viral RNA into particles (Psi site). As used herein, the term "packaging signal" or "packaging sequence" refers to a sequence located within the retroviral genome that is necessary for the encapsidation of the retroviral RNA chain during viral particle formation (see, e.g., Clever et al., 1995 J. Virology, 69(4): 2101-09). The packaging signal can be the minimum packaging signal (also referred to as the psi [Ψ] sequence) required for the encapsidation of the viral genome.

[0258] In certain embodiments, the retroviral vector (e.g., a lentiviral vector) further comprises FLAP. As used herein, the term "FLAP" refers to a nucleic acid whose sequence includes a central polypurine tract and a central termination sequence (cPPT and CTS) of a retrovirus such as HIV-1 or HIV-2. Suitable FLAP elements are described in U.S. Patent No. 6,682,907 and Zennou et al. (2000) Cell, 101:173. During reverse transcription, the central initiation of positive-strand DNA at the center of the cPPT and the central termination of the CTS leads to the formation of a three-stranded DNA structure: a central DNA flap. Although not wishing to be bound by any theory, the DNA flap may serve as a cis-active determinant of nuclear import of the lentiviral genome and / or may increase the titer of the virus. In a specific embodiment, the retroviral vector backbone comprises one or more FLAP elements upstream or downstream of a heterologous gene of interest in the vector. For example, in a specific embodiment, the transfer plasmid comprises a FLAP element. In one embodiment, the vector of the present invention comprises a FLAP element isolated from HIV-1.

[0259] In certain embodiments, the retroviral vector (e.g., a lentiviral vector) further comprises an export element. In one embodiment, the retroviral vector comprises one or more export elements. The term "export element" refers to a cis-transcriptional post-regulatory element that regulates RNA transcripts from the nucleus to the cytoplasm. Examples of RNA export elements include, but are not limited to, human immunodeficiency virus (HIV) RRE (see, e.g., Cullen et al., (1991) J. Virol. 65: 1053; and Cullen et al., (1991) Cell 58: 423) and hepatitis B virus post-transcriptional regulatory element (HPRE). Typically, the RNA export element is placed in the 3'UTR of a gene and can be inserted as one or more copies.

[0260] In certain embodiments, the retroviral vector (e.g., a lentiviral vector) further comprises a post-transcriptional regulatory element. A variety of post-transcriptional regulatory elements can increase the expression of heterologous nucleic acids, such as the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE; see Zufferey et al., (1999) J. Virol., 73: 2886); the post-transcriptional regulatory element present in the hepatitis B virus (HPRE) (Huang et al., Mol. Cell. Biol., 5: 3864); etc. (Liu et al., (1995), Genes Dev., 9: 1766). The post-transcriptional regulatory element is usually located at the 3' end of the heterologous nucleic acid sequence. This configuration leads to the synthesis of mRNA transcripts, the 5' portion of which comprises the heterologous nucleic acid coding sequence and the 3' portion of which comprises the post-transcriptional regulatory element sequence. In certain embodiments, the vector of the present invention lacks or does not comprise a post-transcriptional regulatory element such as WPRE or HPRE, because in some cases, these elements increase the risk of cell transformation and / or do not substantially or significantly increase the amount of mRNA transcripts or increase mRNA stability. Thus, in certain embodiments, the vectors of the invention lack or do not include a WPRE or HPRE as an additional safety measure.

[0261] The elements that guide the efficient termination and polyadenylation of heterologous nucleic acid transcripts increase heterologous gene expression. Transcription termination signals are usually found downstream of polyadenylation signals. Therefore, in certain embodiments, retroviral vectors (e.g., lentiviral vectors) further comprise polyadenylation signals. As used herein, the term "polyadenylation signal" or "polyadenylation sequence" refers to a DNA sequence that guides RNA polymerase H to terminate and polyadenylate both nascent RNA transcripts. Efficient polyadenylation of recombinant transcripts is desirable because transcripts lacking polyadenylation signals are unstable and rapidly degraded. Illustrative examples of polyadenylation signals that can be used for the carriers of the present invention include ideal polyadenylation sequences (e.g., AATAAA, ATTAAA AGTAAA), bovine growth hormone polyadenylation sequences (BGHpA), rabbit β-globin polyadenylation sequences (rβgpA), or other suitable heterologous or endogenous polyadenylation sequences known in the art.

[0262] In certain embodiments, the retroviral vector further comprises an insulator element. The insulator element may help protect the sequence (e.g., therapeutic gene) expressed by the retrovirus from the impact of the integration site effect, which may be mediated by the cis-acting elements present in the genomic DNA and cause the expression of the transfer sequence to be dysregulated (i.e., position effect; see, e.g., Burgess-Beusse et al., (2002) Proc. Natl. Acad. Sci., USA, 99:16433; and Zhan et al., 2001, Hum. Genet., 109:471). In certain embodiments, the retroviral vector comprises an insulator element in one or two LTRs or elsewhere in the vector region that is integrated into the cell genome. Insulators suitable for use in the present invention include, but are not limited to, chicken β-globin insulators (see Chung et al., (1993). Cell 74:505; Chung et al., (1997) Proc. Natl. Acad. Sci., USA 94:575; and Bell et al., 1999. Cell 98:387). Examples of insulator elements include, but are not limited to, insulators from the β-globin locus, such as chicken HS4.

[0263] Non-limiting examples of lentiviral vectors include pLVX-EF1alpha-AcGFP1-C1 (Clontech Catalog No. 631984), pLVX-EF1alpha-IRES-mCherry (Clontech Catalog No. 631987), pLVX-Puro (Clontech Catalog No. 632159), pLVX-IRES-Puro (Clontech Catalog No. 632186), pLenti6 / V5-DEST TM (Thermo Fisher), pLenti6.2 / V5-DEST TM(Thermo Fisher), pLKO.1 (Addgene's plasmid #10878), pLKO.3G (Addgene's plasmid #14748), pSico (Addgene's plasmid #11578), pLJM1-EGFP (Addgene's plasmid #19319), FUGW (Addgene's plasmid #14883), pLVTHM (Addgene's plasmid #12247), pLVUT-tTR-KRAB (Addgene's plasmid #11651), pLL3.7 (Addgene's plasmid #11795), pLB (Addgene's plasmid #11619), pWPXL (Addgene's plasmid #12257), pWPI (Addgene's plasmid #12254), EF.CMV.RFP (Addgene's plasmid #17619), pLenti CMV Puro DEST (Addgene's plasmid #17452), pLenti-puro (Addgene's plasmid #39481), pULTRA (Addgene's plasmid #24129), pLX301 (Addgene's plasmid #25895), pHIV-EGFP (Addgene's plasmid #21373), pLV-mCherry (Addgene's plasmid #36084), pLionII (Addgene's plasmid #1730), pInducer10-mir-RUP-PheS (Addgene's plasmid #44011). These vectors can be modified to be suitable for therapeutic use. For example, the selection marker (e.g., puro, EGFP, or mCherry) can be deleted or replaced with a second exogenous gene of interest. Other examples of lentiviral vectors are disclosed in U.S. Pat. Nos. 7,629,153, 7,198,950, 8,329,462, 6,863,884, 6,682,907, 7,745,179, 7,250,299, 5,994,136, 6,287,814, 6,013,516, 6,797,512, 6,544,771, 5,834,256, 6,958,226, 6,207,455, 6,531,123, and 6,352,694, and PCT Publication No. WO 2017 / 091786.

[0264] Adenoviral vector

[0265] In certain embodiments, the viral vector can be an adenoviral vector. Adenovirus is a medium-sized (90-100nm), non-enveloped (naked) icosahedral virus consisting of a nucleocapsid and a double-stranded linear DNA genome. The term "adenovirus" refers to any virus in the genus Adenovirus, including but not limited to human, bovine, ovine, equine, canine, porcine, mouse and simian adenovirus subgenus. Typically, an adenoviral vector is generated by introducing one or more mutations (e.g., deletions, insertions or substitutions) into the adenoviral genome of an adenovirus to accommodate the insertion of non-natural nucleic acid sequences, e.g., for gene transfer to an adenovirus.

[0266] Human adenovirus can be used as a source of adenoviral genome for an adenoviral vector. For example, the adenovirus can be subgroup A (e.g., serotypes 12, 18, and 31), subgroup B (e.g., serotypes 3, 7, 1, 1, 14, 16, 21, 34, 35, and 50), subgroup C (e.g., serotypes 1, 2, 5, and 6), subgroup D (e.g., serotypes 8, 9, 10, 13, 15, 17, 19, 20, 22-30, 32, 33, 36-39, and 42-48), subgroup E (e.g., serotype 4), subgroup F (e.g., serotypes 40 and 41), unclassified serotypes (e.g., serotypes 49 and 51), or any other adenoviral serogroup or serotype. Adenoviral serotypes 1 to 51 can be obtained from the American Type Culture Collection (ATCC, Manassas, Virginia). Non-Group C adenoviral vectors, methods of producing non-Group C adenoviral vectors, and methods of using non-Group C adenoviral vectors are disclosed, for example, in U.S. Patent Nos. 5,801,030, 5,837,511, and 5,849,561 and PCT Publication Nos. WO 1997 / 012986 and WO 1998 / 053087.

[0267] A non-human adenovirus (e.g., a simian, monkey, avian, canine, ovine, or bovine adenovirus) can be used to generate an adenoviral vector (i.e., as a source of an adenoviral genome for an adenoviral vector). For example, an adenoviral vector can be based on a simian adenovirus, including New World and Old World monkeys (see, e.g., Virus Taxonomy: VHIth Report of the International Committee on Taxonomy of Viruses (2005)). Phylogenetic analysis of adenoviruses that infect primates is disclosed, e.g., in Roy et al. (2009) PLoS Pathog. 5(7):e1000503. Gorilla adenovirus can be used as a source of an adenoviral genome for an adenoviral vector. Gorilla adenoviruses and adenoviral vectors are described, e.g., in PCT Publication Nos. WO2013 / 052799, WO2013 / 052811, and WO2013 / 052832. Adenoviral vectors can also contain a combination of subtypes, thereby being a "chimeric" adenoviral vector.

[0268] Adenoviral vectors can be replication competent, conditionally replication competent, or replication defective. Replication competent adenoviral vectors can replicate in typical host cells, i.e., cells that are normally capable of being infected by adenovirus. Conditionally replication competent adenoviral vectors are adenoviral vectors that have been engineered to replicate under predetermined conditions. For example, gene functions essential for replication, such as those encoded by an adenoviral early region, can be operably linked to an inducible, repressible, or tissue-specific transcriptional control sequence, such as a promoter. Conditionally replicating adenoviral vectors are further described in U.S. Patent No. 5,998,205. A replication defective adenoviral vector is an adenoviral vector that requires the complement of one or more gene functions or regions of the adenoviral genome required for replication, which is due to, for example, a defect in one or more gene functions or regions essential for replication, so that the adenoviral vector does not replicate in typical host cells, especially those cells in the human body infected by the adenoviral vector.

[0269] Preferably, the adenoviral vector is replication-defective, such that the replication-defective adenoviral vector requires complementation of at least one replication-essential gene function of one or more regions of the adenoviral genome for propagation (e.g., to form adenoviral vector particles). The adenoviral vector can be defective in one or more replication-essential gene functions of only the early region of the adenoviral genome (i.e., the E1-E4 region), only the late region of the adenoviral genome (i.e., the L1-L5 region), both the early and late regions of the adenoviral genome, or all adenoviral genes (i.e., high-capacity adeno vector (HC-Ad)). See, e.g., Morsy et al. (1998) Proc. Natl. Acad. Sci. USA 95: 965-976, Chen et al. (1997) Proc. Natl. Acad. Sci. USA 94: 1645-1650, and Kochanek et al. (1999) Hum. Gene Ther. 10(15):2451-9. Examples of replication-defective adenoviral vectors are disclosed in U.S. Pat. Nos. 5,837,511, 5,851,806, 5,994,106, 6,127,175, 6,482,616, and 7,195,896, and PCT Publication Nos. WO 1994 / 028152, WO 1995 / 002697, WO 1995 / 016772, WO 1995 / 034671, WO 1996 / 022378, WO 1997 / 012986, WO 1997 / 021826, and WO 2003 / 022311.

[0270] The replication-deficient adenoviral vectors of the present invention can be produced in a complementing cell line that provides gene functions that are not present in the replication-deficient adenoviral vector but are required for viral propagation at appropriate levels to produce high titer viral vector stocks. Such complementing cell lines are known and include, but are not limited to, 293 cells (described, e.g., Graham et al. (1977) J. Gen. Virol. 36: 59-72), PER.C6 cells (described, e.g., PCT Publication No. WO1997 / 000326 and U.S. Pat. Nos. 5,994,128 and 6,033,908), and 293-ORF6 cells (described, e.g., PCT Publication No. WO1995 / 034671 and Brough et al. (1997) J. Virol. 71: 9206-9213). Other suitable complementing cell lines for producing replication-deficient adenoviral vectors of the invention include complementing cells that have been generated to propagate adenoviral vectors encoding a transgene whose expression inhibits viral growth in host cells (see, e.g., U.S. Patent Publication No. 2008 / 0233650). Other suitable complementing cells are described, e.g., in U.S. Patent Nos. 6,677,156 and 6,682,929 and PCT Publication No. WO2003 / 020879. Formulations of compositions containing adenoviral vectors are further described, e.g., in U.S. Patent Nos. 6,225,289 and 6,514,943 and PCT Publication No. WO2000 / 034444.

[0271] Additional exemplary adenoviral vectors and / or methods for making or propagating adenoviral vectors are described in U.S. Pat. Nos. 5,559,099; 5,837,511; 5,846,782; 5,851,806; 5,994,106; 5,994,128; 5,965,541; 5,981,225;

[0272] Commercially available adenoviral vector systems include the ViraPower™ Adenoviral Expression System available from Thermo Fisher Scientific, the AdEasy™ Adenoviral Vector System available from Agilent Technologies, and the Adeno-X™ Expression System available from Takara Bio USA, Inc. 3.

[0273] Viral vector production

[0274] Methods for producing viral vectors are known in the art. Typically, conventional techniques are used to produce the virus of interest in a suitable host cell line, including culturing transfected or infected host cells under suitable conditions to allow production of infectious viral particles. Nucleic acids encoding viral genes and / or tRNA can be incorporated into plasmids and introduced into host cells by conventional transfection or transformation techniques. Exemplary suitable host cells for producing the disclosed viruses include human cell lines, such as HeLa, Hela-S3, HEK293, 911, A549, HER96 or PER-C6 cells. Specific production and purification conditions will vary depending on the virus and the production system employed.

[0275] In certain embodiments, the production cells can be administered directly to a subject, however, in other embodiments, after production, infectious viral particles are recovered from the culture and optionally purified. Typical purification steps may include plaque purification, centrifugation such as cesium chloride gradient centrifugation, clarification, enzyme treatment such as benzonase or protease treatment, chromatography steps such as ion exchange chromatography or filtration steps.

[0276] IV. Pharmaceutical Compositions

[0277] For therapeutic use, tRNA and / or expression vectors are preferably combined with a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable" refers to those compounds, materials, compositions and / or dosage forms that are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic response or other problems or complications within the scope of sound medical judgment, with a reasonable benefit / risk ratio.

[0278] As used herein, the term "pharmaceutically acceptable carrier" refers to buffers, carriers and excipients suitable for contact with human and animal tissues without excessive toxicity, irritation, allergic reactions or other problems or complications, with a reasonable benefit / risk ratio. Pharmaceutically acceptable carriers include any standard pharmaceutical carriers, such as phosphate buffered saline solutions, water, emulsions (e.g., such as oil / water or water / oil emulsions) and various types of wetting agents. The composition may also include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see, for example, Martin, Remington's Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, PA

[1975] . Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coating agents, isotonic agents and absorption delaying agents, etc. that are compatible with drug administration. The use of such media and medicaments for pharmaceutically active substances is known in the art.

[0279] In certain embodiments, pharmaceutical compositions may contain formulation materials used to alter, maintain or preserve, for example, the pH, osmotic pressure, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, adsorption or penetration of the composition. In such embodiments, suitable formulation materials include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine, or lysine); antimicrobial agents; antioxidants (such as ascorbic acid, sodium sulfite, or sodium bisulfite); buffers (such as borates, bicarbonates, Tris-HCl, citrates, phosphates, or other organic acids); bulking agents (such as mannitol or glycine); chelating agents (such as ethylenediaminetetraacetic acid (EDTA)); complexing agents (such as caffeine, polyvinylpyrrolidone, β-cyclodextrin, or hydroxypropyl-β-cyclodextrin); bulking agents; monosaccharides; disaccharides; and other carbohydrates (such as glucose, mannose, or dextrin); proteins (such as serum albumin, gelatin, or immunoglobulins); colorants, flavorings, and diluents; emulsifiers; hydrophilic polymers (such as polyvinylpyrrolidone); low molecular weight polypeptides; salt-forming reactions; ions (such as sodium); preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenylethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide); solvents (such as glycerol, propylene glycol or polyethylene glycol); sugar alcohols (such as mannitol or sorbitol); suspending agents; surfactants or wetting agents (such as pluronics, PEG, sorbitan esters, polysorbates such as polysorbate 20, polysorbate, triton, tromethamine, lecithin, cholesterol, tyloxapal); stability enhancers (such as sucrose or sorbitol); tonicity enhancers (such as alkali metal halides, preferably sodium chloride or potassium chloride, mannitol sorbitol); delivery vehicles; diluents; excipients and / or pharmaceutical adjuvants (see Remington's Pharmaceutical Sciences, 18th ed. (Mack Publishing Company, 1990).

[0280] In certain embodiments, the pharmaceutical composition may include nanoparticles, such as polymer nanoparticles, liposomes or micelles (see Anselmo et al. (2016) Bioeng. Transl. Med. 1: 10-29). In certain embodiments, the composition does not include (or is substantially free of, for example, the composition includes less than 5%, 4%, 3%, 2%, 1%, 0.5% or 0.1%) nanoparticles or amino lipid delivery compounds, for example, as described in U.S. Patent Publication No. 2017 / 0354672. In certain embodiments, the tRNA or expression vector introduced into the cell or applied to the subject is not conjugated or associated with another part, such as a carrier particle, such as an amino lipid particle. As used herein, the term "conjugated", when used for two or more parts, refers to these parts directly or via one or more additional parts acting as a linker, physically associated or connected to each other, to form a sufficiently stable structure so that these parts remain physically associated under the conditions of the use structure, such as physiological conditions. Typically, these parts are attached by one or more covalent bonds or by a mechanism involving specific binding. Alternatively, a sufficient number of weaker interactions may provide sufficient stability for the moieties to remain physically associated.

[0281] In certain embodiments, pharmaceutical composition can comprise continuous or controlled delivery preparation.Be used for preparing continuous or controlled delivery mode, such as the technology of liposome carrier, bioerodible microparticle or porous beads and reservoir injection, also be known to those skilled in the art.Sustained release preparation can comprise semipermeable polymer matrix of porous polymer microparticle or molded article form, such as film or microcapsule.Sustained release matrix can comprise copolymer of polyester, hydrogel, polylactide, L-glutamic acid and L-glutamic acid-γ-ethyl ester, poly-(methacrylic acid-2-hydroxyethyl ester), ethylene vinyl acetate or poly-D (-)-3-hydroxybutyric acid.Sustained release composition can also comprise liposome that can be prepared by any one of several methods known in the art.

[0282] Pharmaceutical compositions containing tRNA and / or expression vectors disclosed herein can be present in dosage unit form and can be prepared by any suitable method. Pharmaceutical compositions should be formulated to be compatible with their intended route of administration. Examples of routes of administration are intravenous (IV), intradermal, inhaled, transdermal, topical, transmucosal, intrathecal, and rectal administration. In certain embodiments, tRNA and / or expression vectors are administered intrathecally. In certain embodiments, tRNA and / or expression vectors are administered by injection. Useful preparations can be prepared by methods known in the pharmaceutical field. For example, see Remington's Pharmaceutical Sciences, 18th ed. (Mack Publishing Company, 1990). Suitable formulation components for parenteral administration include sterile diluents, such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerol, propylene glycol or other synthetic solvents; antibacterial agents, such as benzyl alcohol or methyl parabens; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as EDTA; buffers, such as acetates, citrates or phosphates; and agents for adjusting tonicity, such as sodium chloride or glucose.

[0283] For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). The carrier should be stable under the conditions of manufacture and storage, and should be preserved against microorganisms. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, a polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof.

[0284] In general, any method of delivering nucleic acid molecules can be suitable for use with tRNA (see, e.g., Akhtar et al. (1992) Trends Cell. Biol. 2(5): 139-144 and PCT Publication No. WO94 / 02595). tRNA can be modified or alternatively delivered using a drug delivery system to prevent tRNA from being rapidly degraded by endonucleases and exonucleases in vivo. tRNA molecules can be modified by chemical conjugation with lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. tRNA molecules can also be conjugated or otherwise associated with aptamers. tRNA can also be delivered using drug delivery systems such as nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems. Positively charged cationic delivery systems promote the binding of tRNA molecules (negatively charged) and enhance interactions on negatively charged cell membranes to allow cells to efficiently uptake tRNA. Cationic lipids, dendrimers or polymers can bind to RNA, such as tRNA, or be induced to form vesicles or micelles that encapsulate RNA (see, e.g., Kim et al. (2008) Journal of Controlled Release 129(2):107-116). Methods for preparing and administering cation-RNA complexes are well within the capabilities of those skilled in the art (see, e.g., Sorensen et al. (2003) J. Mol. Biol 327:761-766; Verma et al. (2003) Clin. Cancer Res. 9:1291-1300; Arnold et al. (2007) J. Hypertens. 25:197-205).Some non-limiting examples of drug delivery systems that can be used to deliver RNA, such as tRNA, systemically include DOTAP (Sorensen et al. (2003) supra; Verma et al. (2003) supra), Oligofectamine, solid nucleic acid lipid particles (Zimmermann et al. (2006) Nature 441:111-114), cardiolipin (Chien et al. (2005) Cancer Gene Ther. 12:321-328; Pal et al. (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet et al. (2008) Pharm. Res. 25(12):2972-82; Aigner (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptide (Liu (2006) Mol. Pharm. 3:472-487), and polyamidoamine (Tomalia et al. (2007) Biochem. Soc. Trans. 35:61-67; Yoo et al. (1999) Pharm. Res. 16:1799-1804). In certain embodiments, tRNA forms a complex with cyclodextrin for systemic administration. Methods and pharmaceutical compositions for administration of RNA and cyclodextrin can be found in U.S. Pat. No. 7,427,605.

[0285] The pharmaceutical preparation is preferably sterile. Sterilization can be accomplished by any suitable method, such as filtration through a sterile filtration membrane. In the case where the composition is lyophilized, filtration sterilization can be performed before or after lyophilization and reconstitution.

[0286] The compositions described herein can be administered topically or systemically. Administration is typically parenteral. In preferred embodiments, the pharmaceutical composition is administered subcutaneously, and in even more preferred embodiments, intravenously. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.

[0287] Typically, the therapeutically effective amount of the active component, such as tRNA and / or expression vector, is in the range of 0.1 mg / kg to 100 mg / kg, such as 1 mg / kg to 100 mg / kg, 1 mg / kg to 10 mg / kg. In certain embodiments, the therapeutically effective amount of the viral expression vector is in the range of 10 2 Up to 10 15 In the range of plaque forming units (pfus), for example, 102 Up to 10 10 , 10 2 Up to 10 5 , 10 5 Up to 10 15 , 10 5 Up to 10 10 or 10 10 Up to 10 15 Plaque forming units. The dosage will depend on variables such as the type and extent of the disease or indication to be treated, the patient's overall health, the in vivo efficacy of the antibody, the pharmaceutical formulation, and the route of administration. The initial dose can be increased to exceed the upper limit to quickly reach the desired blood level or tissue level. Alternatively, the initial dose can be less than the optimal dose, and the daily dose can be gradually increased during the treatment. The human dose can be optimized, for example, in a conventional I phase dose escalation study designed to be from 0.5 mg / kg to 20 mg / kg. The frequency of administration may vary depending on factors such as route of administration, dosage, serum half-life, and the disease being treated. Exemplary dosing frequencies are once a day, once a week, and once every two weeks. The preferred route of administration is parenteral, such as intravenous infusion. In certain embodiments, the polypeptide and / or multimeric protein is lyophilized and then reconstituted in buffered saline when administered.

[0288] In certain embodiments, the tRNA or expression vector is not conjugated or associated with another part, such as a carrier particle, such as an amino lipid particle. In certain embodiments, the tRNA or expression vector is introduced into a cell or administered to a subject in a dosage form lacking a nanoparticle. In certain embodiments, the tRNA or expression vector is introduced into a cell or administered to a subject in a dosage form lacking an amino lipid delivery compound, for example, as described in U.S. Patent Publication No. 2017 / 0354672.

[0289] V. Therapeutic Uses

[0290] The compositions and methods disclosed herein can be used to treat a premature stop codon (PTC)-mediated disorder in a subject. As used herein, the term "PTC-mediated disorder" refers to a disorder that is mediated, enhanced, exacerbated, or otherwise promoted or associated with a PTC in a gene.

[0291] The present invention provides a method for treating a PTC-mediated disorder in a subject in need thereof. The method comprises administering to the subject an effective amount of tRNA and / or expression vector, such as the tRNA and / or expression vector disclosed herein, alone or in combination with another therapeutic agent, to treat the subject's PTC-mediated disease.

[0292] In certain embodiments, the premature stop codon-mediated disorder is a disorder listed in Table 5 below, and / or the gene having a premature stop codon is a gene listed in the corresponding row of Table 5 below.

[0293] Table 5

[0294]

[0295]

[0296]

[0297] In certain embodiments, the premature stop codon-mediated disorder is a disorder listed in Table 6 below, and / or the gene having a premature stop codon is a gene listed in the corresponding row of Table 6 below.

[0298] Table 6

[0299]

[0300]

[0301] In certain embodiments, the PTC-mediated disorder is epilepsy (e.g., Dravet syndrome), wherein the method reduces the frequency of convulsions, the severity of convulsions, and / or cognitive impairment in the subject. For example, in certain embodiments, the method reduces the frequency of convulsions in the subject by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% over a period of, for example, one day, one week, or one month. In certain embodiments, the method reduces the frequency of convulsions by 50% over a period of, for example, one day, one week, or one month.

[0302] In certain embodiments, the PTC-mediated disorder is Dravet and / or the gene having a premature stop codon is SCN1A. In certain embodiments, the premature stop codon in the SCN1A gene is caused by a mutation or combination of mutations selected from the group consisting of: c.5745C>G, c.5713G>T, c.5701C>T, c.5677C>T, c.5641C>T, c.5629C>T, c.5623C>T, c.5503A>T, c.5473G>T, c.5437G>T, c.5428C>T, c.5403G>A, c.5402G>A, c.5383G>T, c.5371G>T, c.5049T>G, c.4921G>T, c.4900C>T, c.4873C>T, c.479d>T el, c.4778G>A, c.4774G>T, c.4761T>G, c.4648G>T, c.4540C>T, c.4516 A>T, c.4514C>A, c.4508T>G, c.4488C>G, c.4471G>T, c.4300A>T, c.4269 G>A, c.4268G>A, c.4233T>A, c.4222G>T, c.4191G>A, c.4190G>A, c.418 6C>T, c.4159A>T, c.4155C>A, c.3964del, c.3952C>T, c.3825G>A, c.382 4G>A, c.3819G>A, c.3818G>A, c.3795T>A, c.3789T>G, c.3779G>A, c.37 50C>G, c.3724G>T, c.3700C>T, c.3697C>T, c.3657dup, c.3624G>A, c.36 04C>T, c.3582G>A, c.3578G>A, c.3574C>T, c.3463C>T, c.3454del, c.3 424G>T, c.3422C>A, c.3406G>T, c.3328G>T, c.3273C>A, c.3262G>T, c.3 073C>T, c.3060T>A, c.2844T>A, c.2749C>T, c.2695C>T, c.2645T>A, c. 2560C>T, c.2551C>T, c.2546C>A, c.2462G>A, c.2298del, c.2228G>A, c. 2181G>A, c.2180G>A, c.2101C>T, c.2038A>T, c.1958T>A, c.1837C>T, c. 1834C>T, c.1804G>T, c.1795G>T, c.1738C>T, c.1702C>T, c.1660C>T, c.1624C>T, c.1516C>T, c.1378C>T, c.1363C>T, c.1354A>T, c.1348C>T, c .1345G>T, c.1344dup, c.1306G>T, c.1278C>A, c.1278C>G, c.1151G>A, c.1129C>T, c.1118T>A, c.942del, c.751del, c.644T>A, c.327C>G, c.249C>A, c.121A>T, c.4846_4850dup, c.4787_4788del, c.4578_4612dup, c.4211_4212del, c.4125_4130delinsATAATCATACTGATTGCCTAAAACTAAT, c.3690_3693del, c.3338_3339del, c.1247_1248insGTAGA, c.825_826insGTATA, and c.278_279dup. In certain embodiments, the premature stop codon in the SCN1A gene is caused by a mutation or combination of mutations selected from the group consisting of: c.58G>T, c.575G>A, c.664C>T, c.962C>G, c.1095dupT, c.1129C>T, c.1315C>T, c.1348C>T, c.1366G>T, c.1492A>T, c.1537G>T, c.1624C>T, c.1738C>T, c.1804G>T, c.1837C>T, c.2134C>T, c.2370T>A, c. 2495G>A, c.2593C>T, c.2635delC, c.2904C>A, c.3295G>T, c.3311C>A, c.3452C>G, c.3637C>T, c.3656G>A, c.3733C>T, c.378 3C>A, c.3829C>T, c.3985C>T, c.4359T>G, c.4547C>A, c.4573C>T, c.4721C>G, c.4954G>T, c.5641G>T, c.5656C>T and c.5734C>T. In certain embodiments, the premature stop codon in the SCN1A gene is caused by a mutation selected from the group consisting of: c.664C>T, c.1129C>T, c.1492A>T, c.1624C>T, c.1738C>T, c.1837C>T, c.2134C>T, c.2593C>T, c.3637C>T, c.3733C>T, c.3985C>T, c.4573C>T, c.5656C>T, and c.5734C>T. In certain embodiments, the premature stop codon in the SCN1A gene is caused by a mutation selected from the group consisting of c.1738C>T and c.3985C>T. .

[0303] In certain embodiments, the premature stop codon in the SCN1A gene is caused by a mutation listed in Table 7 or a combination of mutations listed in Table 7.

[0304] Table 7

[0305]

[0306]

[0307]

[0308] Other exemplary mutations, including exemplary mutations that result in premature stop codons in genes (e.g., the SCN1A gene), can be found in ClinVar (available on the World Wide Web at ncbi.nlm.nih.gov / clinvar / ), "A catalog of SCN1A variants" Lossin et al. (2009) Brain Dev. 2009 31(2):114-30, the SCN1A Registry (available on the World Wide Web at scn1a.net / scn1a-registry / ), the SCN1A Mutation Database (available on the World Wide Web at gzneurosci.com / scn1adatabase), and the Leiden Open Variant Database (LOVD v.3.0; available on the World Wide Web at databases.lovd.nl / shared / genes / SCN1A). Unless otherwise indicated, any SCN1A mutations described herein are relative to SCN1a isoform 1 (NCBI Reference Sequence NM_001165963, SEQ ID NO: 863).

[0309] In another aspect, the present invention provides a method for treating Dravet syndrome in a subject in need thereof, wherein the subject has an SCN1A gene having a mutation listed consecutively in Table 7, the method comprising administering to the subject an effective amount of an inhibitor tRNA of the inhibitor class indicated in the same row of Table 7 as a mutation, or an expression vector comprising a nucleotide sequence encoding the tRNA. As used in Table 7, "inhibitor class" (e.g., Arg>TGA) refers to the endogenous tRNA type (e.g., arginine tRNA) from which the inhibitor tRNA is derived and the stop codon (e.g., TGA) recognized by the inhibitor tRNA. Exemplary Arg>TGA inhibitor tRNAs include tRNAs comprising a nucleotide sequence selected from SEQ ID NOs: 6-9, 11, 16-18, 19-22, and 35. Exemplary Gln>TAA inhibitor tRNAs include tRNAs comprising a nucleotide sequence selected from SEQ ID NOs: 36-40, 44, and 45. Exemplary Gln>TAG suppressor tRNAs include tRNAs comprising a nucleotide sequence selected from SEQ ID NOs: 178-182, 186, and 187.

[0310] For example, in certain embodiments, the subject has an SCN1A gene with a premature stop codon selected from c.664C>T, c.3637C>T, c.3733C>T, c.2134C>T, and c.1837C>T, and the method comprises administering to the subject an effective amount of a suppressor tRNA comprising a nucleotide sequence selected from SEQ ID NOs: 6-9, 11, 16-18, 19-22, and 35. In certain embodiments, the subject has an SCN1A gene with a premature stop codon selected from c.3607C>T, c.2782C>T, c.3829C>T, and c.2893C>T, and the method comprises administering to the subject an effective amount of a suppressor tRNA comprising a nucleotide sequence selected from SEQ ID NOs: 36-40, 44, and 45. In certain embodiments, the subject has an SCN1A gene with a premature stop codon selected from c.3106C>T, c.3496C>T, c.5662C>T, c.5461C>T, and c.3730C>T, and the method comprises administering to the subject an effective amount of a suppressor tRNA comprising a nucleotide sequence selected from SEQ ID NOs: 178-182, 186, and 187.

[0311] In certain embodiments, wherein the gene is the SCN1A gene, the SCN1A gene product produced with tRNA is a functional SCN1A gene product. In certain embodiments, the functional SCN1A gene product has a greater activity than the SCN1A gene product of brachymemma, such as a greater voltage-gated sodium channel activity. In certain embodiments, relative to cells, tissues or subjects without tRNA, the method increases the voltage-gated sodium channel activity in cells, tissues or subjects by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 110%, about 120%, about 130%, about 140%, about 150%, about 160%, about 170%, about 180%, about 190%, about 200%, about 250%, about 300%, about 350%, about 400%, about 450%, about 500%, about 600%, about 700%, about 800%, about 900% or about 1000%. In certain embodiments, the method increases voltage-gated sodium channel activity in a cell, tissue or subject by about 20% to about 200%, about 20% to about 180%, about 20% to about 160%, about 20% to about 140%, about 20% to about 120%, about 20% to about 100%, about 20% to about 80%, about 20% to about 60%, about 20% to about 40%, about 40% to about 200%, about 40% to about 180%, about 40% to about 160%, about 40% to about 140%, about 40% to about 120%, about 40% to about 100%, about 40% to about 80%, about 40% to about 60%, about 20% to about 40%, about 40% to about 200%, about 40% to about 180%, about 40% to about 160%, about 40% to about 140%, about 40% to about 120%, about 40% to about 100%, about 40% to about 80%, about 40% to about 60%, about 60% to about 200%, about 60% to about 180%, about 40% to about 160%, about 40% to about 140%, about 40% to about 1 %, about 60% to about 120%, about 60% to about 100%, about 60% to about 80%, about 80% to about 200%, about 80% to about 180%, about 80% to about 160%, about 80% to about 140%, about 80% to about 120%, about 80% to about 100%, about 100% to about 200%, about 100% to about 180%, about 100% to about 160%, about 100% to about 140%, about 100% to about 120%, about 120% to about 200%, about 120% to about 180%, about 120% to about 160%, about 120% to about 140%, about 140% to about 200%, about 140% to about 180%, about 140% to about 160%, about 160% to about 200%, about 160% to about 180%, or about 180% to about 200%.Voltage-gated sodium channel activity can be measured by any method known in the art, for example, as described in Kalume et al. (2007) J. Neurosci. 27(41):11065-74, Yu et al. (2007) Nat. Neurosci. 9(9):1142-9, and Han et al. (2012) Nature 489(7416):385–390.

[0312] In certain embodiments, the functional SCN1A gene product is Na v 1.1 Protein. In certain embodiments, a functional SCN1A gene product comprises, consists essentially of, or consists of any of the amino acid sequences, or an amino acid sequence having 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the following amino acid sequences (each corresponding to a different SCN1A isoform):

[0313]

[0314]

[0315]

[0316]

[0317]

[0318]

[0319] As used herein, the term "effective amount" refers to an amount of an active agent (e.g., a tRNA or expression vector according to the invention or a second active agent in a combination therapy) sufficient to produce a beneficial or desired result. An effective amount can be administered in one or more administrations, applications, or dosages, and is not intended to be limited to a specific formulation or route of administration.

[0320] As used herein, "treatment" refers to treating a disease in a subject, such as a human. This includes: (a) inhibiting the disease, i.e., preventing its development; (b) alleviating the disease, i.e., causing regression of the disease state. As used herein, the terms "subject" and "patient" refer to an organism to be treated by the methods and compositions described herein. Such organisms preferably include, but are not limited to, mammals (e.g., murines, simians, equines, bovines, porcines, canines, felines, etc.), and more preferably include humans.

[0321] The methods and compositions described herein can be used alone or in combination with other therapeutic agents and / or modes. As used herein, the term "combined" administration is understood to be delivering two (or more) different treatments to a subject during the subject's condition, so that the effects of treatment on the patient overlap at a certain time point. In certain embodiments, the delivery of one treatment still occurs when the delivery of the second treatment begins, so there is overlap in terms of administration. This is sometimes referred to as "simultaneous" or "co-delivery" in this article. In other embodiments, the delivery of one treatment ends before the delivery of another treatment begins. In certain embodiments of either case, due to combined administration, treatment is more effective. For example, compared to what is seen if the second treatment is administered in the absence of the first treatment, or a similar situation is observed when the first treatment is administered, the second treatment is more effective, for example, the second treatment is less likely to see an equivalent effect, or the second treatment is more symptom-reducing. In certain embodiments, delivery causes a reduction in symptoms or other parameters associated with the condition to be greater than what is seen in a treatment delivered in the absence of another treatment. The effects of the two treatments can be partially added, completely added, or greater than added. Delivery can make the effect of the first treatment delivered still detectable when the second treatment is delivered.

[0322] In certain embodiments, the methods or compositions described herein are combined with one or more additional therapeutic agents, such as DIACOMIT ® (Stiripentol), EPIODOLEX ® (cannabidiol), ketogenic diet, ONFI ® (clobazam), TOPAMAX ®(topiramate), fenfluramine or valproic acid. For example, during the treatment of Dravet syndrome, the methods or compositions described herein are combined with one or more other therapeutic agents, such as DIACOMIT ® (Stiripentol), EPIODOLEX ® (cannabidiol), ketogenic diet, ONFI ® (clobazam), TOPAMAX ® (topiramate), fenfluramine, or valproic acid.

[0323] Throughout the description, where compositions are described as having, including, or comprising particular components, or where processes and methods are described as having, including, or comprising particular steps, it is contemplated that additionally, compositions of the invention consist essentially of, or consist of, said components, and processes and methods according to the invention consist essentially of, or consist of, said process steps.

[0324] In the present application, when an element or component is referred to as being included in a list of enumerated elements or components and / or selected from a list, it should be understood that the element or component may be any one of the enumerated elements or components, or the element or component may be selected from a group consisting of two or more enumerated elements or components.

[0325] In addition, it should be understood that the elements and / or features of the compositions or methods described herein can be combined in a variety of ways without departing from the spirit and scope of the present invention, whether it is clear or implied herein. For example, when referring to a specific compound, the compound can be used in various embodiments of the present composition and / or the inventive method, unless otherwise understood from the context. In other words, in the present application, the embodiments have been described and depicted in a manner that enables writing and drawing clear and concise applications, but it is intended and will be understood that the embodiments can be combined or separated in various ways without departing from this teaching and invention. For example, it should be understood that all features described and depicted herein can be applied to all aspects of the present invention described and depicted herein.

[0326] It should be understood that the expression "at least one" includes each listed object after the expression and various combinations of two or more listed objects, unless otherwise understood from the context and usage. Unless otherwise understood from the context, the expression "and / or" related to three or more listed objects should be understood to have the same meaning.

[0327] Use of the terms "comprising", "having" or "containing", including grammatical equivalents thereof, unless otherwise specifically stated or understood from the context, should generally be interpreted as open-ended and non-limiting, for example, not excluding additional unrecited elements or steps.

[0328] When the term "about" is used before a quantitative value, the present invention also includes the specific quantitative value itself, unless explicitly stated otherwise. As used herein, unless otherwise stated or inferred, the term "about" refers to a ±10% variation relative to the nominal value.

[0329] It should be understood that the order of steps or the order in which certain actions are performed is immaterial as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0330] The use of any and all examples or exemplary language herein, for example, "such as" or "including" is intended only to better illustrate the invention and does not constitute a limitation on the scope of the invention unless claimed. No language in the specification should be construed as indicating any non-claimed element is essential to the practice of the invention. Example

[0331] The following examples are illustrative only and are not intended to limit the scope or content of the present invention in any way.

[0332] Example 1

[0333] This example describes an arginine aminoacylation suppressor tRNA that promotes readthrough of a premature stop codon (PTC).

[0334] The suppressor tRNA (called Arg TCA Five of the endogenous arginine-tRNAs contain introns that must be spliced ​​out to produce mature tRNAs; the corresponding Arg with and without these intron sequences were generated. TCA Suppressor tRNA. Suppressor tRNA sequences are shown in Table 8.

[0335] Table 8

[0336]

[0337]

[0338]

[0339]

[0340] In this example, all mature tRNA sequences (as predicted by GtRNAdb; http: / / gtrnadb.ucsc.edu) were expressed in the context of upstream and downstream genomic flanking sequences (±200 bp) from tRNA-Arg-TCG-1-1, a highly expressed arginine-tRNA, i.e., the tRNA sequences were expressed with the 5' flanking sequence of SEQ ID NO: 26 and the 3' flanking sequence of SEQ ID NO: 27. All mature tRNA sequences including upstream and downstream genomic flanking sequences were generated in the pGL4 vector backbone.

[0341] Testing Arg by flow cytometry in cell lines containing dual fluorescent read-through reporters TCA The reporter genes include three copies of red fluorescent protein (tdTomato), TEV protease, a linker region containing PTC, and three copies of green fluorescent protein (EGFP). A schematic diagram of the reporter gene construct is shown in Figure 3 In the absence of any PTC readthrough caused by suppressor tRNA, translation will be terminated by the PTC in the linker region, and only tdTomato will be expressed (and therefore only red fluorescence will be detected). The PTC readthrough activity as a result of suppressor tRNA will allow translation to proceed through the PTC in the linker region, and both tdTomato and EGFP will be expressed (and therefore red and green fluorescence will be detected). Therefore, readthrough can be assessed by quantifying the percentage of live cells expressing red and green fluorescent reporter genes above background (double positive %).

[0342] To screen for suppressor tRNAs with read-through activity at the PTC associated with Dravet syndrome, a linker region containing the PTC and eight flanking codons on either side of the PTC was generated from SCN1A transcripts of two patients (subject N and subject S) with nonsense mutations in the SCN1A gene.

[0343] The linker region derived from the subject N SCN1A transcript is as follows, and the reporter gene including this linker region is called the subject N-PTC reporter gene: CTGAGACCTCTAAGAGCCTTATCTtgaTTTGAAGGGATGAGGGTGGTTGTG (SEQ ID NO: 28). The corresponding linker with the wild-type Arg codon replacing PTC was used as a control and had the following sequence: CTGAGACCTCTAAGAGCCTTATCTcgaTTTGAAGGGATGAGGGTGGTTGTG (SEQ ID NO: 193).

[0344] The linker region derived from the subject S SCN1A transcript is as follows, and the reporter gene including this linker region is called the subject S-PTC reporter gene: ACAAGCCTTTTCAGCTTTAGAGGGtgaGCAAAGGATGTGGGATCTGAGAAC (SEQ ID NO: 29). The corresponding linker with the wild-type Arg codon replacing PTC was used as a control and had the following sequence: ACAAGCCTTTTCAGCTTTAGAGGGcgaGCAAAGGATGTGGGATCTGAGAAC (SEQ ID NO: 194).

[0345] An additional 51 base pair linker region was derived from a mouse model of Dravet syndrome caused by a R1407X nonsense mutation in SCN1A (Ogiwara et al., 2007, Neurobiology of Disease). The linker region derived from the SCN1A R1407X transcript is as follows, and the reporter gene containing this linker region is called the R1407X-PTC reporter gene: CTAATAGAAAGAAATGAGACCGCCtgaTGGAAAAATGTGAAAGTAAACTTT (SEQ ID NO: 30). The corresponding linker with the wild-type Arg codon replacing PTC was used as a control and had the following sequence: CTAATAGAAAGAAATGAGACCGCCcggTGGAAAAATGTGAAAGTAAACTTT (SEQ ID NO: 195).

[0346] Testing Arg in various assay contexts TCA The inhibitor comprises (i) stably expressing the subject S-PTC reporter gene and encoding Arg TCA The human Flp-In-293 cell line was transiently transfected with the inhibitor plasmid (the results are shown in Figure 4 ), (ii) stably expressing the R1407X-PTC reporter gene and encoding Arg TCA The mouse Flp-In-3T3 cell line transiently transfected with the inhibitor plasmid (the results are shown in Figure 5 ), and (iii) using a plasmid encoding the subject's N-PTC reporter gene and Arg TCA Flp-In-293 cells transiently co-transfected with a plasmid containing suppressor tRNA (results are shown in Figure 6 ). Transfection was performed using Lipofectamine 3000 transfection reagent according to the manufacturer's protocol.

[0347] Additional reporter constructs were generated that included EGFP with a nuclear localization signal (NLS) and contained an arginine to TGA mutation (R96X) within the EGFP open reading frame that abolished fluorescence in the absence of PTC read-through. The general experimental methods are shown in Fig. 8A EGFP expression is driven by the CMV early enhancer / chicken beta actin (CAG) promoter. The reporter gene construct is called CAG:NLS-EGFP (R96X-TGA) and its sequence is as follows:

[0348]

[0349] Using the encoding Arg TCA Arg expression was assessed in HEK293 cells and mouse Neuro-2a cells (a neural crest-derived cell line widely used to study neuronal differentiation) transiently co-transfected with a plasmid encoding the suppressor tRNA and a plasmid encoding the CAG:NLS-EGFP (R96X-TGA) reporter gene. TCA Activity of inhibitors. Transfection was performed using Lipofectamine 3000 transfection reagent according to the manufacturer's protocol. Equal amounts of the indicated inhibitor plasmids and CAG:NLS-EGFP (R96X-TGA) reporter plasmid were used for co-transfection. EGFP expression was analyzed by flow cytometry in 293 cells approximately 24 hours after transfection and in Neuro-2a cells approximately 48 hours after transfection. The results are shown in Figure 7 .

[0350] Typically, Arg TCA The relative read-through activity of the suppressor tRNAs remained consistent across multiple assay formats. The following suppressors reliably demonstrated read-through activity above baseline: TCA-001 (SEQ ID NO: 11), TCA-89 (SEQ ID NO: 1), TCA-90 (SEQ ID NO: 2), TCA-105 (SEQ ID NO: 7), TCA-106 (SEQ ID NO: 8), TCA-107 (SEQ ID NO: 9), TCA-113 (SEQ ID NO: 16), TCA-114 (SEQ ID NO: 17), TCA-115 (SEQID NO: 18), TCA-116 (SEQ ID NO: 19), TCA-117 (SEQ ID NO: 20), TCA-118 (SEQ ID NO: 21), and TCA-119 (SEQ ID NO: 22).

[0351] Taken together, these results indicate that the described suppressor tRNAs can promote expression of transcripts, such as the SCN1A transcript, containing premature stop codons associated with disorders such as Dravet syndrome.

[0352] Example 2

[0353] This example describes the effects of expression vector characteristics on the readthrough of premature termination codons (PTCs) by arginine aminoacylated suppressor tRNAs.

[0354] The pGL4 vector backbone generated a plasmid containing Arg TCAExpression constructs for both suppressor tRNA and EGFP (R96X-TGA) reporter gene. These constructs included 1, 2, 3 or 4 copies of Arg TCA Suppressor tRNA113 (SEQ ID NO: 16), 115 (SEQ ID NO: 18) and 001 (SEQ ID NO: 11) (as described in Example 1 and shown in Table 8). Each copy of the tRNA sequence was expressed in the context of either (i) 200 bp upstream genomic flanking sequence from tRNA-Arg-TCG-1-1 (SEQ ID NO: 26) and 200 bp downstream genomic flanking sequence from tRNA-Arg-TCG-1-1 (SEQ ID NO: 27), (ii) 200 bp upstream genomic flanking sequence from tRNA-Arg-TCG-1-1 (SEQ ID NO: 26) and 104 bp downstream genomic flanking sequence from tRNA-Arg-TCG-1-1 (SEQ ID NO: 32), or (iii) an upstream U6 promoter including 19 bp upstream flanking genomic sequence from tRNA-Arg-TCG-1-1 (SEQ ID NO: 33) and 46 bp downstream flanking genomic sequence from tRNA-Arg-TCG-1-1 (SEQ ID NO: 34). General experimental methods are shown in Fig. 8A A schematic diagram of an exemplary reporter gene construct containing four copies of a suppressor tRNA is shown in Figure 8B The reporter construct was a CAG:NLS-EGFP (R96X-TGA) reporter construct (as described in Example 1) or an EF1a:NLS-EGFP (R96X-TGA) reporter construct, in which the CAG promoter was replaced with the elongation factor-1 alpha (EF1a) promoter, the sequence of which is as follows:

[0355]

[0356] Neuro-2a cells or HEK293 (FlpIn-293) cells were transfected with these constructs and read-through was determined by fluorescence imaging or flow cytometry approximately 24 or 48 hours after transfection. Transfection was performed using Lipofectamine 3000 transfection reagent according to the manufacturer's protocol.

[0357] Results are shown in Figure 9-10 (Fluorescence image) and Figure 11-17 (Quantification of fluorescence signal measured by flow cytometry). For the 001 and 113 suppressors, improved readthrough following increased copy number can be seen. In summary, the results indicate that increasing the copy number of the suppressor tRNA module in the reporter construct generally results in enhanced readthrough activity. In addition, constructs containing U6 exhibit PTC readthrough activity, although generally not as much as seen with the equivalent suppressor tRNA expressed in the flanking genomic context.

[0358] Example 3

[0359] This example describes the design of a functional arginine aminoacylation suppressor tRNA that promotes readthrough of premature stop codons (PTCs) in transcripts.

[0360] C57BL / 6J mice have a naturally occurring C to T mutation in the T loop (position 51) of Arg-TCT-5-1, which has been shown to affect pre-tRNA processing and function (Ryuta Ishimura et al., Science, 2014). TCA Suppressor 120 (described in Example 1 and shown in Table 8) contains a T at position 51. A modified suppressor tRNA was generated that included an TCA Inhibitor 120 has position 51 replaced by C with T (called Arg TCA The Arg inhibitor 179 and having the nucleotide sequence of SEQ ID NO: 35 was tested by transfection into the Flp-In-293 cell line stably expressing the subject S-PTC reporter gene and by co-transfection into Flp-In-3T3 cells with a plasmid encoding the subject N-PTC reporter gene. TCA Inhibitors 120 and 179. Transfection was performed using Lipofectamine 3000 transfection reagent according to the manufacturer's protocol. Results are shown in Figure 4 and Figure 6 Although Arg TCA Inhibitor 120 is non-functional but contains only a single substitution of Arg TCA Suppressor 179 exhibits PTC read-through activity.

[0361] Example 4

[0362] This example describes a glutamine aminoacylation suppressor tRNA that promotes readthrough of a premature stop codon (PTC).

[0363] The suppressor tRNA (referred to as Gln TTA or Gln CTA Suppressor tRNA). The suppressor tRNA sequences are shown in Table 9.

[0364] Table 9

[0365]

[0366]

[0367]

[0368]

[0369] In this example, all mature tRNA sequences were expressed in the context of upstream and downstream genomic flanking sequences (±200 bp) from tRNA-Gln-TTG-1-1, a highly expressed glutamine-tRNA, i.e., the tRNA sequences were expressed with the 5' flanking sequence of SEQ ID NO: 173 and the 3' flanking sequence of SEQ ID NO: 174. All mature tRNA sequences including upstream and downstream genomic flanking sequences were generated in the pGL4 vector backbone.

[0370] Gln was tested by flow cytometry in two independently derived Flp-In-293 cell lines containing an integrated fluorescent read-through reporter gene. TTA The results are shown in Fig.18 The reporter gene includes three copies of red fluorescent protein (tdTomato), TEV protease, a linker region containing PTC, and three copies of green fluorescent protein (EGFP). A schematic diagram of the reporter gene construct is shown in Figure 3. In the absence of any PTC readthrough caused by suppressor tRNA, translation will be terminated by the PTC in the linker region, and only tdTomato will be expressed (and therefore only red fluorescence will be detected). PTC readthrough activity as a result of suppressor tRNA will allow translation to proceed through the PTC in the linker region, and both tdTomato and EGFP will be expressed (and therefore red and green fluorescence will be detected). Therefore, readthrough was assessed by flow cytometry by quantifying the percentage of live cells expressing red and green fluorescent reporter genes above background (double positive %). The linker is derived from mouse Dmd mdx The transcript had the following sequence: CTGCAAAGTTCTTTGAAAGAGCAAtaaAATGGCTTCAACTATCTGAGTGAC (SEQ ID NO: 192). The corresponding linker with the wild-type Gln codon replacing PTC was used as a control and had the following sequence: CTGCAAAGTTCTTTGAAAGAGCAACAAAATGGCTTCAACTATCTGAGTGAC (SEQ ID NO: 191).

[0371] An additional reporter construct was generated in the pGL4 vector backbone that included EGFP with a nuclear localization signal (NLS) and contained a glutamine to TAA mutation (Q69X) that eliminated fluorescence in the absence of PTC read-through. EGFP expression was driven by the CMV early enhancer / chicken beta actin (CAG) promoter. The reporter construct was called CAG:NLS-EGFP (Q69X-TAA) and its sequence is as follows:

[0372]

[0373] By flow cytometry, Gln TTA Evaluation of Gln in Neuro-2a cells transiently co-transfected with a plasmid containing suppressor tRNA and a CAG:NLS-EGFP (Q69X-TAA) reporter gene TTA The transfection was performed using Lipofectamine 3000 transfection reagent according to the manufacturer's protocol. The results are shown in Fig.19 .

[0374] An additional reporter construct was generated in the pGL4 vector backbone, which includes EGFP with a nuclear localization signal (NLS) and contains a glutamine to TAG mutation (Q69X) that eliminates fluorescence in the absence of PTC read-through. EGFP expression is driven by the CMV early enhancer / chicken beta actin (CAG) promoter. The reporter gene construct is called CAG:NLS-EGFP (Q69X-TAG), and its sequence is as follows:

[0375]

[0376] In use code Gln CTA Gln was assessed in Neuro-2a cells transiently co-transfected with a plasmid encoding the suppressor tRNA and a plasmid encoding the CAG:NLS-EGFP (Q69X-TAG) reporter gene. CTA The results are shown in Fig. 20 .

[0377] Together, these results indicate that the described suppressor tRNAs are able to promote the expression of transcripts containing premature stop codons associated with disease states.

[0378] Example 5

[0379] This example describes the read-through activity of the disclosed suppressor tRNA and small molecule nonsense suppression therapeutics.

[0380] The disclosed suppressor tRNAs were tested with the nonsense suppressor drugs translarna (ataluren), gentamicin, and G418 (geneticin). The tRNAs were transfected with an expression construct containing a CAG:NLS-EGFP (R96X-TGA) reporter gene (as described in Example 1) and either (i) included the indicated number of copies of Arg on the same construct. TCA PTC readthrough activity was measured in Neuro-2a cells approximately 48 hours after treatment with either (i) ataluren, (iii) gentamicin, or (iv) G418. Transfections were performed using Lipofectamine 3000 transfection reagent according to the manufacturer's protocol. For all experimental conditions, cell culture medium was replaced with fresh medium approximately 6 hours after transfection, at which time the indicated drugs were added at the indicated concentrations. PTC readthrough activity was measured as the percentage of EGFP-positive cells. A reporter gene containing wild-type EGFP without PTC was used as a control. Cell viability in cells receiving the same set of treatments was assessed by flow cytometry after staining with 7-aminoactinomycin D (7-AAD; Thermo Fisher Scientific #006993-50), a membrane-impermeable dye that is normally excluded from live cells (used according to the manufacturer's protocol). The results are shown in Figure 2. Figure 21-23 In summary, the results show that Arg TCA The suppressor tRNA #115 (SEQ ID NO: 18) produced greater readthrough than any of the nonsense suppressor drugs. In addition, the results showed that, unlike any of the nonsense suppressor drugs, the use of Arg TCA Suppressor tRNA treatment was not accompanied by a decrease in cell viability.

[0381] Example 6

[0382] This example describes an aminoacylated suppressor tRNA that promotes readthrough of a premature stop codon (PTC).

[0383] Suppressor tRNA was generated from endogenous mouse tRNA by converting its normal anticodon to an anticodon that recognizes a premature termination codon (PTC). The suppressor tRNA sequence is shown in Table 10.

[0384] Table 10

[0385]

[0386]

[0387]

[0388]

[0389]

[0390]

[0391]

[0392]

[0393]

[0394]

[0395]

[0396]

[0397]

[0398]

[0399]

[0400]

[0401]

[0402]

[0403]

[0404]

[0405]

[0406]

[0407]

[0408]

[0409]

[0410]

[0411]

[0412]

[0413]

[0414] The PTC readthrough activity of suppressor tRNAs was tested by flow cytometry in a cell line containing dual fluorescent readthrough reporters, which included three copies of red fluorescent protein (tdTomato), TEV protease, a linker region containing the PTC, and three copies of green fluorescent protein (EGFP). Figure 3 The schematic diagram of reporter gene construct is shown.In the absence of any PTC read-through caused by suppressor tRNA, translation will be terminated by the PTC in the joint region, and only tdTomato (and therefore only red fluorescence is detected) is expressed.The PTC read-through activity as a result of suppressor tRNA will allow translation to be carried out by the PTC in the joint region, and tdTomato and EGFP are all expressed (and therefore red and green fluorescence is detected).Therefore, read-through can be assessed by quantifying the percentage (double positive %) of the viable cells of the red and green fluorescence reporter genes higher than background.

[0415] Example 7

[0416] This example describes a glutamine aminoacylation suppressor tRNA that promotes readthrough of a premature stop codon (PTC).

[0417] In this example, all mature tRNA sequences were expressed in the context of upstream and downstream genomic flanking sequences (±200 bp) from tRNA-Gln-TTG-1-1, a highly expressed glutamine-tRNA, i.e., the tRNA sequences were expressed with the 5' flanking sequence of SEQ ID NO: 173 and the 3' flanking sequence of SEQ ID NO: 174. All mature tRNA sequences including upstream and downstream genomic flanking sequences were generated in the pGL4 vector backbone.

[0418] Gln was tested by flow cytometry in Flp-In-293 cells containing an integrated dual-fluorescence read-through reporter or transiently co-transfected with an expression construct containing the dual-fluorescence read-through reporter CTA PTC read-through activity of suppressor tRNA. The reporter gene includes three copies of red fluorescent protein (tdTomato), TEV protease, a linker region containing PTC, and three copies of green fluorescent protein (EGFP). Figure 3 The schematic diagram of reporter construct is shown.In the absence of any PTC read-through caused by suppressor tRNA, translation will be terminated by the PTC in the joint region, and only tdTomato (and therefore only red fluorescence is detected) is expressed.PTC read-through activity as a result of suppressor tRNA allows translation to be carried out by the PTC in the joint region, and tdTomato and EGFP are all expressed (and therefore red and green fluorescence is detected).Therefore, by quantifying the percentage (double positive %) of the viable cells of the red and green fluorescence reporter gene higher than background, read-through is assessed by flow cytometry.In order to screen for suppressor tRNA with read-through activity on the PTC related to Dravet syndrome, a joint region containing eight flanking codons on both sides of PTC and PTC is generated from the SCN1A transcripts of three patients (patient 3 (W1397X), patient 4 (S1505X) and patient 5 (Q1810X)) with Gln (Q) to TAG nonsense mutations in SCN1A.

[0419] The linker region derived from the patient 3 SCN1A transcript is as follows, and the reporter gene including this linker region is called the patient 3-Gln-TAG (W1397X) reporter gene: ATAGAAAGAAATGAGACTGCTCGAtagAAAAATGTGAAAGTAAACTTTGAT (SEQ ID NO: 889). The corresponding linker with the wild-type Trp (W) codon replacing PTC was used as a control and had the following sequence: ATAGAAAGAAATGAGACTGCTCGACAGAAAAATGTGAAAGTAAACTTTGAT (SEQ ID NO: 890).

[0420] The linker region derived from the patient 4 SCN1A transcript is as follows, and the reporter gene including this linker region is called the patient 4-Gln-TAG (S1505X) reporter gene: TATAATGCAATGAAAAAATTAGGAtagAAAAAACCGCAAAAGCCTATACCT (SEQ ID NO: 891). The corresponding linker with the wild-type Ser (S) codon replacing PTC was used as a control and had the following sequence: TATAATGCAATGAAAAAATTAGGACAGAAAAAACCGCAAAAGCCTATACCT (SEQ ID NO: 892).

[0421] The linker region derived from the patient 5 SCN1A transcript is as follows, and the reporter gene including this linker region is called the patient 5-Gln-TAG (Q1810X) reporter gene: GAGAAGTTTGATCCCGATGCAACTtagTTCATGGAATTTGAAAAATTATCT (SEQ ID NO: 893). The corresponding linker with the wild-type Gln codon replacing PTC was used as a control and had the following sequence: GAGAAGTTTGATCCCGATGCAACTCAGTTCATGGAATTTGAAAAATTATCT (SEQ ID NO: 894).

[0422] Testing of Gln by flow cytometry in various assay contexts CTA PTC read-through activity of suppressor tRNA (SEQ ID NO: 178-190) comprising (i) human Flp-In-293 cells transiently co-transfected with a patient 3-Gln-TAG (W1397X) reporter gene, a patient 4-Gln-TAG (S1505X) reporter gene, or a patient 5-Gln-TAG (Q1810X) reporter gene (results are shown in Fig.24 ) and (ii) stably expressing the patient's 3-Gln-TAG (W1397X) reporter gene and encoding Gln CTA The human Flp-In-293 cell line was transiently transfected with a plasmid containing suppressor tRNA (the results are shown in Fig.25 ). Transfection was performed using Lipofectamine 3000 transfection reagent according to the manufacturer's protocol.

[0423] Taken together, these results demonstrate that the described suppressor tRNAs are able to promote expression of transcripts, such as the SCN1A transcript, containing premature stop codons associated with disorders such as Dravet syndrome.

[0424] Example 8

[0425] This example describes the effect of the nucleotide sequence flanking a suppressor tRNA on the suppressor tRNA's readthrough of a premature termination codon (PTC).

[0426] A protein encoding the EGFP-R96X-TGA reporter gene (SEQ ID NO: 31, as described in Example 1) and a single copy of Arg TCA The expression vector of suppressor tRNA #115 (tRNA-Arg-TCT-2-1-TCA-SUP_intronless, SEQ ID NO: 18, as described in Example 1). The expression vector includes sequences immediately 5' and 3' of the tRNA coding sequence, which are derived from genomic DNA 5' and 3' of the mouse tRNA-Arg-TCG-1-1 gene in each case but with different lengths. The detailed information of the expression vector is shown in Table 11.

[0427] Table 11

[0428]

[0429] The PTC read-through activity of the expression vectors in Table 11 was tested in Neuro-2a cells by flow cytometry. Transfection was performed using Lipofectamine 3000 transfection reagent according to the manufacturer's protocol. The results are shown in Fig.26A and 26B and prove that although Arg TCA Suppressor tRNA #115 exhibited activity even with a random 5' leader sequence, but using a 5' leader sequence from an endogenous tRNA gene was able to increase suppressor tRNA activity.

[0430] Example 9

[0431] This example describes the effect of the nucleotide sequence flanking a suppressor tRNA on the suppressor tRNA's readthrough of a premature termination codon (PTC).

[0432] A library of expression vectors was generated that included (i) one of 20 unique 100 nt leader sequences (sequences immediately 5' to the tRNA coding sequence) derived from human genomic DNA, immediately 5' to the endogenous tRNA gene, in combination with (ii) a nucleotide sequence encoding TCA-115 (tRNA-Arg-TCT-2-1-TCA-SUP_intronless, SEQ ID NO: 18, as described in Example 1) or TTA-163 (tRNA-Gln-TTG-3-1-TTA-SUP, SEQ ID NO: 45, as described in Example 4). A schematic diagram of the design of the expression vector constructs in the library is depicted in Fig. 27. The 20 unique 100 nt leader sequences included sequences derived from the most abundant tRNA in human HEK293 cells and included leader sequences derived from Arg-TCT-1-1 (SEQ ID NO: 875), Tyr-GTA-5-1 (SEQ ID NO: 883), Ser-GCT-3-1 (SEQ ID NO: 878), Arg-TCG-1-1 (SEQ ID NO: 886), Arg-TCG-3-1 (SEQ ID NO: 888), Ser-TGA-1-1 (SEQ ID NO: 879), Arg-TCG-5-1 (SEQ ID NO: 871), Lys-TTT-6-1 (SEQ ID NO: 887), Asn-GTT-1-1 (SEQ ID NO: 880), Arg-CCG-2-1 (SEQ ID NO: 877), Ala-AGC-4-1 (SEQ ID NO: 881), Ser-TGA-1-1 (SEQ ID NO: 879), Arg-TCG-5-1 (SEQ ID NO: 871), Lys-TTT-6-1 (SEQ ID NO: 887), Asn-GTT-1-1 (SEQ ID NO: 880), Arg-CCG-2-1 (SEQ ID NO: 887), Ala-AGC-4-1 (SEQ ID NO: 881), Ser-TGA-1-1 (SEQ ID NO: 879), Arg-TCG-5-1 (SEQ ID NO: 871), Lys-TTT-6-1 (SEQ ID NO: 887), Asn-GTT-1-1 (SEQ ID NO: 880), Arg-CCG-2-1 (SEQ ID NO: 887), 874), Leu-TAA-1-1 (SEQ ID NO: 876), Ser-CGA-4-1 (SEQ ID NO: 870), Ser-TGA-4-1 (SEQ ID NO: 869), Ser-GCT-2-1 (SEQ ID NO: 872), Arg-TCT-2-1 (SEQ ID NO: 881), Thr-TGT-1-1 (SEQ ID NO: 885), Ile-AAT-4-1 (SEQ ID NO: 873), Val-CAC-2-1 (SEQ ID NO: 884) or Asn-GTT-3-1 (SEQ ID NO: 882) genes.

[0433] The EGFP-R96X-TGA reporter gene (SEQ ID NO: 31) (for Arg TCA construct) or with EGFP-Q69X-TAA reporter gene (SEQ ID NO: 175) (for Gln TTA The leader sequence combined with Arg TCA Suppressor tRNA #115 (SEQ ID NO: 18) or Gln TTA PTC read-through activity of suppressor tRNA #163 (SEQ ID NO: 45). The results are shown in Figure 28-32 and show that (i) the activity of suppressor tRNA is affected by the leader sequence, and (ii) suppressor tRNAs (including different classes of suppressor tRNAs) display high read-through activity when combined with the identified leader sequence.

[0434] Example 10

[0435] This example describes the read-through activity of certain suppressor tRNAs and small molecule nonsense suppression therapeutics disclosed herein.

[0436] Suppressor tRNAs were tested with the nonsense suppressor drugs translarna (ataluren), gentamicin, and G418 (geneticin). PTC readthrough activity was measured in Neuro-2a cells approximately 48 hours after transfection with an expression construct containing a CAG:NLS-EGFP (Q69X-TAA) reporter gene (described in Example 4, SEQ ID NO: 175) and the cells were either (i) treated with the indicated number of copies of the Gln suppressor tRNA (either #002, tRNA-Gln-TTG-1-1-TTA-SUP, SEQ ID NO: 36, or #196, tRNA-Gln-TTG-1-1-CTA-SUP, SEQ ID NO: 178, both as described in Example 4) on the same construct, or (ii) treated with ataluren, (iii) treated with gentamicin, or (iv) treated with G418. Transfection was performed using Lipofectamine 3000 transfection reagent according to the manufacturer's protocol. For all experimental conditions, the cell culture medium was replaced with fresh medium approximately 6 hours after transfection, at which time the indicated drugs were added at the indicated concentrations. PTC read-through activity was measured as the percentage of EGFP-positive cells measured by flow cytometry. Cell viability in cells receiving the same set of treatments was assessed by flow cytometry after staining with 7-aminoactinomycin D (7-AAD; Thermo FisherScientific #006993-50), a membrane-impermeable dye that is normally excluded from live cells (used according to the manufacturer's protocol). Figure 33-34 Shows Gln TTA The results of suppressor tRNA #002 (SEQ ID NO: 36) and Figure 35-36 Shows Gln CTA Results for suppressor tRNA #196 (SEQ ID NO: 178). In summary, the results indicate that suppressor tRNA produces greater readthrough than any of the nonsense suppressor drugs. In addition, the results indicate that, unlike any of the nonsense suppressor drugs, treatment with suppressor tRNA is not accompanied by a decrease in cell viability.

[0437] Embodiment 11

[0438] This example describes the rescue of full-length SCN1a protein expression by certain suppressor tRNAs disclosed herein.

[0439] Flp-In-293 cells were (i) transfected with an expression construct (SEQ ID NO: 899) containing mouse SCN1A with a PTC (R1407X) with Arg(R) to TGA and a 3xFLAG tag peptide at the C-terminus (DYKDHD-G-DYKDHD-I-DYKDDDDK), and (ii) either transfected with a PTC containing Arg(R) to TGA or a 3xFLAG tag peptide at the C-terminus (DYKDHD-G-DYKDHD-I-DYKDDDDK). TCA The expression construct of suppressor tRNA #115 (tRNA-Arg-TCT-2-1-TCA-SUP_intronless, SEQ ID NO: 18) was co-transfected, or treated with G418, gentamicin or ataluren. The expression construct containing wild-type mouse SCN1A and a 3xFLAG tag peptide at the C-terminus (SEQ ID NO: 898) was used as a control. SEQ ID NOs: 898 and 899 are as follows:

[0440]

[0441]

[0442] SCN1A was detected by Western blotting as follows. Protein was separated in RIPA lysis and extraction buffer (Thermo Fisher Scientific #89900) containing Halt protease inhibitor mixture (Thermo Fisher Scientific #89900) 24 hours after transfection according to the manufacturer's protocol. Protein concentration was determined using Pierce BCA protein detection kit (Thermo Fisher Scientific #23225). 30 μg of protein was separated at 150V for 1.5 hours on NuPAGE 4-12% Bis-Tris (Thermo Fisher Scientific #NP0322BOX) or NuPAGE 3-8%, Tris-acetate (Thermo FisherScientific #EA0375BOX) protein gels, and transferred to PVDF membranes to spend the night at 30V, then at 4°C for 30 minutes at 250 mA. The blot was blocked in SuperBlock T20 blocking buffer (Thermo Fisher Scientific #37536) for 1 hour at room temperature, incubated with anti-FLAG M2 primary antibody (Sigma, F1804-200UG, 1:1000) in TBST at 4°C overnight, washed 3 times with TBST, and incubated with goat anti-mouse IgG (H+L) secondary antibody, HRP secondary antibody (Thermo Fisher Scientific #31431, 1:30,000) at room temperature for 1 hour. The blot was developed by applying SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific #34094) and the signal was detected by iBright imaging system. The results are shown in Figure 37 and demonstrate that Arg TCA The inhibitor tRNA #115, but not small molecule drugs, was able to rescue full-length SCN1A protein expression.

[0443] Flp-In-293 cells were also expressed with (i) an expression construct containing a mouse SCN1A PTC (R1407X) with Arg(R) to TGA and a 3xFLAG tag peptide at the C-terminus (SEQ ID NO: 899) and (ii) an expression construct containing Arg(R) to TGA TCA Suppressor tRNA #104 (tRNA-Arg-CCG-3-1-TCA-SUP, SEQ ID NO: 6), Arg TCASuppressor tRNA #106 (tRNA-Arg-CCT-2-1-TCA-SUP, SEQ ID NO: 8) or Arg TCA The expression construct of suppressor tRNA #115 (tRNA-Arg-TCT-2-1-TCA-SUP_intronless, SEQ ID NO: 18) was co-transfected. SCN1A expression was measured by Western blotting using anti-FLAG antibody as described above in this example. The results are shown in Figure 38 and demonstrate that each suppressor tRNA tested rescued full-length SCN1A protein expression.

[0444] Flp-In-293 cells were also cultured with (i) an expression construct containing mouse SCN1A with a PTC (R1407X) with Arg(R) to TGA and a 3xFLAG tag peptide at the C-terminus (SEQ ID NO: 899) and (ii) a dose range (13 ng per well, 40 ng per well, 113 ng per well, or 400 ng per well; 6-well cell culture plates) of a 5-well plate containing Arg(R) to TGA. TCA The expression construct of suppressor tRNA #115 (tRNA-Arg-TCT-2-1-TCA-SUP_intronless, SEQ ID NO: 18) was co-transfected. SCN1A expression was measured by Western blot using anti-FLAG antibody as described above in this example. The results are shown in Figure 39 and demonstrate that tRNA 115 is able to rescue full-length SCN1A protein expression over a wide dose range.

[0445] Example 12

[0446] This example describes the read-through activity of the disclosed suppressor tRNAs delivered by adeno-associated virus (AAV) vectors.

[0447] The construct packaged into the AAV-PHP.eB capsid is depicted in Fig.40 Construct 262 contained wild-type EGFP driven by the EF1a promoter. Construct 269 contained EGFP-R96X-TGA driven by the EF1a promoter (SEQ ID NO: 177) and two copies of Arg in the context of 55 bp upstream flanking genomic DNA from tRNA-Tyr-GTA-5-1 (SEQ ID NO: 900). TCASuppressor tRNA #115 (tRNA-Arg-TCT-2-1-TCA-SUP_intronless, SEQ ID NO: 18, as described in Example 1). Both constructs contain 5' and 3' ITR sequences from AAV2, which provide cis-acting elements for AAV replication and packaging. AAV-PHP.eB containing construct 262 and construct 269 was produced by Vigene Biosciences.

[0448] Prior to AAV transduction, 293 cells (Agilent #240073) were pre-transfected with an expression construct containing the LY6A gene (CCDS ID 27540.1) driven by the CMV early enhancer / chicken beta actin (CAG) promoter, which is required for robust transduction of AAV-PHP.eB. For pre-transfection, cells were transiently transfected with the LY6A expression construct using Lipofectamine 3000 transfection reagent according to the manufacturer's protocol. Approximately 24 hours after transfection, the medium was replaced with fresh medium and the cells were allowed to recover for an additional 24 hours prior to viral transduction. The cells were then transduced at an MOI of 1E5 vg / cell. Results are shown in Table 1. Fig.41 As shown. AAV delivered Arg TCA Suppressor tRNA #115 resulted in approximately 13.2% PTC readthrough based on GFP intensity. When delivered via AAV or transient transfection, the suppressor tRNA showed comparable readthrough activity.

[0449] Example 13

[0450] This example describes ribosome profiling experiments demonstrating that the disclosed suppressor tRNAs do not cause extensive readthrough of off-target natural stop codons.

[0451] To determine whether suppressor tRNAs cause readthrough of natural stop codons, ribosome profiling was used to quantify the number of ribosomes found in the 3'UTR of mRNAs from (i) cells transfected with an expression construct containing suppressor tRNAs relative to (ii) cells transfected with an expression construct lacking suppressor tRNAs. Ribosomes normally terminate translation upon encountering a stop codon, so if suppressor tRNAs cause increased readthrough of natural stop codons, this would manifest as an increase in the density of ribosomes found in the 3'UTR of mRNAs in cells expressing suppressor tRNAs, particularly in 3'UTR mRNAs containing natural stop codons recognized by the expressed suppressor tRNAs.

[0452] Neuro-2a cells were treated with (i) a construct containing the EGFP-R96X-TGA reporter gene (SEQ ID NO: 177) and Arg TCA The expression constructs of suppressor tRNA #001 (SEQ ID NO: 11) or (ii) the expression construct lacking suppressor tRNA and containing wild-type EGFP reporter gene were transfected. The expression of EGFP was Fig.42As shown. Approximately 48 hours after transfection, cells were subjected to ribosome footprinting profiling as follows. Cells were lysed in lysis buffer (10 mM Tris-HCl pH7.5, 5 mM MgCl2, 100 mM KCl, 1% Triton X-100, 1 Mm DTT, 50 μg / mL emetine (Sigma #324693), and 500 U / mL RNAsin (Promega #N2615)) and the cell lysate was sheared 10 times with a 25-gauge needle and then centrifuged at 20,000 g for 10 minutes at 4°C. The supernatant was digested with micrococcal nuclease (MNase; 120 units / OD A260 lysate; New England Biolabs #M0247S) for 30 minutes at room temperature, and then 5 uL SuperAse-IN (ThermoFisher Scientific #AM2694) was added to stop the reaction. The MNase-treated extracts were loaded into a 15-45% sucrose gradient and density separated at 41,000 rpm in a SW 41Ti swinging-bucket rotor (Beckman Coulter #331362) at 4°C for 2:26 hours. After fractionation and collection of monomer-containing fractions, ribosome-protected mRNA fragments were precipitated from the sucrose with 1.25 mL of 95% ethanol at -20°C overnight. The mRNA fragments were resuspended with 10 mM Tris-HCl, pH 8.0 and separated on a 15% denaturing polyacrylamide gel (TBE-urea gel; Thermo Fisher Scientific #EC68852BOX). RNA fragments ranging in size from 26 to 34 nt were excised from the gel and separated to generate a ribosome-protected fragment library. PCR products were separated on 8% non-denaturing polyacrylamide gels (Thermo Fisher Scientific #EC62152BOX) after 3' adapter ligation, rRNA depletion with Ribo-Zero reagent in the TruSeq Stranded Total RNA Library Prep Gold Kit (Illumina #20020598), reverse transcription, circularization, and PCR amplification with index primers. The barcoded cDNA library was extracted from the gel and sequenced by the NextSeq 550 sequencing system with a single read run type. After sequencing, the raw reads were trimmed of adapters using Trimmomatic and then depleted of non-coding RNA by aligning against the mouse mm10 ncRNA reference from Ensembl using bowtie2. The remaining reads were aligned against the mm10 mouse reference assembly from UCSC, again using bowtie2.Multi-positioned reads were discarded. The resulting final aligned read set was quantified using the RiboProfiling package in R and a custom Python script. Python was used to generate graphs examining 3'UTR occupancy and fold change for each gene with 20 or more uniquely positioned reads, and the distribution of genes with each natural stop codon was compared using a 2-sample Kolmogorov-Smirnov test. The results are depicted in. Fig.43 .

[0453] Together, these results suggest that suppressor tRNAs can promote expression of transcripts containing premature stop codons, such as EGFP-R96X-TGA, without causing extensive off-target natural stop codon readthrough in expressing cells.

[0454] Incorporated by Reference

[0455] The entire disclosure of each patent and scientific article cited herein is incorporated by reference for all purposes.

[0456] Equivalent

[0457] Without departing from the spirit or essential features of the present invention, the present invention may be implemented in other specific forms. Therefore, the foregoing embodiments are considered to be illustrative in all respects, rather than limiting the present invention described herein. Therefore, the scope of the present invention is indicated by the appended claims rather than by the preceding description, and all changes falling within the equivalent meanings and scope of the claims are intended to be included therein.

Claims

1. tRNA comprising the nucleotide sequence listed in Table 2.

2. The tRNA of claim 1, wherein the tRNA comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 19-21, 37, 39, 40, 44, 179, 181, 182, and 186.

3. The tRNA of claim 1 or 2, wherein the tRNA comprises a naturally occurring nucleotide modification.

4. The tRNA of any one of claims 1-3, wherein the tRNA comprises one or more nucleotide modifications selected from 5-methyluridine, 5-carbamoylmethyluridine, 5-carbamoyl-methyl-2-O-methyluridine, 5-methoxy-carbonylmethyluridine, 5-methoxycarbonylmethyl-2-thiouridine, pseudouridine, dihydrouridine, 1-methyladenosine, and inosine.

5. An expression vector comprising a nucleotide sequence encoding the tRNA according to any one of claims 1 to 4.

6. The expression vector of claim 5, wherein the expression vector comprises 1, 2, 3, 4 or more copies of the nucleotide sequence encoding the tRNA.

7. The expression vector of claim 5 or 6, wherein the expression vector further comprises the nucleotide sequence listed in Table 4.

8. The expression vector of claim 7, wherein the expression vector comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 869-888.

9. An expression vector comprising a nucleotide sequence encoding a tRNA listed in Table 3, wherein the expression vector comprises 1, 2, 3, 4 or more copies of the nucleotide sequence encoding the tRNA.

10. An expression vector comprising a nucleotide sequence encoding a tRNA listed in Table 3, wherein the expression vector further comprises a nucleotide sequence listed in Table 4.

Images