Circular RNA (Ribonucleic Acid) and application thereof in tumor diagnosis and treatment

Abstract

The invention discloses a circular RNA (Ribonucleic Acid) and application thereof in tumor diagnosis and treatment. Specifically, the invention discloses a circular RNA derived from an FRMD4A gene, the circular RNA can significantly inhibit the growth and progress of colorectal and breast cancer cells, and the circular RNA has a high expression level and is related to better prognosis. The circular RNA can promote the sensitivity of cancer cells to copper death. Mechanism analysis shows that the circular RNA interacts with pyruvate kinase PKM2 and inhibits the activity of the pyruvate kinase PKM2, thereby causing inhibition of glycolysis and transfer of glycolysis flux to tricarboxylic acid (TCA) circulation.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and biomedicine. Specifically, the present invention relates to a circular RNA and its application in tumor diagnosis and treatment. Background Art

[0002] Tumor molecular diagnosis refers to molecular biological diagnostic technology with nucleic acid or protein as the core, which is an important method for early diagnosis of tumors. By detecting biomacromolecules related to tumor occurrence, tumor occurrence can be predicted and diagnosed, and the effect of tumor treatment can be evaluated, providing a reference for the prognosis and outcome of tumors. Tumor markers refer to substances produced by tumors or by tumors stimulating host cells, which can reflect the occurrence, development and response to anti-tumor treatment of tumors. The level of its expression in cells or the change of its content in body fluids is closely related to the occurrence, development and transformation of tumors. Tumor markers that have been discovered so far include embryonic proteins, glycoproteins, enzymes and isoenzymes, hormones, special proteins and cancer-related genes.

[0003] Tumor-related genes include proto-oncogenes (cellular oncogenes) and tumor suppressor genes. Proto-oncogenes are genes that are widely present in cells, have highly conserved sequences, and are often in a state of low expression or non-expression. Genes that are activated through the acquisition of promoters and enhancers, gene translocation, proto-oncogene amplification, point mutations, gene methylation changes, etc. are called oncogenes, and can generate nuclear transcription factors, intracellular signal transduction factors, transmembrane growth factor receptors or extracellular growth factors to induce cell carcinogenesis. Tumor suppressor genes are a type of gene that can inhibit excessive cell growth and curb tumor formation when expressed normally; when they are inhibited, inactivated, lost, or the expression product loses function, cells can lose control and undergo malignant transformation. The inactivation of tumor suppressor genes is manifested in tumor suppressor gene point mutations, tumor suppressor gene promoter hypermethylation, mixed deletions, abnormal gene amplification, and chromosomal abnormalities.

[0004] The tumor suppressor p53 maintains genome integrity and prevents tumorigenesis by transcriptionally regulating the expression of genes involved in the cell cycle and DNA damage repair. However, when cells suffer irreversible damage, p53 can trigger various forms of regulated cell death (RCD) to eliminate these cells. The pro-apoptotic function of p53 was first described in 1991 and subsequently validated in mouse embryonic fibroblasts (MEFs). It has been well documented that p53 activates the transcription of pro-apoptotic genes of the BCL-2 family, such as PUMA, NOXA, and BAX, while inhibiting the expression of anti-apoptotic genes of the BCL-2 family, such as BCL-2, BCL-XL, and MCL15. p53 also physically interacts with some mitochondrial proteins to enhance apoptosis. Recently, p53 has been found to be a key regulator of ferroptosis. On the one hand, p53 promotes ferroptosis by reducing the biosynthesis of glutathione (GSH) or regulating multiple metabolic pathways related to polyunsaturated fatty acid peroxidation, glutamine catabolism, or vitamin K metabolism. On the other hand, p53 protects cells from ferroptosis by increasing GSH levels through enhancing the expression of p2116 and TIGAR17 or detoxifying lipid peroxidation through activating iPLA2β expression. In addition, p53 plays a role in regulating many other types of RCD, including necroptosis, PARP-1-dependent cell death, and autophagic cell death.

[0005] Copper death is a form of cell death that depends on copper and occurs primarily in cells that rely on mitochondrial metabolism for energy production. Several hypotheses have been proposed that p53 may play a role in the regulation of copper death. First, p53 is an important regulator of glycolysis that inhibits glycolysis and promotes the tricarboxylic acid (TCA) cycle and oxidative phosphorylation. For example, p53 inhibits the activity of the glycolysis rate-limiting enzymes hexokinase HK220 and phosphofructokinase PFKM17 or PFKP21, thereby inhibiting the glycolysis process in cancer cells. At the same time, p53 also promotes the production of acetyl-CoA22 or glutamate to provide energy for the TCA cycle. Second, p53 may promote the biosynthesis of iron-sulfur cluster proteins, which are degraded during copper death. Finally, p53 controls the biosynthesis of glutathione (GSH), which is not only a potent antioxidant but also a natural copper chelator. Although the above studies suggest that there may be a link between p53 and copper death, how p53 controls copper death and the factors involved in this regulation remain uncertain.

[0006] Therefore, those skilled in the art are committed to studying the tumor suppressor p53 signaling pathway in order to obtain newer tumor markers and / or tumor treatment targets. Summary of the invention

[0007] The purpose of the present invention is to provide a circular RNA and its use in tumor diagnosis and treatment.

[0008] In the first aspect of the present invention, a circular RNA is provided, wherein the sequence of the circular RNA is selected from the group consisting of:

[0009] (A) the polynucleotide sequence shown in SEQ ID NO.1;

[0010] (B) a polynucleotide sequence formed by replacing, deleting or adding one or more nucleotides of the polynucleotide sequence shown in SEQ ID NO.1;

[0011] (C) is a polynucleotide sequence having a homology of ≥90%, preferably ≥95%, more preferably ≥98%, and most preferably ≥99% compared to the polynucleotide sequence shown in SEQ ID NO.: 1;

[0012] (D) A polynucleotide sequence complementary to the polynucleotide sequence described in any one of (A) to (C).

[0013] In the second aspect of the present invention, there is provided a use of the circular RNA or an activator thereof according to the first aspect of the present invention, for:

[0014] (1) Preparation of drugs for preventing or treating tumors;

[0015] (2) preparing PKM2 inhibitors;

[0016] (3) preparing reagents that reduce cellular glycolysis levels;

[0017] (4) preparing a reagent for enhancing the copper death sensitivity of tumor cells; or

[0018] (5) Prepare a reagent for inhibiting pyruvate kinase (PK) activity.

[0019] In another preferred embodiment, the circular RNA is derived from mammals (including humans).

[0020] In another preferred embodiment, the activator of the circular RNA is a substance that can increase the level of the circular RNA in the cell; for example, a compound, a protein, a nucleic acid (including DNA and RNA), or a combination thereof.

[0021] In another preferred embodiment, the tumor is a p53 wild-type tumor.

[0022] In another preferred embodiment, the tumor is colorectal cancer or breast cancer.

[0023] In another preferred embodiment, the PKM2 inhibitor inhibits the tetramerization of PKM2.

[0024] In the third aspect of the present invention, a pharmaceutical composition is provided, comprising a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is the circular RNA, its activator, or a vector or cell expressing the circular RNA as described in the first aspect of the present invention.

[0025] In another preferred embodiment, the pharmaceutical composition is used to prevent or treat tumors.

[0026] In another preferred embodiment, the tumor is a p53 wild-type tumor.

[0027] In another preferred embodiment, the tumor is colorectal cancer or breast cancer.

[0028] In a fourth aspect of the present invention, there is provided a use of the circular RNA or a detection reagent thereof according to the first aspect of the present invention, for preparing a tumor detection kit.

[0029] In another preferred embodiment, the tumor detection kit is used to determine (or assist in determining) the prognosis of a tumor.

[0030] In the fifth aspect of the present invention, a method for non-therapeutic inhibition of tumor cells in vitro is provided, comprising the steps of: culturing tumor cells in the presence of the circular RNA described in the first aspect of the present invention, thereby inhibiting the tumor cells; or overexpressing the circular RNA described in the first aspect of the present invention in the tumor cells, thereby inhibiting the tumor cells.

[0031] In another preferred embodiment, the tumor is a p53 wild-type tumor.

[0032] In another preferred embodiment, the tumor is breast cancer or colorectal cancer; preferably, the tumor cells are CAL-51 breast cancer cells, MCF-7 breast cancer cell line, or HCT116 colorectal cancer cell line.

[0033] In another preferred embodiment, the inhibition of tumor cells is the inhibition of tumor cell growth or the inhibition of tumor cell tumorigenesis.

[0034] In another preferred embodiment, compared with control tumor cells, the level of the circular RNA described in the first aspect of the present invention in the tumor cells is increased by more than 10%, preferably more than 20%, more preferably more than 30%, more preferably more than 40%, more preferably more than 50%, more preferably more than 60%, more preferably more than 70%, more preferably more than 80%, and more preferably more than 90%.

[0035] In the sixth aspect of the present invention, a vector is provided, wherein the vector contains the circular RNA sequence described in the first aspect of the present invention.

[0036] In another preferred embodiment, the vector is the circular RNA expression vector pLCDH-ciR.

[0037] The seventh aspect of the present invention provides a host cell, wherein the host cell contains the vector or chromosome described in the sixth aspect of the present invention integrated with the circular RNA sequence described in the first aspect.

[0038] In another preferred embodiment, the host cell expresses the circular RNA described in the first aspect of the present invention.

[0039] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The following drawings are used to illustrate specific embodiments of the present invention and are not used to limit the scope of the present invention defined by the claims.

[0041] Figure 1A-1M .Identification of the cancer-associated circular RNA circFRMD4A.

[0042] ( Figure 1A ) Expression microarray analysis revealed the top 20 circular RNAs that were upregulated in CAL51 cells treated with 5-FU, cisplatin, or Nutlin-3 compared with DMSO. Figure 1B ) Representative images of in situ hybridization (ISH) staining of circFRMD4A (hsa_circ_0004183) in normal and colorectal cancer tissues. ( Figure 1C ) Statistical analysis of ISH scores of circFRMD4A in 20 pairs of matched colorectal cancer tissues. ( Figure 1D ) Overall survival analysis of 80 patients with colorectal cancer based on ISH score. Figure 1E ) Schematic diagram of circFRMD4A and its parent gene, and the results of Sanger sequencing verification. ( Figure 1F , Figure 1G ) in HCT116( Figure 1F ) and CAL51( Figure 1G ) cells, using forward primers and reverse primers located around the junction, confirmed the circular structure of circFRMD4A. Figure 1H , Fig. 1I )RT-qPCR analysis showed that HCT116( Figure 1H ) and CAL51( Fig. 1I) Expression of circFRMD4A, linear FRMD4A and p21 mRNA in cells with or without RNase R treatment. ( Figure 1J , Figure 1K )RT-qPCR analysis showed that HCT116( Figure 1J ) and CAL51( Figure 1K ) Expression of circFRMD4A, linear FRMD4A, and p21 mRNA in cells treated with actinomycin D for the indicated time. ( Figure 1L , Figure 1M ) Nuclear / cytoplasmic separation showed that circFRMD4A was expressed in HCT116 ( Figure 1L ) and CAL51( Figure 1M ) Subcellular localization in cells. U1, ACTB and circNSUN2 were used as references for comparison. *p<0.05, **p<0.01, ***p<0.001.

[0043] Figure 2 .The expression of circFRMD4A in breast cancer tissues was also lower than that in normal tissues.

[0044] Figure 3A-Figure 3U .The RNA-binding protein EWSR1 promotes the formation of circFRMD4A.

[0045] ( Figure 3A ) Predicted RNA binding proteins that may bind to the flanking regions of circFRMD4A. Figure 3B , C) RT-qPCR analysis showing the expression of circFRMD4A in CAL51 and MCF-7 cells transfected with the indicated siRNAs. ( Figure 3D -F) RT-qPCR analysis showed that HCT116 cells transfected with empty vector or Myc-EWSR1 ( Figure 3D )、CAL51( Figure 3E ) and MCF-7( Figure 3F )The expression of circFRMD4A in cells. Figure 3G ) Predicted binding sites of EWSR1 in the flanking regions of circFRMD4A. ( Figure 3H , Fig. 3I ) RIP-qPCR experiments revealed that in HCT116 ( Figure 3H ) and CAL51( Fig. 3I ) cells, EWSR1 bound to both the upstream and downstream regions of circFRMD4A. Figure 3J , Figure 3K )RT-qPCR analysis showed the expression of EWSR1 when cancer cells were treated with DMSO, 5-FU or Nutlin-3. ( Figure 3L , Figure 3M)RT-qPCR analysis shows the expression of EWSR1 when cancer cells were transfected with control or p53 siRNA. ( Figure 3N , Fig.3O ) Expression of EWSR1 in colorectal cancer and breast cancer samples from TCGA database. ( Figure 3P , Figure 3Q ) Correlation between EWSR1 expression and prognosis in patients with colorectal cancer or breast cancer from TCGA database. ( Figure 3R , Figure 3S )HCT116 and CAL51 cells were transfected with siNC or siEWSR1, and then cell viability was assayed. Figure 3T , Figure 3U )HCT116 and CAL51 cells were transfected with siNC or siEWSR1 and treated with Nutlin-3, followed by cell viability assay. *p<0.05, **p<0.01, ***p<0.001.

[0046] Figure 4A-4J .Exogenous circFRMD4A inhibits the growth, survival and proliferation of colorectal cancer and breast cancer cells.

[0047] ( Figure 4A , Figure 4B )RT-qPCR analysis showed the expression of circFRMD4A and FRMD4A mRNA in HCT116 and CAL51 cells transfected with empty vector or pLCDH-circFRMD4A. ( Figure 4C-Figure 4H )HCT116 and CAL51 cells were transfected with empty vector or pLCDH-circFRMD4A, and then cell viability assay was performed ( Figure 4C , Figure 4D ), clone formation experiment ( Figure 4E ), flow cytometry analysis ( Figure 4F )、Transwell migration( Figure 4G ) and invasion ( Figure 4H )experiment.( Figure 4I-Figure 4K ) Growth rate of xenograft tumors stably overexpressing empty vector or pLCDH-circFRMD4A ( Fig. 4I ),weight( Figure 4J ) and size ( Figure 4K ). Fig. 4I and Figure 4J The data are expressed as mean ± SD, n = 6. *p < 0.05, **p < 0.01, ***p < 0.001.

[0048] Figure 5A-5J.Exogenous circFRMD4A inhibits the growth, survival and proliferation of RKO and MCF-7 cancer cells. ( Figure 5A , Figure 5B )RT-qPCR analysis of the expression of circFRMD4A and FRMD4A mRNA in RKO and MCF-7 cells transfected with empty vector or pLCDH-circFRMD4A. Figure 5C-5H ) RKO and MCF-7 cells were transfected with empty vector or pLCDH-circFRMD4A, and then cell viability assay was performed ( Figure 5C , Figure 5D ), colony formation assay ( Figure 5E ), flow cytometry ( Fig. 5F ) and transwell migration ( Figure 5G ) and invasion ( Figure 5H ) determination. Fig.5I )RTqPCR verified the stable overexpression of circFRMD4A in HCT116 cells. Figure 5J ) Body weight of nude mice bearing xenograft tumors. **p<0.01, ***p<0.001.

[0049] Figure 6A-6J .Knockdown of circFRMD4A promotes the growth, survival, and proliferation of HCT116 and CAL51 cancer cells. ( Fig. 6A , Figure 6B )RT-qPCR analysis of the expression of circFRMD4A and FRMD4A mRNA in HCT116 and CAL51 cells transfected with siNC or sicircFRMD4A. Figure 6C -H) HCT116 and CAL51 cells were transfected with siNC or sicircFRMD4A, and then subjected to cell viability assay ( Figure 6C , D), colony formation assay ( Fig. 6E ), flow cytometry ( Fig. 6F ) and transwell migration ( Figure 6G ) and invasion ( Figure 6H ) determination. Fig.6I -K) Growth rate of xenograft tumors stably overexpressing shNC or shcircFRMD4A ( Fig.6I ),weight( Figure 6J ) and size ( Figure 6K ). Fig.6I )and( Figure 6J ) are expressed as mean ± SD, n = 6. *p < 0.05, **p < 0.01, ***p < 0.001.

[0050] Figure 7A-7J.Knockdown of circFRMD4A promotes the growth, survival, and proliferation of RKO and MCF-7 cancer cells. ( Fig. 7A , Figure 7B )RT-qPCR analysis of the expression of circFRMD4A and FRMD4A mRNA in RKO and MCF-7 cells transfected with siNC or sicircFRMD4A. Figure 7C-7H ) RKO and MCF-7 cells were transfected with siNC or sicircFRMD4A, and then cell viability assay was performed ( Figure 7C , Fig.7D ), colony formation assay ( Fig. 7E ), flow cytometry ( Figure 7F ) and transwell migration ( Figure 7G ) and invasion ( Figure 7H ) determination. Fig.7I )RT-qPCR validation of stable knockdown of circFRMD4A in HCT116 cells. Figure 7J ) Body weight of nude mice bearing xenograft tumors. *p<0.05, **p<0.01, ***p<0.001.

[0051] Figure 8A-8Q .circFRMD4A promotes the metabolic shift from glycolysis to the tricarboxylic acid cycle by inhibiting PKM2 activity.

[0052] ( Fig. 8A ) Schematic diagram of the positive strand of circFRMD4A used for RNA pull-down experiment (left). Silver staining experiment shows the protein pulled down by the biotin-labeled positive strand (right). Figure 8B , Figure 8C ) RIP-qPCR analysis confirmed the binding of circFRMD4A to PKM2 in HCT116 and CAL51 cells. Anti-Flag antibody was used to detect the binding of exogenous Flag-PKM2 to circFRMD4A ( Figure 8B ), while anti-PKM2 antibody was used to detect the binding of endogenous PKM2 to circFRMD4A ( Figure 8C ). This experiment used RT-qPCR primers targeting circFRMD4A. ( Fig.8D ) IB analysis of PKM2 expression by cross-linking using DSS after HCT116 cells were transfected with the indicated plasmids. ( Figure 8E-8J ) Pyruvate kinase activity was measured in HCT116 and CAL51 cells transfected with empty vector or circFRMD4A ( Fig. 8E , Fig.8F ), lactic acid ( Figure 8G , Figure 8H ) and mitochondrial citrate ( Figure 8I , Figure 8J ) level. Figure 8K )LC-MS analysis from 13 C-labeled glucose (1,2- 13 C2-glucose) metabolite levels. Figure 8L-Figure 8O ) Measurement of lactate in HCT116 and CAL51 cells transfected with the indicated plasmids ( Figure 8L , Figure 8M ) and mitochondrial citrate ( Figure 8N , Fig.8O ) level. Figure 8P , Figure 8Q ) HCT116 and CAL51 cells were treated with different doses of Elesclomol for 48 h in the presence of exposure to the indicated drug and plasmid combinations, followed by cell viability assay. *p<0.05, **p<0.01, ***p<0.001.

[0053] Figure 9A-9Q .circFRMD4A promotes the metabolic shift from glycolysis to TCA cycle by inhibiting PKM2 activity (related to Figure 8).

[0054] ( Figure 9A-9D ) RT-qPCR and IB analysis of PKM2 transfection efficiency in HCT116 and CAL51 cells. Fig.9E )IB analysis of PKM2 expression in HCT116 and CAL51 cells transfected with the indicated plasmids. Figure 9F-9K ) Pyruvate kinase activity was measured in HCT116 and CAL51 cells transfected with control or circFRMD4A shRNA ( Fig.9F , Figure 9G ), lactic acid ( Figure 9H , Fig.9I ) and mitochondrial citrate ( Figure 9J , Figure 9K ). Figure 9L )LC-MS analysis of unlabeled glucose metabolite levels. Figure 9M )1,2- 13 Schematic diagram of C2-glucose metabolites. ( Figure 9N-Figure 9Q ) Measurement of lactate in HCT116 and CAL51 cells transfected with the indicated shRNAs ( Figure 9N , Fig.9O ) and mitochondrial citrate ( Figure 9P , Figure 9Q ). *p<0.05, **p<0.01, ***p<0.001. DETAILED DESCRIPTION

[0055] After extensive and in-depth research, the inventors unexpectedly discovered a circular RNA (circRNA) derived from the FRMD4A gene and regulated by p53, named circFRMD4A. Studies have shown that circFRMD4A can significantly inhibit the growth and progression of colorectal and breast cancer cells, and higher circFRMD4A expression levels are associated with better prognosis. Surprisingly, circFRMD4A can promote the sensitivity of cancer cells to copper death. Mechanistic analysis shows that circFRMD4A interacts with pyruvate kinase PKM2 and inhibits its activity, resulting in the inhibition of glycolysis and the transfer of glycolytic flux to the tricarboxylic acid (TCA) cycle. On this basis, the present invention was completed.

[0056] the term

[0057] Circular RNA

[0058] Circular RNA (circRNA) is a type of single-stranded closed circular RNA molecule, which is produced by mRNA precursor (pre-mRNA) through alternative splicing (AS, Alternative Splicing), exon cyclization or intron cyclization). Endogenous circular RNA includes coding or non-coding RNA, does not contain a 5' end cap structure and a 3' end poly (A), lacks a free end, and is therefore not easily degraded by nuclease exonucleases and is more stable than linear RNA.

[0059] The human FRMD4A gene (NCBI sequence number Gene ID: 55691) is located on chromosome 10. The present invention found through genome analysis that the circular RNA (circFRMD4A) of the present invention is formed by reverse splicing of exons 16 to 21 of the maternal gene FRMD4A, and this result was verified by Sanger sequencing.

[0060] In a preferred embodiment of the present invention, the sequence of the circular RNA is shown in SEQ ID NO.1:

[0061] GTTCTCAGGAATCAGATAGCTCGCAGTCGGCCAAGAAGGACATGCTGGCTGCCTTGAAGTCCAGGCAGGAAGCTCTGGAGGAAACCCTGCGTCAGAGGCTGGAGGAACTGAAGAAGCTGTGTCTCCGAGAAGCTGAGCTCACGGGCAAGCTGCCAGTAGAATATCCCCTGGATCCAGGGGAGGAACCACCCATTGTTCGGAGAAGAATAGGAACAGCCTTCAAACTGGATGAACAGAAAATCCTGCCCAAAGGAGAGGAAGCTGAGCTGGAACGCCTGGAACGAGAGTTTGCCATTCAGTCCCAGATTACGGAGGCCGCCCGCCGCCTAGCCAGTGACCCCAACGTCAGCAAAAAACTGAAGAAACAAAGGAAAACCTCGTATCTGAATGCACTGAAGAAACTGCAGGAGATTGAAAATGCAATCAATGAGAACCGCATCAAGTCTGGGAAGAAACCCACCCAGAGGGCTTCGCTGATCATAGACGATGGAAACATTGCCAGTGAAGACAGCTCCCTCTCAGATGCCCTTGTTCTTGAGGATGAAGACTCTCAGGTTACCAGCACAATATCCCCCCTACATTCTCCTCACAAGGGACTCCCTCCTCGGCCACCGTCGCACAACAGGCCTCCTCCTCCCCAGTCCCTGGAGGGACTCCGACAGATGCACTATCACCGCAACGACTATGACAAGTCACCCATCAAGCCCAAAATGTGGAGTGAGTCCTCTTTAGATGAACCCTATGAGAAGGTCAAGAAGCGCTCCTCTCACAGCCATTCCAGCAGCCACAAGCGCTTCCCCAGCACAGGAAGCTGTGCGGAAGCCGGCGGAGGAAGCAACTCCTTGCAGAACAGCCCCATCCGCGGCCTCCCGCACTGGAACTCCCAGTCCAGCATGCCGTCCACGCCAGACCTGCGGGTCCGGAGTCCCCACTACGTCCATTCCACGAG(SEQ ID NO.1)

[0062] Circular RNA can be obtained by in vitro synthesis methods known in the art, such as chemical synthesis of circular RNA and enzymatic ligation synthesis of circular RNA.

[0063] Pharmaceutical composition

[0064] The present invention provides a pharmaceutical composition, comprising a pharmaceutically acceptable carrier and an effective amount of the following active ingredients: the circular RNA or an activator thereof.

[0065] As used herein, the term "effective amount" or "effective dose" refers to an amount that can produce a function or activity on humans and / or animals and can be accepted by humans and / or animals.

[0066] As used herein, "pharmaceutically acceptable" ingredients are suitable for use in humans and / or mammals without excessive adverse side effects (such as toxicity, irritation and allergic reactions), i.e., substances with a reasonable benefit / risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent, including various excipients and diluents.

[0067] The pharmaceutical composition of the present invention contains a safe and effective amount of the active ingredient of the present invention and a pharmaceutically acceptable carrier. Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. Usually, the pharmaceutical preparation should match the mode of administration. The dosage form of the pharmaceutical composition of the present invention is injection, oral preparation (tablet, capsule, oral liquid), transdermal agent, sustained release agent. For example, it is prepared by conventional methods using physiological saline or an aqueous solution containing glucose and other adjuvants. The pharmaceutical composition is preferably manufactured under sterile conditions.

[0068] The effective amount of the active ingredient of the present invention may vary with the mode of administration and the severity of the disease to be treated. The selection of the preferred effective amount can be determined by a person of ordinary skill in the art based on various factors (e.g., through clinical trials). The factors include, but are not limited to: pharmacokinetic parameters of the active ingredient such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated by the patient, the patient's body weight, the patient's immune status, the route of administration, etc. Generally, when the active ingredient of the present invention is administered at a dose of about 0.00001 mg-50 mg / kg animal body weight (preferably 0.0001 mg-10 mg / kg animal body weight) per day, satisfactory results can be obtained. For example, depending on the urgency of the treatment condition, several divided doses may be administered per day, or the dose may be reduced proportionally.

[0069] The pharmaceutically acceptable carriers of the present invention include (but are not limited to): water, saline, liposomes, lipids, proteins, protein-antibody conjugates, peptides, cellulose, nanogels, or combinations thereof. The choice of carrier should match the mode of administration, which are well known to those of ordinary skill in the art.

[0070] application

[0071] The present invention provides a method for treating tumors, comprising the steps of administering a therapeutically effective amount of the circular RNA or an activator thereof according to the present invention to a tumor patient.

[0072] The present invention also provides an in vitro non-therapeutic method for inhibiting tumor cells, comprising the steps of: culturing tumor cells in the presence of the circular RNA of the present invention, thereby inhibiting tumor cells; or overexpressing the circular RNA described in the first aspect of the present invention in the tumor cells, thereby inhibiting tumor cells.

[0073] In another preferred embodiment, the tumor is a p53 wild-type tumor, or the tumor cell is a p53 wild-type tumor cell.

[0074] In a preferred embodiment of the present invention, the inhibition of tumor cells is the inhibition of tumor cell growth, metastasis or inhibition of tumor formation.

[0075] Preferably, compared with control tumor cells, the level of the circular RNA described in the first aspect of the present invention in the tumor cells is increased by more than 10%, preferably more than 20%, more preferably more than 30%, more preferably more than 40%, more preferably more than 50%, more preferably more than 60%, more preferably more than 70%, more preferably more than 80%, more preferably more than 90%.

[0076] The main advantages of the present invention are:

[0077] (1) It is the first time to discover the key role of circular RNA according to the present invention in inhibiting the survival and growth of cancer cells.

[0078] (2) It was verified that the circular RNA of the present invention can be used as a biomarker for determining tumor prognosis.

[0079] (3) It was discovered for the first time that the circular RNA of the present invention can serve as a PKM2 inhibitor.

[0080] (3) It was discovered for the first time that the circular RNA of the present invention can reduce the level of cellular glycolysis.

[0081] (3) It was discovered for the first time that the circular RNA of the present invention can enhance the copper death sensitivity of tumor cells.

[0082] (3) It was discovered for the first time that the circular RNA of the present invention can inhibit the activity of pyruvate kinase (PK).

[0083] The present invention is further described in detail below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, parts and percentages are by weight.

[0084] Example

[0085] (I) Materials and methods

[0086] Cell culture and transient transfection

[0087] Cancer cell lines HCT116, RKO, CAL51, MCF-7 and A549 carrying wild-type p53, cancer cell lines SW620, MDA-MB-231, H1975 and ES-2 carrying mutant p53, and p53-deficient cancer cell lines HCT116 p53- / - and H1299 (all cell lines were purchased from the Cell Bank of the Chinese Academy of Sciences) were cultured in DMEM medium containing 10% fetal bovine serum, penicillin (100 U / ml) and streptomycin (0.1 mg / ml). All cells were incubated at 37°C in a humidified atmosphere containing 5% CO2. All cells were confirmed to be free of mycoplasma contamination by PCR analysis. Plasmids and siRNAs were transiently transfected using Hieff Trans liposome transfection reagent according to the manufacturer's operating procedures (Shanghai Yisheng Biotechnology Co., Ltd.).

[0088] Plasmids, antibodies, and reagents

[0089] The human EWSR1 sequence was cloned into the Myc-pcDNA vector to construct the EWSR1 overexpression vector. To construct the plasmid for luciferase reporter gene detection, the sequence upstream of the FRMD4A transcription start site (as shown in the figure) was cloned into the pGL3-basic vector. To construct the plasmid encoding circFRMD4A, the genomic region of circFRMD4A was cloned into the circular RNA expression vector pLCDH-ciR (Guangzhou Jisai Biotechnology Co., Ltd.) using the seamless cloning kit (Shanghai Biyuntian Biotechnology Co., Ltd.) according to the manufacturer's operating procedures. The primers used are listed in Table 1.

[0090] Table 1

[0091]

[0092] Flag antibody (Cat. No. F1804, Sigma-Aldrich, St. Louis, USA), p53 antibody (Cat. No. sc-126, DO-1, Santa Cruz Biotechnology), GAPDH antibody (Cat. No. 60004-1-Ig, Proteintech), p21 antibody (Cat. No. 2947, Cell Signaling Technology), FDX1 antibody (Cat. No. 12592-1-AP, Proteintech) and PKM2 antibody (Cat. No. 15822-1-AP, Proteintech) were all purchased commercially. The secondary antibodies used were HRP-conjugated affinity purified goat anti-rabbit IgG (Cat. No. SA00001-2, Proteintech) and anti-mouse IgG (Cat. No. SA00001-1, Proteintech). Proteins were visualized by ECL chemiluminescence reagent (Shanghai Yisheng Biotechnology Co., Ltd.). Cisplatin, 5-fluorouracil (5-FU), Nutlin-3, Elesclomol (ES), Alrizomadlin (APG-115), Tetrathiomolybdate (TTM), and proteasome inhibitor MG132 were purchased from MedChemExpress (Shanghai, China).

[0093] Clinical samples of colorectal cancer and breast cancer

[0094] In this study, a total of 100 paraffin-embedded tissue sections from the First Affiliated Hospital of Nanchang University were collected and analyzed by in situ hybridization (ISH). Among them, 20 pairs of colorectal cancer tissues and paired normal tissues were used to analyze the expression of circFRMD4A, while 80 colorectal cancer tissues were used to analyze overall survival based on ISH scores. In addition, seven pairs of breast cancer and adjacent normal tissues were used for RT-qPCR analysis. This study has been approved by the Human Research Ethics Committee of the First Affiliated Hospital of Nanchang University.

[0095] In situ hybridization (ISH)

[0096] In this study, the expression of circFRMD4A in paraffin-embedded colorectal cancer tissues was detected by in situ hybridization. The probe was designed and synthesized by Wuhan Boster Biotechnology Co., Ltd.

[0097] The probe sequence is (SEQ ID NO.10):

[0098] 5'-AGCTATCTGATTCCTGAGAACCTCGTGGAATGGACGTAGT-DIG-3'.

[0099] The specific steps were as follows: the slides were incubated at 60°C for 45 minutes and dewaxed with xylene, and then incubated with 3% H2O2 and 3% citric acid for 10 minutes at room temperature, respectively. The slides were prehybridized at 37°C for 4 hours, then hybridized with DIG-labeled circFRMD4A probe at 60°C overnight, and then stained with FITC-SABC (Boster). The slides were scanned using TMAMaster (3DHISTECH, Hungary). The ISH results were independently evaluated by two pathologists. The evaluation criteria were as follows: the staining intensity of circFRMD4A was scored as 0 (negative), 1 (weak), 2 (moderate), and 3 (strong). The staining range was scored according to the percentage of positively stained cells, with the criteria of 0 (0%), 1 (1–25%), 2 (26–50%), 3 (51–75%), and 4 (76–100%). The product of the staining intensity and staining range scores was considered as the ISH score. The scoring agreement between the two pathologists was 90%, and all scoring discrepancies were re-evaluated by discussion between the two pathologists. An ISH score of 0-6 was considered to indicate low expression of circFRMD4A, and an ISH score of 0-6 was considered to indicate high expression of circFRMD4A.

[0100] Reverse transcription and real-time quantitative PCR

[0101] According to the manufacturer's protocol, total RNA was extracted from cells and tissues using RNAiso Plus (Takara, Japan); genomic DNA (gDNA) was extracted from cells using the TIANamp genomic DNA kit (TIANGEN); cDNA synthesis was performed using RT SuperMix for qPCR (+gDNA wiper) (Vazyme); RT-qPCR analysis was performed using SYBR qPCR Master Mix. -ΔΔCt Methods The relative expression was calculated, with GAPDH as the internal reference gene.

[0102] RNA interference and construction of stable cell lines

[0103] All siRNAs and shRNAs were synthesized and purified by Shanghai GenePharma Pharmaceutical Technology Co., Ltd. (GenePharma). Cells were seeded in 6-well plates at appropriate density. siRNA transfection was performed using Hieff Trans liposome transfection reagent according to the manufacturer's protocol (Yeasen). After culturing for 24–48 h after transfection, cells were collected for RT-qPCR or immunoblot (IB) analysis. To establish a stable circFRMD4A knockdown cell line, the shcircFRMD4A plasmid was co-transfected into HEK293T cells with the packaging plasmids psPAX2 and PMD2.0G using polyethyleneimine (PEI) (Sigma-Aldrich, St. Louis, USA). Lentiviral particles were collected 48 h after transfection and then used to infect HCT116 cells. Stable cells were selected using puromycin (MedChemExpress, Shanghai, USA) and verified by RT-qPCR. The sequences of siRNA and shRNA used in this study are listed in Tables 2 and 3.

[0104] Table 2. siRNA sequences

[0105] siRNA Justice (5'-3') SEQ ID NO. Antisense (5'-3') SEQ ID NO. siNC TTCTCCGAACGTGTCACGT 11 ACGTGACACGTTCGGAGAA 12 sicircFRMD4A#1 ATTCCACGAGGTTCTCAGG 13 CCTGAGAACCTCGTGGAAT 14 sicircFRMD4A#2 TCCACGAGGTTCTCAGGAA 15 TTCCTGAGAACCTCGTGGA 16 sIU GGGCAACAAAGCTATGGAA 17 TTCCATAGCTTTGTTGCCC 18 siHNRNPC CAACGGGACTATTATGATA 19 TATCATAATAGTCCCGTTG 20 siIGF2BP2 GCGAAAGGATGGTCATCAT 21 ATGATGACCATCCTTTCGC 22 siIGF2BP3 GCTGGAGCTTCAATTAAGA 23 TCTTAATTGAAGCTCCAGC 24 siLIN28A GCAGTGGAGTTCACCTTTA 25 TAAAGGTGAACTCCACTGC 26 siPUM2 CTGAAGTAGTTGAGCGCTT 27 AAGCGCTCAACTACTTCAG 28 siTIA1 CGCTCCAAAGAGTACATAT 29 ATATGTACTCTTTGGAGCG 30 sip53 GTAATCTACTGGGACGGAA 31 TTCCGTCCCAGTAGATTAC 32

[0106] Table 3. shRNA sequences

[0107]

[0108] RNase R and cycloheximide D treatment experiments

[0109] For RNase R treatment experiments, 2 μg of total RNA was incubated with 6 U of RNase R at 37 °C for 30 min (with or without RNase R as a control). Subsequently, the abundance of circFRMD4A and linear FRMD4A mRNA was analyzed by RT-qPCR. The expression of p21 mRNA was used as a control. For cycloheximide D treatment experiments, cells were seeded in 60 mm dishes and treated with 1 μg / ml cycloheximide D. Cells were collected at 0 h, 4 h, 8 h, 12 h, and 24 h after treatment, and RNA was extracted. The stability of circFRMD4A, FRMD4A, and p21 mRNA was analyzed by RT-qPCR.

[0110] Nuclear-cytoplasmic separation experiment

[0111] The cytoplasm and nucleus were separated using a nuclear protein extraction kit (Bayotime) according to the manufacturer's protocol (with appropriate adjustments). The nucleus and cytoplasm were separated using the kit, and RNA was then extracted from the nucleus or cytoplasm using RNAisoPlus. The abundance of circFRMD4A was analyzed by RT-qPCR. U1 was used as a nuclear marker and ACTB as a cytoplasmic marker.

[0112] Cell viability assay

[0113] Cells were transfected with the indicated siRNA or plasmid and seeded in 96-well plates at a density of 3000 cells per well. After the cells were cultured for the indicated time, Cell Counting Kit-8 (CCK-8) reagent (Yeasen) was added to the culture and incubated for 2 hours. Cell viability was measured at 450 nm using a microplate reader. For cell viability assays associated with copper death, cells were seeded in 96-well plates at a density of 9000 cells per well 24 hours after transfection and treated with the indicated reagents or DMSO for 48 hours. Cell viability was then determined using CCK-8 as described above.

[0114] Colony formation assay

[0115] The cells were seeded in 6-well plates at a density of 1000 cells per well, and the culture medium was changed every two days for 14 days. The colonies were washed with PBS, fixed with methanol, and stained with a mixture of methanol and crystal violet for 30 minutes at room temperature. They were then rinsed with running water, the plates were dried, and photographed.

[0116] Transwell cell migration and invasion assay

[0117] For migration experiments, 5 × 10 4 10 cells were suspended in 200 μl serum-free medium and seeded into the upper layer of the Transwell chamber. For invasion assays, 100 μl of Matrigel matrix gel was added to the upper chamber before seeding, followed by 8×10 4 Cells (suspended in 200 μl serum-free medium) were inoculated into the upper layer of the Transwell chamber. DMEM medium containing 10% FBS was added to the lower chamber. After culturing at 37°C for 48 hours, the cells remaining on the surface of the upper chamber were removed with a cotton swab, and the cells attached to the surface of the lower chamber were stained with methanol containing 0.2% crystal violet. An optical microscope was used to image and count the cells that migrated to or invaded the surface of the lower chamber in three randomly selected fields of view.

[0118] Flow cytometry detection of apoptosis

[0119] Apoptosis was detected by flow cytometry using the Annexin-V-PE / 7-AAD kit (Vazyme) according to the manufacturer's protocol. That is, cells were collected 48 hours after transfection with the specified siRNA or plasmid and stained with Annexin-V-PE and 7-AAD for 20 minutes at room temperature in the dark. The percentage of apoptotic cells was then measured using a flow cytometer (Beckman Coulter).

[0120] Western Blotting

[0121] Proteins were extracted using RIPA buffer and separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to a PVDF membrane. The membrane was blocked with 5% skim milk and incubated with primary antibodies overnight. The membrane was washed three times and incubated with secondary antibodies at a dilution ratio of 1:10000. Proteins were visualized using ECL chemiluminescent reagents (Yeasen).

[0122] Chromatin Immunoprecipitation (ChIP)

[0123] Cells were seeded in 100 mm dishes and cultured for 24 hours. Cells were cross-linked with 37% formaldehyde for 10 minutes at room temperature, then neutralized with 800 μl 10× glycine for 5 minutes and washed three times with cold PBS. Subsequently, cells were scraped and suspended in cell lysis buffer (50 mM Tris-HCl pH 7.5, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% TritonX-100, and protease inhibitor cocktail) and incubated on ice for 20 minutes, vortexing every 5 minutes. Cell nuclei were collected and resuspended in 400 μl nuclear lysis buffer (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS, and protease inhibitor cocktail). After sonication (200 W, 60 cycles, 30 s on, 30 s off each time), the lysates were centrifuged at 12,000 g for 5 min, and the supernatants were incubated with anti-p53 antibody or IgG at 4°C overnight and then with protein A / G magnetic beads at 4°C for 2 h. The magnetic beads were washed sequentially with low salt wash buffer (50mM Tris-HCl pH 8.0, 0.1% SDS, 0.5% sodium deoxycholate, 1mM EDTA, 1% NP-40, and 150mM NaCl), high salt wash buffer (50mM Tris-HCl pH 8.0, 0.1% SDS, 0.5% sodium deoxycholate, 1mM EDTA, 1% NP-40, and 500mM NaCl), LiCl wash buffer (50mM Tris-HCl pH 8.0, 250mM LiCl, 0.1% SDS, 0.5% sodium deoxycholate, 1mM EDTA, and 1% NP-40), and TE buffer (10mM Tris HCl pH 8.0, and 1mM EDTA). The protein-DNA complex was eluted with ChIP elution buffer (1% SDS and 0.1M NaHCO3). After reversal of cross-linking at 62°C for 2 h, DNA was extracted and analyzed by qPCR and agarose gel electrophoresis.

[0124] Luciferase Reporter Assay

[0125] Cells were seeded in 24-well plates and transfected with pGL3-basic, pGL3-p53-RE1 / 2 or pGL3-p53-RE1 / 2 / 3 plasmids, as well as plasmids encoding Renilla luciferase and p53. After 48 h of culture, cells were harvested and luciferase activity was measured using the Dual-Luciferase Reporter Gene Assay System (Promega, Madison, WI, USA) according to the manufacturer's protocol.

[0126] RNA Immunoprecipitation (RIP)

[0127] Cells were seeded in 100 mm dishes and transfected with empty vector or indicated plasmids. After 48 h of culture, cells were collected and suspended in RIP buffer (10 mM Tris, 150 mM NaCl, 1 mM Na2EDTA·2H2O, 3.5 mM SDS, 1 mM DTT, 1% NP-40, pH 7.4). Cell lysates were incubated with protein A / G magnetic beads (Santa Cruz Biotechnology) and anti-Myc antibodies at 4°C overnight. The beads were washed six times with RIP buffer. The bound RNA was eluted and purified, and then subjected to RT-qPCR analysis.

[0128] RNA-pull down assay

[0129] Biotinylated linear sense and antisense RNA sequences of circFRMD4A were synthesized using the Biotin RNA Labeling Mix Kit (Roche, Germany). CAL51 cells were lysed using RNA pull-down lysis buffer (10 mM Tris, 150 mM NaCl, 1 mM Na2EDTA·2H2O, 3.5 mM SDS, 1 mM DTT, 1% NP-40, pH 7.4) containing 1 U RNase inhibitor (Takara) and 20 mM ribonucleoside vanadium complex (RVC) (Beyotime) and incubated with biotin-labeled probes at 4 °C for 3 h. Then, the RNA-protein mixture was incubated with Dynabeads TM M-280 Streptavidin (Invitrogen, USA) was incubated for 4-6 hours at 4° C. Finally, the interacting proteins were analyzed by mass spectrometry and immunoblotting (IB).

[0130] PKM2 cross-linking experiments

[0131] To detect monomer, dimer and tetramer PKM2 proteins, cells were collected and washed twice with ice-cold PBS, then incubated with 500 μM disuccinimidyl suberate (DSS, MedChemExpress) in PBS at room temperature for 30 minutes. 10 mM Tris (pH 8.0) was then added to the cell suspension for 15 minutes to terminate cross-linking. Cells were collected and lysed in lysis buffer, followed by immunoblotting (IB) analysis.

[0132] Liquid chromatography-mass spectrometry13 C-labeled metabolites

[0133] 4×10 6 Cells were seeded into 100 mm culture dishes and transfected with circFRMD4A plasmid or empty vector for 20 h. Subsequently, the medium was replaced with 4 ml of fresh medium containing 5 mM unlabeled glucose, and the cells were cultured for 3 h. Afterwards, the medium was replaced with an equal amount of 5 mM 1,2- 13 C2-glucose (Sigma-Aldrich) was added and the cells were cultured for another 6 hours. At the same time, the number of cells was counted using a culture dish cultured under the same experimental conditions as the sample culture dish to determine the volume of the extract. 6 1 ml of extraction solution was used for each cell. The cells were washed twice with PBS, and metabolites were extracted with a mixture of methanol, acetonitrile and water (ratio 5:3:2) in an ice bath. After centrifugation at 16,000g for 15 minutes at 0°C, the supernatant was collected for liquid chromatography (LC-30AD, Shimadzu) and mass spectrometry (QTRAP 7500, SCIEX) analysis. LC separation was performed using a HILIC BEH column (1.7 μm, 2.1 mm × 100 mm; Waters), and gradient elution was performed using a 10 mM ammonium formate solution containing 0.2% ammonia and acetonitrile at a flow rate of 1 mL / min.

[0134] Measurement of pyruvate kinase activity, lactate and citrate content

[0135] The activity of PK and the levels of LA and CA were measured using a pyruvate kinase (PK) activity assay kit, a lactate (LA) assay kit, and a citrate (CA) content assay kit according to the manufacturer's procedures (Solarbio, Beijing, China), respectively.

[0136] For the evaluation of PK activity, 5 × 10 6 cells and extracted using the extraction solution provided in the kit and sonicated under the following conditions: 200 W, 30 cycles, 3 s on, 10 s off per cycle. Then, the cells were centrifuged at 8,000 g for 10 min at 4 °C, and the supernatant was measured at 340 nm using a microplate reader. To determine lactate levels, 1 × 10 5Cells were seeded into 12-well plates and cultured overnight. Then, the culture medium was replaced with fresh culture medium and cultured for another 1 hour. The supernatant was collected and the lactate level was measured at 570nm using a microplate reader. To determine the mitochondrial citrate level, 5×10^6 cells were collected and extracted using the extraction solution provided in the kit and sonicated under the following conditions: 200W, 30 cycles, 3 seconds on and 10 seconds off per cycle. Then, the cells were centrifuged at 11,000g for 10 minutes at 4°C, and the precipitate was collected and resuspended with 200μl of reagent II and 2μl of reagent III provided in the kit. After centrifugation at 11,000g for 10 minutes at 4°C, the supernatant was measured at 545nm using a microplate reader.

[0137] Mouse xenograft tumor model

[0138] Mouse xenograft experiments followed ethical guidelines and were approved by the Animal Welfare Committee of Fudan University Shanghai Cancer Center. Six-week-old BALB / c nude mice were purchased and maintained from the Department of Laboratory Animal Science, Fudan University Shanghai Cancer Center. To evaluate the in vivo function of circFRMD4A, 8 × 10 mice stably expressing empty vector or circFRMD4A plasmid were placed in the 6 HCT116 cells stably expressing shNC or shcircFRMD4A; 5×10 6 HCT116 cells were implanted subcutaneously in nude mice. Tumor growth was monitored twice a week using a vernier caliper. For drug treatment, 8×10 6 HCT116 cells were subcutaneously implanted into nude mice. Seven days later, the mice were randomly divided into four groups: control group, Elesclomol group, APG-115 group and Elesclomol+APG-115 group. Elesclomol (5 mg / kg) was administered daily by intraperitoneal injection (five days a week for two weeks). APG-115 (50 mg / kg) was administered intragastrically (five days a week for two weeks). The control group was given an equal amount of normal saline. The weight of the mice was monitored and recorded daily. The formula "volume = length × width was used. 2 × 0.5” to measure and calculate tumor volume.

[0139] Statistical analysis

[0140] All in vitro data were obtained from three independent replicates. Data are presented as mean ± standard deviation (SD). Differences between two or more groups were compared using Student's t test or one-way analysis of variance (ANOVA). The overall survival of patients with colorectal cancer was analyzed using the Kaplan-Meier method. p values ​​< 0.05 were considered statistically significant. ns indicates no statistically significant difference, *p < 0.05, **p < 0.01, ***p < 0.001.

[0141] (II) Results

[0142] Identification of circular RNA circFRMD4A associated with breast and colorectal cancer

[0143] To identify potential p53-regulated circular RNAs (circRNAs) in cancer, CAL51 breast cancer cells carrying wild-type p53 were treated with 5-fluorouracil (5-FU), cisplatin, or Nutlin-3, followed by expression microarray analysis.

[0144] The results of the present invention revealed that 1165 circRNAs with a size between 200 and 1000 nucleotides were significantly upregulated (p value less than 0.05). Among them, the top 20 circRNAs with upregulated expression are shown in Figure 1 A. Subsequently, the present invention verified whether Nutlin-3 would upregulate the expression of these 20 circRNAs in cancer cells carrying wild-type p53 (including CAL51, HCT116 and A549).

[0145] The results of the present invention show that in all three cell lines, the expression of hsa_circ_0004183 was significantly upregulated after Nutlin-3 treatment, indicating that this circRNA may be regulated by p53. Since hsa_circ_0004183 is derived from the FRMD4A gene, the present invention names it as circFRMD4A.

[0146] Next, the present invention evaluated the expression of circFRMD4A in clinical samples. In situ hybridization analysis of 20 pairs of colorectal cancer tissues and paired normal tissues showed that the expression of circFRMD4A in colorectal cancer tissues was significantly reduced compared with normal tissues ( Figure 1B and 1C ).

[0147] In addition, low circFRMD4A expression was significantly associated with more advanced T stage and lymph node metastasis (Table 1), and in a cohort of 80 colorectal cancer patients, low circFRMD4A expression predicted poor overall survival ( Figure 1D ).

[0148] Table 1 Relationship between circFRMD4A expression and clinicopathological factors in patients with colorectal cancer

[0149]

[0150] Similarly, RT-qPCR analysis of seven matched tissue samples revealed that the expression of circFRMD4A in breast cancer tissues was also lower than that in normal tissues ( Figure 2 ). These results suggest that circFRMD4A may play a role in cancer, and further studies are warranted.

[0151] Validation of circFRMD4A biological characteristics

[0152] Genomic analysis showed that circFRMD4A was formed by reverse splicing of exons 16 to 21 of the maternal gene FRMD4A, and this result was confirmed by Sanger sequencing ( Figure 1E ).

[0153] The circular structure of circFRMD4A was further confirmed by RT-PCR analysis using forward and reverse primers surrounding the junction site. When the forward primer was used, both cDNA and genomic DNA templates were able to generate specific PCR products from linear FRMD4A, while when the reverse primer was used, only the cDNA template was able to successfully amplify the junction site of circFRMD4A ( Figure 1F and 1G ).

[0154] The reported circNSUN2 was used as a control. Subsequently, the present invention tested whether circFRMD4A was resistant to RNase R digestion. After RNase R treatment, linear FRMD4A and CDKN1A (also known as p21) were rapidly degraded, but circFRMD4A remained stable ( Figure 1H and 1I ).

[0155] Similarly, the present invention found that when transcription was blocked using actinomycin D, the stability of circFRMD4A was higher than that of linear FRMD4A and p21 ( Figure 1J and 1K ).

[0156] Therefore, the above findings confirmed that circFRMD4A has the biological characteristics of circRNA. Finally, RT-qPCR analysis of subcellular components revealed that circFRMD4A was mainly localized in the cytoplasm ( Figure 1L and 1M ).

[0157] RNA-binding protein EWSR1 promotes the biogenesis of circFRMD4A

[0158] Circular RNAs (circRNAs) are formed by the cyclization of primary transcripts, a process that involves the traditional spliceosome machinery, intron-complementary sequences (ICSs) and RNA-binding proteins (RBPs). The present invention attempts to identify potential RBPs that promote the formation of circFRMD4A after p53 activation.

[0159] By using the database, the present invention identified seven RBPs that may be potentially associated with both the upstream and downstream sequences of circFRMD4A ( Figure 3A ). Next, the present invention knocked down these RBPs and found that knocking down EWSR1 significantly reduced the level of circFRMD4A induced by Nutlin-3 ( Figure 3B and 3C ), indicating that EWSR1 plays a role in p53-induced circFRMD4A upregulation. Conversely, overexpression of EWSR1 significantly increased the level of circFRMD4A ( Figure 3D-3F ).

[0160] In addition, RIP-qPCR analysis confirmed that EWSR1 bound to both the upstream and downstream sequences of the circFRMD4A linear precursor ( Figure 3G-3I However, RT-qPCR analysis of cells treated with p53 inducers or siRNAs showed that p53 did not regulate the expression of EWSR1 ( Figure 3J-3M ).

[0161] Although studies have shown that fusion of EWSR1 with ETS family genes due to genomic translocation is a characteristic of Ewing's sarcoma, the role of EWSR1 in colorectal cancer or breast cancer is still unclear. By analyzing the TCGA database, the present invention found that there was no significant difference in the expression of EWSR1 in colorectal cancer or breast cancer compared with normal tissues ( Figure 3N and 3O ).

[0162] In addition, there was no significant correlation between EWSR1 expression and patient prognosis ( Figure 3P and 3Q Consistent with these findings, we found that knocking down EWSR1 had no effect on the growth of colorectal and breast cancer cells ( Figure 3R and 3S ).

[0163] Interestingly, EWSR1 knockdown could partially reverse the inhibitory effect of Nutlin-3 on cell growth ( Figure 3T and 3UAlthough further studies are needed to understand the function and mechanism of EWSR1, the results of the present invention indicate that EWSR1 promotes the formation of circFRMD4A by binding to the intronic sequences flanking circFRMD4A, which is essential for the increase in circFRMD4A levels induced by p53.

[0164] CircFRMD4A inhibits the progression of colorectal and breast cancer

[0165] Next, the present invention studied the role of circFRMD4A by overexpressing plasmids encoding circFRMD4A in different cancer cells ( Figure 4A , 4B , Figure 5A and Figure 5B ).

[0166] Cell viability assays revealed that overexpression of circFRMD4A inhibited the proliferation of colorectal cancer and breast cancer cells ( Figure 4C , 4D , Figure 5C and Figure 5D ).

[0167] Likewise, overexpression of circFRMD4A impaired the clonogenic capacity of these cancer cells ( Figure 4E and Figure 5E ).

[0168] In addition, flow cytometry analysis showed that overexpression of circFRMD4A increased apoptosis in colorectal and breast cancer cells ( Figure 4F and Fig. 5F ).

[0169] In addition, overexpression of circFRMD4A inhibited the migration of cancer cells ( Figure 4G and Figure 5G ) and invasion ( Figure 4H and Figure 5H ).

[0170] To test whether circFRMD4A inhibits tumor growth in vivo, the present invention established a xenograft tumor model using HCT116 cells stably expressing circFRMD4A or an empty vector ( Fig.5I ).

[0171] The results of the present invention showed that overexpression of circFRMD4A significantly inhibited the growth of colorectal cancer, as manifested by the reduction of tumor growth rate, weight and volume ( Figure 4I-4K ), without affecting the average body weight ( Figure 5J ). Taken together, these results suggest that ectopic circFRMD4A impedes the growth and progression of colorectal and breast cancer.

[0172] Knockout of circFRMD4A promotes the development of colorectal and breast cancer

[0173] Subsequently, the present invention determined the role of endogenous circFRMD4A by reducing its expression using two different siRNAs. The expression of circFRMD4A could be specifically knocked down, while the level of the maternal gene FRMD4A remained unchanged ( Fig. 6A , Figure 6B , Fig. 7A and Figure 7B ).

[0174] Cell viability and clone formation experiments showed that knocking out circFRMD4A increased the growth of colorectal cancer and breast cancer cells ( Figure 6C , Fig.6D , Figure 7C and Fig.7D ) and colony formation ( Fig. 6E and Fig. 7E ).

[0175] Furthermore, knockout of circFRMD4A significantly reduced apoptosis in colorectal and breast cancer cells ( Fig. 6F and Figure 7F ), while enhancing the migration of colorectal cancer and breast cancer cells ( Figure 6G and Figure 7G ) and invasion ( Figure 6H and Figure 7H ).

[0176] Finally, the present invention tested whether knocking out circFRMD4A promotes tumor growth in vivo. Xenograft tumor models were constructed using HCT116 cells stably expressing circFRMD4A shRNA or control vector ( Fig.6I The results of the present invention showed that knocking out circFRMD4A significantly increased tumor growth rate, weight and size (Figure Figure 6I-6K ), but had no effect on average body weight ( Figure 6J ). Taken together, these results suggest that endogenous circFRMD4A is a tumor suppressor, as knockout of circFRMD4A promotes the growth and progression of colorectal and breast cancers.

[0177] CircFRMD4A inactivates PKM2 and directs pyruvate to the tricarboxylic acid cycle

[0178] To elucidate the potential mechanism by which circFRMD4A exerts its tumor suppressor function, we used biotin-labeled RNA probes to perform RNA pull-down experiments, followed by mass spectrometry (MS) analysis ( Fig. 8A ).

[0179] The results showed that pyruvate kinase PKM2 is a potential binding partner of circFRMD4A. PKM2 catalyzes the conversion of phosphoenolpyruvate (PEP) to pyruvate, the final step of glycolysis, which is essential for the survival, growth and metastasis of tumor cells.

[0180] In addition, recent studies have shown that increasing mitochondrial uptake of pyruvate promotes copper death by promoting mitochondrial metabolism. Therefore, the present invention aims to investigate whether circFRMD4A interacts with PKM2 and, if so, whether circFRMD4A regulates glycolytic metabolism by regulating PKM2 in colorectal cancer and breast cancer cells ( Figure 9A-9D ).

[0181] First, the present invention performed RIP-qPCR analysis to verify the interaction between PKM2 and circFRMD4A in colorectal cancer and breast cancer cells ( Figure 8B and Figure 8C Interestingly, overexpression of circFRMD4A did not affect the expression level of PKM2 ( Fig.9E ), but inhibited the tetramerization of PKM2 ( Fig.8D ).

[0182] Since tetrameric PKM2 is the active enzyme form that catalyzes the conversion of PEP to pyruvate, the present invention then examined whether circFRMD4A regulates pyruvate kinase (PK) activity. The present invention's findings showed that overexpression of circFRMD4A inhibited PK activity ( Fig. 8E and Fig.8F ) and subsequent lactate production ( Figure 8G and Figure 8H ), while knockout of circFRMD4A promoted PK activity ( Fig.9F and Figure 9G ) and lactate levels ( Figure 9H and Fig.9I ).

[0183] It has been reported that inactivation of PKM2 may promote the entry of pyruvate into the tricarboxylic acid (TCA) cycle, thereby shifting glycolytic flux to mitochondrial metabolism. To determine whether this is also the case in the present study, the present invention assessed the rate of the TCA cycle.

[0184] The results of the present invention showed that overexpression of circFRMD4A increased the level of mitochondrial citrate ( Figure 8I and Figure 8J ), while knockdown of circFRMD4A resulted in a decrease in these levels ( Figure 9J and Figure 9K ).

[0185] Consistent with these results, LC-MS analysis of metabolite levels in the present invention showed that overexpression of circFRMD4A led to a significant accumulation of PEP, accompanied by a decrease in pyruvate levels ( Figure 9L At the same time, lactate production decreases, while citrate levels increase ( Figure 9L ).

[0186] In order to further verify these results, the present invention uses 13 C-labeled glucose (1,2- 13 C2-glucose) to track the fate of glucose-derived metabolites. Figure 8K As shown, in cancer cells overexpressing circFRMD4A, 13 C-labeled PEP ( 13 C2-PEP) levels increased, and 13 C2-pyruvate levels were reduced. Of note, 13 C2-lactate levels were decreased, while circFRMD4A overexpressing cancer cells 13 C2- and 13 C4-citrate levels were elevated ( Figure 8K and Figure 9M ), indicating that overexpression of circFRMD4A promoted the TCA cycle.

[0187] Next, the present invention tested whether the changes in lactate and citrate levels were associated with PKM2 activity. The results showed that overexpression of PKM2 reversed the changes in the levels of the two metabolites caused by overexpression of circFRMD4A ( Figure 8L-Figure 8O ). Similarly, knockdown of PKM2 reversed the changes in metabolite levels caused by circFRMD4A knockdown ( Figure 9N-Figure 9Q ).

[0188] In addition, the present invention also studied whether PKM2 is involved in regulating p53-mediated copper death. The results showed that Nutlin-3 increased the sensitivity of cancer cells to copper death, which is consistent with the previous results of the present invention, while overexpression of PKM2 offset the effect of Nutlin-3 ( Figure 8P and Figure 8Q ).

[0189] Taken together, these results demonstrate that circFRMD4A promotes mitochondrial metabolism by inactivating PKM2, thereby making cancer cells more sensitive to copper death.

[0190] Copper death is a type of cell death induced by copper that primarily affects cells that rely on mitochondrial metabolism. Although p53 regulates glycolytic metabolism, it is unclear whether this tumor suppressor plays a role in copper death. Here, the present study found that the circular RNA circFRMD4A plays an important role in p53-mediated metabolic reprogramming and copper death. CircFRMD4A is derived from the transcript of FRMD4A, which is transcriptionally activated by p53, and the formation of circFRMD4A is promoted by the RNA-binding protein EWSR1. Compared with adjacent normal tissues, the expression of circFRMD4A is downregulated in colorectal cancer, and low levels of circFRMD4A are associated with poor prognosis. CircFRMD4A plays a tumor suppressor role by inhibiting the growth and progression of colorectal and breast cancer cells. In addition, it increases the sensitivity of cancer cells to Elesclomol-induced copper death. Mechanistic studies have shown that circFRMD4A interacts with the pyruvate kinase PKM2, thereby preventing the formation of the active tetrameric form of PKM2. This action leads to a reduction in lactate production and redirects glycolytic flux toward the TCA cycle.

[0191] The present invention also found that EWSR1 binds to the flanking sequence of circFRMD4A and promotes the formation of circRNA. The presence of EWSR1 is essential for the production of circFRMD4A, because knocking down EWSR1 significantly reduced the expression of circFRMD4A. Further results of the present invention indicate that EWSR1 may not have a significant effect on the progression of colorectal cancer and breast cancer, because the expression of EWSR1 does not affect the growth of cancer cells and is not associated with the prognosis of patients. However, knocking down EWSR1 significantly reversed the cell growth inhibition caused by Nutlin-3 treatment. These findings indicate that EWSR1 is involved in p53-mediated tumor suppression.

[0192] Although studies have found that FRMD4A can promote the growth and metastasis of several types of cancer, the results of the present invention indicate that circFRMD4A exerts a tumor suppressor function by inhibiting the survival, growth and spread of colorectal cancer and breast cancer cells.

[0193] In order to understand its molecular basis, the present invention conducted a series of mechanistic studies. Interestingly, the present invention found that circFRMD4A binds to PKM2 and prevents its tetramerization, resulting in PKM2 inactivation, thereby redirecting the glycolysis channel to the tricarboxylic acid cycle (TCA). It is reported that the upregulation of PKM2 is associated with high rates of glycolysis and tumorigenesis, while the inactivation of PKM2 reduces glycolysis and prevents tumor growth and metastasis. In addition, the inactivation of PKM2 also leads to the transfer of glycolytic flux to mitochondrial metabolism, which is a prerequisite for the sensitivity of cells to copper death. Therefore, the discovery of the present invention explains why circFRMD4A inhibits cancer growth and progression and enhances the sensitivity of cancer to copper death.

[0194] In summary, the present study identified and described that overexpression of circFRMD4A inhibited the growth and spread of cancer cells, while loss of circFRMD4A promoted their growth and spread. Mechanistically, circFRMD4A interacted with PKM2 to inhibit its activity, resulting in a reduction in lactate production and a redirection of glycolytic flux to the tricarboxylic acid (TCA) cycle.

[0195] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A circular RNA, characterized in that The sequence of the circular RNA is selected from the group consisting of: (A) the polynucleotide sequence shown in SEQ ID NO.1; (B) a polynucleotide sequence formed by replacing, deleting or adding one or more nucleotides of the polynucleotide sequence shown in SEQ ID NO.1; (C) is a polynucleotide sequence having a homology of ≥90%, preferably ≥95%, more preferably ≥98%, and most preferably ≥99% compared to the polynucleotide sequence shown in SEQ ID NO.: 1; (D) A polynucleotide sequence complementary to the polynucleotide sequence described in any one of (A) to (C).

2. The use of circular RNA or an activator thereof according to claim 1, characterized in that: Used for: (1) Preparation of drugs for preventing or treating tumors; (2) preparing PKM2 inhibitors; (3) preparing reagents that reduce cellular glycolysis levels; (4) preparing a reagent for enhancing the copper death sensitivity of tumor cells; or (5) Prepare a reagent for inhibiting pyruvate kinase (PK) activity.

3. A pharmaceutical composition, characterized in that It comprises a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is the circular RNA according to claim 1, its activator, or a vector or cell expressing the circular RNA.

4. The pharmaceutical composition according to claim 3, characterized in that The pharmaceutical composition is used for preventing or treating tumors.

5. The pharmaceutical composition according to claim 4, characterized in that The tumor is a p53 wild-type tumor.

6. The use of the circular RNA or a detection reagent thereof according to claim 1, characterized in that: Used for: preparing tumor detection kits.

7. The pharmaceutical composition according to claim 6, characterized in that The tumor detection kit is used to determine (or assist in determining) the prognosis of a tumor.

8. A method for non-therapeutic inhibition of tumor cells in vitro, characterized in that: The method comprises the steps of: culturing tumor cells in the presence of the circular RNA according to claim 1, thereby inhibiting the tumor cells; or overexpressing the circular RNA according to claim 1 in the tumor cells, thereby inhibiting the tumor cells.

9. The method according to claim 8, characterized in that The tumor is a p53 wild-type tumor. 10 . A vector comprising the circular RNA sequence of claim 1 .

Images