Nucleic acid aptamer combined with CD83 protein and application of nucleic acid aptamer

Abstract

The invention belongs to the technical field of biology, and particularly relates to a nucleic acid aptamer combined with CD83 protein and application of the nucleic acid aptamer, the limitation of the prior art is solved by improving a screening strip, and the nucleic acid aptamer which is small in molecular weight, stable in chemical property, convenient to store and capable of being chemically labeled is successfully screened out through an optimized screening strategy. The aptamer shows high affinity and high specificity binding with the CD83 protein, so that the aptamer has important application potential in multiple fields of detection, diagnosis, imaging, treatment and the like.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a nucleic acid aptamer binding to CD83 protein and an application thereof. Background Art

[0002] CD83 is a member of the immunoglobulin superfamily and a type of single-pass transmembrane protein located on the cell surface, encoded by the gene CD83. The expression of CD83 is closely related to the maturation of dendritic cells. The activation of its signaling pathway can promote the antigen presentation ability of dendritic cells, enhance the interaction between immune cells, induce the activation and differentiation of immune cells, and regulate the intensity of immune response. Therefore, CD83 is considered to play an important role in immune regulation and immune response.

[0003] So far, the ligand of CD83 has not been fully identified, but studies have shown that CD83 may participate in regulating immune responses by interacting with molecules on the surface of other immune cells. The expression and function of CD83 may be regulated by a variety of cytokines and signaling pathways, thereby affecting the maturation of dendritic cells and the initiation of immune responses.

[0004] The expression of CD83 and the activation of the signaling pathway can promote the maturation and antigen presentation ability of dendritic cells, enhance the interaction between immune cells, and induce the activation and differentiation of immune cells, thus playing a key role in the immune response. Therefore, the CD83 signaling pathway is believed to be involved in the immune regulation and pathogen clearance process. However, abnormal activation or imbalanced regulation of the CD83 signaling pathway may lead to excessive or insufficient immune response, thereby affecting the health status of the body.

[0005] The results of multiple studies have shown that the role of CD83 in immune regulation is closely related to the occurrence and development of a variety of immune-related diseases, including certain types of cancer. Although there is no specific data on the number of patients, studies have shown that the expression level of CD83 changes in certain disease states. For example, CD83 expression increases during the maturation of dendritic cells, which may affect their antigen presentation ability and the activation of immune cells. In vitro experimental results also show that the expression and function of CD83 may affect the activation and differentiation of immune cells. In some cases, abnormal expression of CD83 may be associated with dysregulation of immune response, which may be related to the development of autoimmune diseases or chronic infections. Studies have shown that the expression level of CD83 may be associated with the progression of the disease in some cancers. For example, CD83 may affect tumor immune escape in certain tumor microenvironments, which may be related to tumor growth and metastasis. At present, studies have explored the application of interventions targeting CD83 in regulating immune responses. For example, by using specific antibodies or small molecule drugs to regulate the expression or function of CD83, the maturation and antigen presentation ability of dendritic cells can be affected, thereby affecting the activation and differentiation of T cells. This provides new strategies for treating autoimmune diseases and improving the effectiveness of vaccines.

[0006] However, simply inhibiting or activating CD83 may not be sufficient to resolve complex immune imbalances. In addition, the function of CD83 may be regulated by multiple factors, including interactions with other immune cell surface molecules and the influence of cytokines.

[0007] Clinical evidence suggests that targeted therapy against CD83 may have therapeutic potential for certain immune diseases. For example, regulation of CD83 may help improve the course of certain autoimmune diseases or enhance the immune effect of vaccines. All of this evidence suggests that the role of CD83 in immune regulation is multifaceted and may play a role in the treatment of immune-related diseases. Therefore, CD83 is a candidate target for the development of immunomodulatory drugs. Qualitative and quantitative detection and purification of CD83, and the development of reagents or drugs for the diagnosis and treatment of abnormal CD83 expression or function, are of great significance for improving the therapeutic effect of immune diseases.

[0008] Aptamers are DNA or RNA molecules separated by systematic evolution of ligands by exponential enrichment (SELEX). They can bind to other targets such as proteins, metal ions, small molecules, peptides, and even whole cells with high affinity and specificity, and therefore have broad prospects in biochemical analysis, environmental monitoring, basic medicine, and new drug synthesis. Compared with antibodies, aptamers have small molecular weight, better stability, easy modification, no immunogenicity, short production cycle, and can be synthesized artificially, eliminating a series of processes such as animal immunization, feeding, protein extraction, and purification. Therefore, if we can find aptamers with high affinity and high specificity for CD83 protein, it will help to achieve high sensitivity and high specificity detection of CD83 protein, and help to develop drugs targeting CD83 protein.

[0009] At present, although CD83, as an important immunomodulatory molecule, has been widely studied in various immune-related studies, according to existing information, there is no patent disclosing a nucleic acid aptamer targeting CD83 protein and a screening method thereof.

[0010] The development of high-affinity nucleic acid aptamers targeting CD83 is of great significance for enhancing the accuracy of immune detection, promoting the development of immunotherapy strategies, and deepening the understanding of the interaction between immune cells. The potential applications of these aptamers include early disease diagnosis, personalized medicine, and as targeting molecules for drug delivery systems, which are expected to bring revolutionary progress in the treatment of immune-related diseases.

[0011] Therefore, there is an urgent need to find a nucleic acid aptamer with high binding affinity to CD83 protein, good specificity, easy modification and artificial synthesis, good stability, and convenient use. Summary of the invention

[0012] In order to comprehensively solve the above problems, especially to address the shortcomings of the prior art, the present invention provides a nucleic acid aptamer that binds to the CD83 protein by improving the screening strip to solve the limitations of the prior art. Through the optimized screening strategy, a nucleic acid aptamer with a small molecular weight, stable chemical properties, easy storage and chemical labeling is successfully screened out. The aptamer exhibits high affinity and high specificity binding to the CD83 protein, making it have important application potential in multiple fields such as detection, diagnosis, imaging and treatment.

[0013] In view of this, the present invention provides a nucleic acid aptamer binding to CD83 protein and its application, characterized in that it has a nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.6; or a nucleotide sequence that has at least 30% homology with any one of SEQ ID NO.1 to SEQ ID NO.6 and binds to CD83 protein; or an RNA sequence transcribed from the nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.6.

[0014] The present invention designs and synthesizes a random single-stranded DNA library and corresponding primers based on the SELEX technology, which are used to screen nucleic acid aptamers that have small molecular weight, stable chemical properties, are easy to store and label, and can bind to CD83 protein with high affinity. Thus, some nucleic acid aptamers that bind to CD83 protein with high affinity are screened, which are SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, respectively. The nucleic acid aptamers have strong affinity to CD83 protein and high specificity.

[0015] It can be understood that the nucleotide sequence that has at least 30%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% homology with the nucleic acid aptamer provided by the present invention and binds to the CD83 protein, for example, the nucleotide sequence shown in any one of the above nucleic acid aptamers can have part of the sequence deleted or part of the sequence added, and still has high affinity with the CD83 protein and is still within the scope of protection of the present invention.

[0016] In some ways, as an improvement on the above technical solution, a certain position on the nucleotide sequence of the above-mentioned nucleic acid aptamer can be modified, for example, phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium or isotopization, etc., provided that the nucleic acid aptamer sequence obtained after such modification has desirable properties, for example, it can have an affinity for binding to CD83 protein that is equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0017] Therefore, in some embodiments, the nucleotide sequence of the nucleic acid aptamer is modified and the modified nucleic acid aptamer specifically binds to the CD83 protein, and the modification is selected from at least one of phosphorylation, methylation, amination, thiolation, replacement of oxygen with sulfur, replacement of oxygen with selenium and isotopization, which is still within the scope of protection of the present invention.

[0018] In the above technical scheme, further, the present invention provides a conjugate or derivative of a nucleic acid aptamer, wherein the nucleic acid aptamer has a nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.6; the conjugate of the nucleic acid aptamer includes a fluorescent marker; the derivative of the nucleic acid aptamer includes a thiophosphate backbone or peptide nucleic acid that binds to the CD83 protein, which is modified from the nucleotide sequence backbone of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.

[0019] In the present technical scheme, the conjugate of the nucleic acid aptamer refers to connecting other groups to the nucleic acid aptamer, such as fluorescent markers with marking functions, such as FAM, radioactive substances, therapeutic substances, biotin, digoxin, nanoluminescent materials, small peptides, siRNA or enzyme labels, so that the nucleic acid aptamer sequence obtained after modification has desirable properties, for example, it can have an affinity for binding to CD83 protein that is equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0020] In other words, the above aptamers, whether partially substituted or modified, have substantially the same or similar molecular structures, physicochemical properties and functions as the original aptamers, and can be used to bind to CD83 protein.

[0021] In addition, the present invention also provides nucleic acid aptamer derivatives, which are obtained by transforming the nucleotide sequence skeleton of the above-mentioned nucleic acid aptamer into a phosphorothioate skeleton that binds to the CD83 protein, or are peptide nucleic acids that bind to the CD83 protein that are transformed from the nucleic acid aptamer or the conjugate of the nucleic acid aptamer in any of the above-mentioned technical solutions. The condition is that the derivatives have a molecular structure, physicochemical properties and functions that are substantially the same or similar to the original nucleic acid aptamer, and all bind to the CD83 protein.

[0022] The term "phosphorothioate backbone" as used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to that the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA aptamers can be replaced by one or two sulfur atoms, resulting in a phosphorothioate backbone with phosphorothioate or phosphorodithioate bonds, respectively. Such phosphorothioate backbones are known to have increased binding affinity to their targets, as well as enhanced resistance to nuclease degradation.

[0023] The term "peptide nucleic acid" used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to an artificially synthesized DNA molecule analog, first reported by Nielsen et al. in 1991. Oligonucleotide mimics linked by peptide bonds were synthesized using N-2-(aminoethyl)-glycine units instead of sugar-phosphate backbones as repeating structural units, and are called peptide nucleic acids. Since peptide nucleic acids (PNA) do not have phosphate groups like those on DNA or RNA, there is a lack of electrical repulsion between PNA and DNA, making the binding strength between the two greater than the binding strength between DNA.

[0024]

[0025] In the above technical scheme, further, the present invention provides a product for detecting CD83 protein, wherein the product includes the nucleic acid aptamer as described above, or a conjugate or derivative of the nucleic acid aptamer as described above; the product includes any one or more of a kit, a detection chip, and a chromatographic detection device.

[0026] In the above technical scheme, further, the present invention provides a product for purifying CD83 protein, wherein the product includes the nucleic acid aptamer as described above, or the conjugate or derivative of the nucleic acid aptamer as described above; the product includes any one or more of a kit, a detection chip, and a chromatography detection device.

[0027] In the above technical scheme, further, the present invention provides a method for screening nucleic acid aptamers binding to CD83 protein, the method comprising the following steps: step S1, synthesizing a random single-stranded DNA library and primers; step S2, magnetic bead screening: performing at least 6 rounds of counter-screening and screening, and adding serum (normal human serum, purchased from Beijing Solebow Technology Co., Ltd., item number: SL010) starting from the 5th round

[0028] In the above technical solution, further, the step S2 of adding serum after the fifth round is as follows: adding 5% serum in the fifth round and adding 10% serum in the sixth round; the serum is human serum.

[0029] In the present technical scheme, the method for screening nucleic acid aptamers binding to CD83 protein provided by the present invention is based on the SELEX screening method. In the step of magnetic bead screening, serum is added for blocking starting from the 5th round and the serum concentration is increased round by round to further improve the specificity and stability of the nucleic acid aptamer.

[0030] The conventional conditions for nucleic acid aptamer screening are carried out in ionic buffer, while a certain concentration of serum is gradually added under the screening conditions. On the one hand, because the serum contains abundant proteins, it can compete with the proteins on the surface of magnetic beads to bind to the library, thereby removing those sequences that have weak binding ability to the target CD83 protein or are only adsorbed. On the other hand, the aptamer binds to the target in the serum environment, which can better meet the actual detection environment of the later application based on nucleic acid aptamer development.

[0031] Studies have shown that using higher concentrations of serum in the final rounds of screening can screen for nucleic acid aptamers with higher affinity and better specificity.

[0032] In the above technical scheme, further, the present invention provides the use of the nucleic acid aptamer as described above, or the conjugate or derivative of the nucleic acid aptamer as described above for preparing a reagent for detecting or purifying CD83 protein.

[0033] In the above technical solution, further, the present invention provides the use of the nucleic acid aptamer as described above, or the conjugate or derivative of the nucleic acid aptamer as described above for preparing a drug targeting CD83 protein.

[0034] In some embodiments, the present invention provides the use of the above-mentioned nucleic acid aptamer, its conjugate or its derivative in any one of the group consisting of:

[0035] (1) Quantitative or qualitative detection of CD83 protein;

[0036] (2) Purification of CD83 protein;

[0037] (3) Imaging of CD83 protein;

[0038] (4) As an inhibitor of CD83 protein;

[0039] (5) preparing drugs targeting CD83 protein;

[0040] (6) Preparing reagents or drugs for diagnosing and treating abnormal CD83 expression.

[0041] The beneficial effects of the present invention are:

[0042] 1. By improving the screening conditions, a nucleic acid aptamer with small molecular weight, stable chemical properties, easy storage and labeling, which can bind to CD83 protein with high affinity and high specificity, was screened out.

[0043] 2. The structure is relatively stable, simple, easy to modify, can be artificially synthesized in a short period of time, has stable chemical properties, and is easy to store and label.

[0044] 3. It can be used for detection, diagnosis, imaging and treatment, such as purification or high-sensitivity and high-specificity detection of CD83 protein; it can be used to prepare drugs targeting CD83 protein; it can be used as reagents or drugs for diagnosis and treatment of abnormal CD83 expression, etc., and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is a data diagram of affinity detection between nucleic acid aptamer SEQ ID NO.1 and CD83 protein in Example 2;

[0046] Figure 2 This is a data diagram of affinity detection between nucleic acid aptamer SEQ ID NO.2 and CD83 protein in Example 2;

[0047] Figure 3 This is a data diagram of affinity detection between nucleic acid aptamer SEQ ID NO.3 and CD83 protein in Example 2;

[0048] Figure 4 This is a data diagram of affinity detection between nucleic acid aptamer SEQ ID NO.4 and CD83 protein in Example 2;

[0049] Figure 5 This is a data diagram of affinity detection between nucleic acid aptamer SEQ ID NO.5 and CD83 protein in Example 2;

[0050] Figure 6 This is a data diagram of affinity detection between nucleic acid aptamer SEQ ID NO.6 and CD83 protein in Example 2;

[0051] Figure 7 This is the affinity test data diagram of nucleic acid aptamer SEQ ID NO.6 and Trop2 protein in Example 3;

[0052] Figure 8 This is a data diagram of affinity detection between nucleic acid aptamer SEQ ID NO.6 and nectin4 protein in Example 3;

[0053] Fig. 9 This is a schematic diagram of the results of the dot blot hybridization experiment based on nucleic acid aptamers in Example 4 to detect CD83 protein. DETAILED DESCRIPTION

[0054] The following will be combined with the drawings in the embodiments of the present application to clearly describe the technical solutions in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments in the present application belong to the scope of protection of this application.

[0055] In the description of the present application, it should be noted that the terms used herein are only for describing specific embodiments, and are not intended to limit the exemplary embodiments according to the present application. For ease of description, the sizes of the various parts shown in the drawings are not drawn according to the actual proportional relationship. The technology, methods and equipment known to ordinary technicians in the relevant field may not be discussed in detail, but in appropriate cases, the technology, methods and equipment should be regarded as part of the authorization specification. In all examples shown and discussed here, any specific value should be interpreted as merely exemplary, rather than as a limitation. Therefore, other examples of the exemplary embodiments may have different values. It should be noted that similar numbers and letters represent similar items in the following drawings, so once an item is defined in one drawing, it does not need to be further discussed in subsequent drawings.

[0056] It should be noted that the terms "first", "second", etc. in the specification and claims of the present application are used to distinguish similar objects, and are not used to describe a specific order or sequence. It should be understood that the data used in this way can be interchangeable under appropriate circumstances, so that the embodiments of the present application can be implemented in an order other than those illustrated or described here, and the objects distinguished by "first", "second", etc. are generally of one type, and the number of objects is not limited. For example, the first object can be one or more. In addition, "and / or" in the specification and claims represents at least one of the connected objects, and the character " / " generally indicates that the objects associated with each other are in an "or" relationship.

[0057] It should be noted that, in the description of the present application, the orientation or positional relationship indicated by terms such as "front, back, up, down, left, right", "lateral, vertical, perpendicular, horizontal" and "top, bottom" are usually based on the orientation or positional relationship shown in the drawings, and are only for the convenience of describing the present application and simplifying the description. Unless otherwise stated, these orientation words do not indicate or imply that the device or element referred to must have a specific orientation or be constructed and operated in a specific orientation, and therefore cannot be understood as limiting the scope of protection of the present application; the orientation words "inside and outside" refer to the inside and outside relative to the contour of each component itself.

[0058] It should be noted that, in the present application, the terms "comprise", "include" or any other variant thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, an element defined by the sentence "comprises one..." does not exclude the presence of other identical elements in the process, method, article or device including the element. In addition, it should be noted that the scope of the method and device in the embodiment of the present application is not limited to performing functions in the order shown or discussed, and may also include performing functions in a substantially simultaneous manner or in reverse order according to the functions involved, for example, the described method may be performed in an order different from that described, and various steps may also be added, omitted, or combined. In addition, the features described with reference to certain examples may be combined in other examples.

[0059] Example 1: Screening of ssDNA nucleic acid aptamers binding to CD83 protein

[0060] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequence:

[0061] Random single-stranded DNA library:

[0062] 5'-ATTGGCACTCCACGCATAGG(36N)CCTATGCGTGCTACCGTGAA-3'(SEQ ID NO.5);

[0063] Among them, "36N" represents a sequence formed by connecting 36 arbitrary nucleotide bases. The library was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0064] Primer information is shown in Table 1 and was synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0065] Table 1. Primers and their sequences

[0066]

[0067]

[0068] Among them, S in the primer name represents the forward primer, and A in the primer name represents the reverse primer.

[0069] The primers were prepared into 100 μM storage solution with DPBS buffer (calcium chloride 0.1 g / L, potassium chloride 0.2 g / L, potassium dihydrogen phosphate 0.2 g / L, magnesium chloride hexahydrate 0.1 g / L, sodium chloride 8 g / L, sodium hydrogen phosphate dodecahydrate 2.8915 g / L; pH 7.4, 25°C) and stored at -20°C for later use.

[0070] 2. Magnetic bead screening

[0071] The magnetic bead method was used for screening, with a total of 6 rounds of screening. The screening process of each round is shown in Table 2.

[0072] Table 2. CD83 protein aptamer screening process

[0073] Number of rounds Anti-screening Buffer solution First round Conjugated His magnetic beads DPBS buffer Round 2 Conjugated His magnetic beads DPBS buffer Round 3 Conjugated His magnetic beads DPBS buffer Round 4 Conjugated His magnetic beads DPBS buffer Fifth round Conjugated His magnetic beads DPBS buffer with 5% serum Round 6 Conjugated His magnetic beads DPBS buffer with 10% serum

[0074] The specific screening process is as follows:

[0075] 1) Carboxyl magnetic beads to immobilize CD83 protein

[0076] Take 50 μl of carboxyl magnetic beads (Jiangsu Zecheng Biotechnology Co., Ltd., catalog number: FM2221), wash them 4 times with 200 μl of ultrapure water, fish the beads with a magnet, and remove the supernatant. Take 100 μl of each of the prepared NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution), mix them in equal volumes, add them to the magnetic beads, incubate at 25°C for 20 minutes to activate the carboxyl groups on the surface of the magnetic beads, and wash the magnetic beads twice with DPBS buffer for later use.

[0077] Take 10 μl of CD83 protein (purchased from Wuhan Abotek Biotechnology Co., Ltd., RP00983, concentration 1 mg / ml), add 80 μl of 10 mM sodium acetate at pH 4.5, mix well, and add to the above activated magnetic beads. Incubate at 25°C on a vertical mixer for 60 minutes, and the CD83 protein is coupled to the surface of the magnetic beads through the amino groups on the protein surface.

[0078] After the coupling is completed, place the coupling tube on a magnetic stand, discard the supernatant, take 100μl 1M ethanolamine pH8.5 and add it to the magnetic beads, incubate on a 25℃ vertical mixer for 10 minutes to block the unreacted activation sites on the surface of the magnetic beads. Place on a magnetic stand and discard the blocking solution. Wash the magnetic beads 4 times with 200μl DPBS and mark them as MB-CD83.

[0079] 2) Counter-screening and screening

[0080] Preparation of counter-screening magnetic beads: The His protein is coupled to the magnetic beads. The steps of coupling the His protein are the same as those of coupling the CD83 protein. The concentration of the His protein is 1 mg / ml, and it is diluted with a 10 mM NaAC solution at pH 4.5. Specifically, take 10 μl of His protein and add 80 μl of a 10 mM NaAC solution at pH 4.5 and mix well. The rest of the steps are the same. The coupled magnetic beads are labeled MB-His.

[0081] Library dissolution and denaturation treatment: Take 1OD random single-stranded nucleotide library, centrifuge at 14000rpm for 5 minutes, centrifuge the library to the bottom of the tube, dissolve it to 10μM with DPBS buffer, mix it and dispense it into PCR tubes for denaturation treatment. The treatment process is as follows: The PCR instrument is set to maintain 95℃ for 10 minutes. The purpose of this step is to unwind the folded chain, then maintain it at 4℃ for 5 minutes, and then balance it to room temperature. Add the treated library to 50μl MB-His magnetic beads, mix it and incubate it at room temperature for a period of time on a vertical mixer. Place it on a magnetic stand, collect the supernatant, mark it as pool-, and use the supernatant as a single-stranded nucleic acid library for positive screening with MB-CD83 magnetic beads. In each round of magnetic bead screening, MB-his is used for counter-screening before the positive screening targeting CD83 protein, and the counter-screening supernatant is used as a single-stranded nucleotide library for positive screening with MB-CD83 magnetic beads. Specifically, add the pool- of the library after counter-screening to 50 μl MB-CD83 magnetic beads and incubate them on a vertical mixer at 25°C for 40 minutes. Place them on a magnetic stand, discard the supernatant, retain the magnetic beads, and wash the magnetic beads 4 times with 200 μl DPBS. Finally, add 200 μl DPBS to the washed magnetic beads, boil them in a boiling water bath for 10 minutes, collect the supernatant, and mark it as elution-CD83.

[0082] The nucleic acid molecules in elution-CD83 were used as templates and amplified by ordinary PCR. The method is as follows: add all template elution-CD83 to 2ml PCR mix and mix well. Add the template and PCR mix mixture into 100μl / tube and add it to the PCR tube. The amplification conditions are as follows: 95℃ pre-denaturation for 2 minutes, 95℃ denaturation for 60 seconds, 60℃ annealing for 60 seconds, 72℃ extension for 60 seconds, a total of 25 cycles, and store at 4℃. PCR mix is ​​prepared with dNTPs (P031-02) purchased from Novozymes and rTaq enzyme (R500Z) purchased from Takara Biotech.

[0083] The amplified product was purified using commercially purchased Tiandirenhe SA magnetic beads (SM017100) to prepare a secondary library for the next round of screening. Add 1 / 5 volume of 4M sodium chloride to 2mL of PCR product, and then add 160uL of SA magnetic beads that have been washed with DPBS and the supernatant removed. After incubation on a shaker at room temperature for 30 minutes, remove the supernatant of the PCR product. Wash the magnetic beads three times with DPBS containing 0.02% Tween20, add 100uL of 40mM sodium hydroxide solution after removing the supernatant, and remove the magnetic beads by magnetic attraction after incubation for three minutes. Then add 4uL of 1M hydrochloric acid to the supernatant to neutralize the single chain, and then add 104uL of 2*DPBS to dilute and neutralize the salt concentration, and finally obtain 208uL of the secondary library dissolved in 1*DPBS, which can be used as the library for the next round of screening.

[0084] The magnetic bead method was repeated for 6 rounds of screening, and each operation used the secondary library obtained in the previous operation as the starting nucleic acid library. After the library was denatured and renatured, it was incubated with MB-CD83 magnetic beads. The screening process obtained the libraries of the 1st, 2nd, 3rd, 4th, 5th and 6th rounds, which met the sequencing requirements, and the obtained libraries were constructed and analyzed by high-throughput sequencing.

[0085] 3. Analysis and identification of nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the obtained enriched library products, several sequences were selected and synthesized by Genewise Biotechnology (Jiangsu) Technology Co., Ltd., and the affinity was tested.

[0086] In subsequent tests, six sequences with the strongest binding ability were identified from the 1560 sequences obtained in the final sixth round, which were nucleic acid aptamers having nucleotide sequences shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.

[0087] Example 2: Surface Plasmon Resonance (SPR) Detection of the Affinity of CD83 Protein Aptamers and CD83 Protein

[0088] Suzhou Jinweizhi Biotechnology Co., Ltd. was commissioned to synthesize nucleic acid aptamers SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, which were diluted to 500 nM with DPBS buffer respectively.

[0089] 1. Couple the CD83 protein to the second channel on the surface of the CM5 chip. The specific method is as follows: first wash the chip with 50mM NaOH, inject 20μl, flow rate 10μl / min, then mix equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and inject 50μl to activate the chip, flow rate 5μl / min. Dilute the CD83 protein with 10mM sodium acetate at pH 4.0 to a final concentration of 50μg / mL and inject it, the injection volume is 50μL, the flow rate is 5μL / min, and the CD83 protein coupling amount is 3500Ru. After the injection is completed, inject ethanolamine to block the chip, flow rate 10μL / min, and inject 100μL. The first channel is treated as above, the steps of coupling His protein, activation and blocking steps are exactly the same, as the control channel.

[0090] 2. Detection: Use a surface plasmon resonance instrument (GE Healthcare, model: Biacore 8K) to set the detection parameters. The diluted 6 aptamer samples flow through channels 1 and 2 in turn. The program for each aptamer is as follows: injection 30 μL / min, time 3 minutes, dissociation 30 μL / min, time 3 minutes, regeneration 1M NaCl 30 μL / min, time 30 seconds, and the diluted 6 nucleic acid aptamers are injected in turn.

[0091] The affinity test data of nucleic acid aptamers SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 with CD83 protein are shown in Figures 1 to 6 ,in Figure 1 This is the affinity test diagram of SEQ ID NO.1 and CD83 protein; Figure 2 This is the affinity test diagram of SEQ ID NO.2 and CD83 protein; Figure 3 This is the affinity test diagram of SEQ ID NO.3 and CD83 protein; Figure 4 This is the affinity test diagram of SEQ ID NO.4 and CD83 protein; Figure 5 This is the affinity test diagram of SEQ ID NO.5 and CD83 protein; Figure 6 The affinity test diagram of SEQ ID NO.6 and CD83 protein. The KD values ​​of the affinity of these nucleic acid aptamers and CD83 protein are shown in Table 3 below, respectively, which illustrate the binding ability of the corresponding nucleic acid aptamers with the target protein CD83 protein. These data show that these nucleic acid aptamers are detected to have strong binding with CD83 protein by SPR instrument.

[0092] Table 3. Affinity of nucleic acid aptamers and CD83 protein

[0093]

[0094]

[0095] As can be seen from Table 3, the nucleic acid aptamers SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 provided by the present invention all have high affinity to CD83 protein (the smaller the KD value, the greater the affinity), especially SEQ ID NO.6 has the highest affinity to CD83.

[0096] Example 3: Study on the specificity of nucleic acid aptamers

[0097] In this example, SEQ ID NO.6 was selected from the six nucleic acid aptamers for specificity study, and Trop2 protein and nectin4 protein were used to replace CD83 protein, respectively, in the same way as the method of fixing CD83 protein to the SPR chip for testing in Example 2. Trop2 protein and nectin4 protein were coupled to the second channel of four Channals on the surface of the CM5 chip, respectively, with coupling amounts of 2827RU and 3801RU, respectively, and the diluted SEQ ID NO.6 nucleic acid aptamer was injected.

[0098] The affinity test data of nucleic acid aptamer SEQ ID NO.6 and Trop2 protein are shown in Figure 7 The affinity test data with nectin4 protein can be found in Figure 8 ;Depend on Figure 7 and Figure 8 It can be seen that the nucleic acid aptamer cannot bind to Trop2 protein and nectin4 protein, which shows that it has very good specificity.

[0099] Example 4: Detection of CD83 protein by dot blot hybridization assay based on nucleic acid aptamers

[0100] In this example, SEQ ID NO.6 among the six nucleic acid aptamers was selected for dot blot hybridization test. The steps of the dot blot hybridization test for the nucleic acid aptamer are as follows:

[0101] 1. Take two 8cm×2cm nitrocellulose membranes (purchased from Millipore), dissolve CD83 protein in DPBS buffer to 0.500mg / mL, 0.250mg / mL, 0.125mg / mL, 0.063mg / mL, 0.032mg / mL, 0.016mg / mL, and dissolve control proteins Trop2, his, FAP, EGFR, and nectin4 in DPBS buffer to 0.500mg / mL. Spot 2ul of the test sample and control sample on the nitrocellulose membrane and air dry for 40min.

[0102] 2. Then put the test strip into a 5mL centrifuge tube, add 3mL of 10% BSA to soak it, block it for 1h, and wash it with DPBS-T (DPBS containing 5mM Mg(2+) and 0.02% Tween20) for 5min after blocking. Repeat the washing for 3 times and aspirate it clean.

[0103] 3. Transfer the test strip to a new 5 mL centrifuge tube, add 3 mL of DPBS buffer (containing 5 mM Mg(2+)) dissolved with biotin-modified nucleic acid aptamer (500 nM) (SEQ ID NO.11) to soak it, incubate for 30 min, wash with DPBS-T for 2 min after incubation, repeat washing 3 times, and aspirate clean.

[0104] 4. Transfer the test strip to a new 5 mL centrifuge tube, dilute HRP-Streptavidin (purchased from BeyotimeBiotech 1 mg / ml): DPBS buffer at a ratio of 1:2000, take 3 mL and add it to soak it, incubate for 30 minutes. After the incubation, wash it with DPBS-T for 2 minutes, repeat the washing 3 times, and aspirate it clean.

[0105] 5. Transfer the test strip to a clean PE glove, take the ECL color development kit (purchased from Beyotime Biotech), mix 100uL of solution A and 100uL of solution B, soak the surface of the test strip, and incubate for 5 minutes.

[0106] 6. Imaging system observation and photography: The instrument used is ImageQuant from GE Healthcare Life Sciences TM LAS 4000 digital imaging system.

[0107] The results are as follows Fig. 9 As shown by Fig. 9It can be seen that compared with the spots of control proteins TROP2, his, FAP, EGFR and nectin4, the spots of CD83 protein are more obvious, which indicates that the biotin-modified nucleic acid aptamer can be used for the detection of membrane hybridization CD83 protein and does not bind to the control proteins TROP2, his, FAP, EGFR and nectin4.

[0108] from Fig. 9 It can also be seen that the nucleic acid aptamer provided in this embodiment can only bind to CD83 protein, and cannot bind to other proteins such as TROP2, his, FAP, EGFR, and nectin4, and has high specificity.

[0109] It can also be proved that the nucleic acid aptamer can be used to accurately detect 0.500 mg / mL, 0.250 mg / mL, 0.125 mg / mL, 0.063 mg / mL, 0.032 mg / mL, and 0.016 mg / mL of CD83 protein.

[0110] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

[0111] Sequence Listing

[0112] SEQ ID NO.1

[0113] ATTGGCACTCCACGCATAGGCTCGCTCGTGGTTTGGTTGGGCTGGTTAGAGCTCCCCTATGCGTGCTACCGTGAA

[0114] SEQ ID NO.2

[0115] ATTGGCACTCCACGCATAGGGGGCATCGTTTTGGTTGGACTGGTTTTGGTGTGTCCGCCTATGCGTGCTACCGTGAA

[0116] SEQ ID NO.3

[0117] ATTGGCACTCCACGCATAGGCGATCTGGGGTTGGGGTTTGGTGGTTGAGGGTAAGGCCTATGCGTGCTACCGTGAA

[0118] SEQ ID NO.4

[0119] ATTGGCACTCCACGCATAGGCTACTTGGGGTTGGAGGTCTGGGGTTGGGGTATTGCCCTATGCGTGCTACCGTGAA

[0120] SEQ ID NO.5

[0121] ATTGGCACTCCACGCATAGGCCGAGCGTTTGGTTGGTCTGGTTTGGAGCTCTTACGCCTATGCGTGCTACCGTGAA

[0122] SEQ ID NO.6

[0123] ATTGGCACTCCACGCATAGGCTGGGTGGGTGGGTATGTGGTGGTTGGAGGGGGCGACCTATGCGTGCTACCGTGAA

[0124] SEQ ID NO.7

[0125] ATTGGCACTCCACGCATAGG

[0126] SEQ ID NO.8

[0127] FAM-ATTGGCACTCCACGCATAGG

[0128] SEQ ID NO.9

[0129] Biotin-TTCACGGTAGCACGCATAGG

[0130] SEQ ID NO.10

[0131] TTCACGGTAGCACGCATAGG

[0132] SEQ ID NO.11

[0133] Biotin-ATTGGCACTCCACGCATAGGCTGGGTGGGTGGGTATGTGGTGGTTGGAGGGGGCGACCTATGCGTGCTACCGTGAA

Claims

1. A nucleic acid aptamer that binds to CD83 protein, characterized in that: A nucleotide sequence having a nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.6; or a nucleotide sequence having at least 30% homology with any one of SEQ ID NO.1 to SEQ ID NO.6 and binding to CD83 protein; or an RNA sequence transcribed from the nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.

6.

2. A conjugate or derivative of a nucleic acid aptamer, wherein the nucleic acid aptamer has a nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.6; the conjugate of the nucleic acid aptamer includes a fluorescent marker; the derivative of the nucleic acid aptamer includes a thiophosphate backbone or peptide nucleic acid that binds to the CD83 protein, which is modified from the nucleotide sequence backbone of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.

3. Use of the nucleic acid aptamer according to any one of claims 1 or the conjugate or derivative of the nucleic acid aptamer according to claim 2 for preparing a reagent for detecting or purifying CD83 protein.

4. Use of the nucleic acid aptamer according to any one of claims 1 or the conjugate or derivative of the nucleic acid aptamer according to claim 2 for preparing a drug targeting CD83 protein.

5. A product for detecting CD83 protein, characterized in that: It includes the nucleic acid aptamer according to any one of claim 1, or the conjugate or derivative of the nucleic acid aptamer according to claim 2; the product includes any one or more of a kit, a detection chip, and a chromatography detection device.

6. A product for purifying CD83 protein, characterized in that: It includes the nucleic acid aptamer according to any one of claim 1, or the conjugate or derivative of the nucleic acid aptamer according to claim 2; the product includes any one or more of a kit, a detection chip, and a chromatography detection device.

7. A method for screening nucleic acid aptamers that bind to CD83 protein, characterized in that: The following steps are involved: Step S1, synthesizing a random single-stranded DNA library and primers; Step S2, magnetic bead screening: perform at least 6 rounds of counter-screening and screening, and start adding serum from the 5th round.

8. The method for screening a nucleic acid aptamer binding to CD83 protein according to claim 7, characterized in that: The step S2 of adding serum after the fifth round specifically includes: adding 5% serum in the fifth round and adding 10% serum in the sixth round; the serum is human serum.

Images