Helitron transposon fragment associated with citrus huanglongbing resistance and application thereof

By identifying and knocking out the Helitron transposon in the promoter region of the citrus Huanglongbing (HLB) susceptibility gene PUB21, and using CRISPR/Cas9 gene editing technology, the problem of insufficient resistance to HLB in citrus was solved, and the resistance of citrus to HLB and the disease control effect were significantly improved.

CN119955805BActive Publication Date: 2026-04-28INST OF MICROBIOLOGY CHINESE ACAD OF SCI
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF MICROBIOLOGY CHINESE ACAD OF SCI
Filing Date
2025-01-26
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Citrus Huanglongbing (HLB) causes severe economic losses to the citrus industry, and existing technologies are insufficient to effectively improve plant resistance to the disease.

Method used

By identifying and knocking out the Helitron transposon in the promoter region of the citrus Huanglongbing susceptibility gene PUB21, and using CRISPR/Cas9 gene editing technology, this region was deleted or modified to reduce the expression level of PUB21, disrupt the tight feedback loop of PUB21-MYC2, and regulate gene expression to enhance resistance.

Benefits of technology

It significantly improved the resistance of citrus to Huanglongbing, effectively controlled the replication and spread of pathogens, provided a resistance breeding strategy, and enhanced the disease control capabilities of citrus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005259226430000011
    Figure HDA0005259226430000011
  • Figure HDA0005259226430000012
    Figure HDA0005259226430000012
  • Figure HDA0005259226430000021
    Figure HDA0005259226430000021
Patent Text Reader

Abstract

The application discloses a Helitron transposon fragment related to citrus Huanglongbing resistance and application thereof. The nucleotide sequence of the Helitron transposon fragment is shown in sequence 2, which contains multiple characteristic motifs combined with transcription factor MYC2, the transcription factor MYC2 can be combined with and play the transcription factor activity to transcribe and activate the expression of PUB21 gene. The application confirms that PUB21 and the ubiquitination substrate MYC2 transcription factor constitute a close feedback loop, explains the molecular mechanism of different species sensitivity to Huanglongbing, and provides a breeding strategy for enhancing the disease resistance of citrus by knocking out or modifying the Helitron transposon fragment in the promoter region of the susceptible gene PUB21 to reduce the expression level of the susceptible gene PUB21, the resistance breeding strategy can effectively resist the replication and spread of Huanglongbing pathogen, and has important significance for preventing and controlling citrus Huanglongbing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a Helitron transposon fragment related to resistance to citrus Huanglongbing (HLB) and its application, particularly the identification, functional verification, and application of the Helitron transposon fragment in the promoter region of the citrus HLB21 susceptibility gene in regulating citrus HLB resistance. Background Technology

[0002] Citrus Huanglongbing (HLB), also known as citrus green fruit disease, is currently the most destructive citrus disease, causing severe economic losses to the global citrus industry. HLB is mainly caused by the phloem-restricting bacterium Candidatus Liberibacterasiaticus (CLas), and is primarily spread by the insect vector Diaphorina citri Kuwayama.

[0003] As sessile organisms, plants face various biotic and abiotic stresses throughout their life cycle. Through long-term evolution, plants have developed complex defense mechanisms to combat pathogen infection. Protein degradation plays a crucial role in plant defense, with the ubiquitin-proteasome system being one of the main mechanisms. E3 ligases are a key component of this system, determining substrate specificity and mediating substrate ubiquitination and degradation. Plant U-box proteins (PUBs), as members of this family, have been reported in recent years to play a crucial role in the interaction between pathogens and various plants, including rice and Arabidopsis. Many pathogens manipulate PUBs to target and degrade disease-resistant proteins, thereby disrupting the host's immunity. Therefore, strictly regulating the expression level of PUBs plays a vital role in plant resistance to diseases and pests. Promoters, as fundamental elements of gene expression, play a key role in regulating gene expression levels. Studying promoter regulatory patterns or comparing differences in promoter characteristics to precisely regulate the expression level of target genes is crucial for guiding next-generation resistance breeding.

[0004] Transposons, also known as transposable elements, are autonomous DNA sequences that can move freely within the host genome. They typically range in length from 100 bp to 10,000 bp, similar to viruses. Currently, transposons are mainly classified into three types based on their replication method: Type I transposons, also known as retrotransposons, are "copy-paste" type; Type II transposons, simply called transposons, are "cut-paste" type; and Helitron transposons, which transpose via "rolling circle" replication, are a novel type of transposon discovered in the last 20 years. Autonomous Helitrons encode the replicase Rep and helicase Hel, expanding within the genome through a rolling circle replication method similar to that of DNA viruses. Helitron transposons have become a popular subject in biological research due to their specific replication characteristics. For example: (i) Helitron can be used to alter gene transcriptional regulatory networks, thereby integrating and amplifying the transcription factor expression regulatory regions and regulating the expression of nearby genes; (ii) Helitron can be used to alter gene epigenetic modifications, and the siRNA produced by Helitron can target donor genes, causing gene epigenetic modifications that inhibit gene expression. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to improve the resistance of plants to Huanglongbing (HLB).

[0006] To address the aforementioned technical problems, the present invention first provides a DNA molecule.

[0007] The DNA molecule provided by this invention is a Helitron transposon located in the promoter region of the citrus Huanglongbing susceptibility gene PUB21, and is any one of the following a1)-a3):

[0008] a1) The DNA molecule shown in sequence 2;

[0009] a2) A DNA molecule with the same function obtained by substituting and / or inserting and / or deleting one or more bases in the DNA molecule defined in a1).

[0010] DNA molecules defined in a3) and a1) are DNA molecules that have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity and have the same function.

[0011] In a2), the substitution and / or insertion and / or deletion of one or more bases is a substitution and / or insertion and / or deletion of no more than 10 bases.

[0012] In a3), the identity refers to the sequence similarity to a natural nucleic acid sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0013] Those skilled in the art can readily mutate the nucleotide sequence of the DNA molecule of the present invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that have 70% or higher identity with the nucleotide sequence of the DNA molecule provided by the present invention, provided they have the same function, are derived from and are equivalent to the nucleotide sequence of the present invention.

[0014] The aforementioned DNA molecules contain multiple characteristic motifs (G-box like: CANNTG) that bind to the transcription factor MYC2. The transcription factor MYC2 can bind to these motifs and exert its transcriptional activity to activate the expression of PUB21, forming a tight feedback loop connecting the PUB21 promoter, PUB21, and MYC2, which participates in regulating resistance to Huanglongbing.

[0015] To address the aforementioned technical problems, this invention also provides new uses for substances that knock out the entire length or a portion of the aforementioned DNA molecules.

[0016] This invention provides the use of substances that knock out the full length or a portion of the above-mentioned DNA molecules in any of the following A1)-A6):

[0017] A1) Improve plant resistance to Huanglongbing (HLB);

[0018] A2) Prepare products that enhance plant resistance to Huanglongbing (HLB);

[0019] A3) Cultivate plants resistant to Huanglongbing (HLB);

[0020] A4) Prepare products that cultivate plants resistant to Huanglongbing (HLB);

[0021] A5) Control of plant Huanglongbing (HLB);

[0022] A6) Prepare products for the prevention and control of Huanglongbing (HLB) in plants.

[0023] In the above applications, the fragments contain characteristic motifs that bind to the transcription factor MYC2.

[0024] In the above applications, the substance that knocks out the full-length or partial fragment of the DNA molecule can be a substance that causes a mutation in the characteristic motif that binds to the transcription factor MYC2 in the full-length or partial fragment of the DNA molecule (the mutation can be a deletion mutation and / or an insertion mutation and / or a base substitution), thereby preventing the transcription factor MYC2 from binding to it. The mutation can occur in any manner known in the art, such as the zinc finger protein ZFN gene editing system, the TALENs gene editing system, the CRISPR / Cas9 gene editing system, etc.

[0025] Furthermore, the substance that knocks out the full-length or partial fragments of the aforementioned DNA molecule is a CRISPR / Cas9 gene editing vector that knocks out the full-length or partial fragments of the aforementioned DNA molecule; the CRISPR / Cas9 gene editing vector expresses sgRNA and Cas9 protein that target the full-length or partial fragments of the aforementioned DNA molecule.

[0026] Furthermore, the CRISPR / Cas9 gene editing vector comprises an sgRNA gene expression cassette and a Cas9 gene expression cassette.

[0027] The sgRNA gene expression cassette includes a promoter for initiating sgRNA gene expression. The preferred promoter for initiating sgRNA gene expression is the CsU6 promoter.

[0028] The Cas9 gene expression cassette includes a promoter for initiating Cas9 gene expression. The promoter for initiating Cas9 gene expression is preferably the CmYLCV promoter.

[0029] Furthermore, the target sequence of the sgRNA is shown in positions 1105-1124 of sequence 1.

[0030] The nucleotide sequence of the CsU6 promoter is shown in Sequence 6.

[0031] The nucleotide sequence of the CmYLCV promoter is shown in Sequence 7.

[0032] To address the aforementioned technical problems, the present invention also provides a method for improving plant resistance to Huanglongbing or for cultivating Huanglongbing-resistant plants.

[0033] The method for improving plant resistance to Huanglongbing or cultivating Huanglongbing-resistant plants provided by the present invention includes the step of knocking out the full length or a portion of the above-mentioned DNA molecule; the PUB21 gene promoter in the recipient plant contains the above-mentioned DNA molecule.

[0034] Furthermore, the method for knocking out the full length or part of the above-mentioned DNA molecule in the recipient plant involves introducing a substance that knocks out the full length or part of the above-mentioned DNA molecule into the recipient plant.

[0035] The substance that knocks out the full length or part of the above-mentioned DNA molecule is a CRISPR / Cas9 gene editing vector that knocks out the full length or part of the above-mentioned DNA molecule; the CRISPR / Cas9 gene editing vector expresses sgRNA and Cas9 protein that target the full length or part of the above-mentioned DNA molecule.

[0036] Furthermore, the CRISPR / Cas9 gene editing vector comprises an sgRNA gene expression cassette and a Cas9 gene expression cassette.

[0037] The sgRNA gene expression cassette includes a promoter for initiating sgRNA gene expression. The preferred promoter for initiating sgRNA gene expression is the CsU6 promoter.

[0038] The Cas9 gene expression cassette includes a promoter for initiating Cas9 gene expression. The promoter for initiating Cas9 gene expression is preferably the CmYLCV promoter.

[0039] Furthermore, the target sequence of the sgRNA is shown in positions 1105-1124 of sequence 1.

[0040] The nucleotide sequence of the CsU6 promoter is shown in Sequence 6.

[0041] The nucleotide sequence of the CmYLCV promoter is shown in Sequence 7.

[0042] To address the aforementioned technical problems, the present invention also provides a method for improving plant resistance to Huanglongbing or for cultivating Huanglongbing-resistant plants.

[0043] The method for improving plant resistance to Huanglongbing or cultivating Huanglongbing-resistant plants provided by the present invention includes the step of deleting positions 1113-1196 of the PUB21 gene promoter in the genomic DNA of the recipient plant.

[0044] In some implementations, the deletion is a homozygous substitution, meaning that the same deletion occurs in homologous chromosomes.

[0045] The sequence of the characteristic motif (G-box like) that binds to the transcription factor MYC2 described above is as follows: CANNTG.

[0046] The PUB21 gene promoter mentioned above is the CsPUB21 gene promoter. The sequence of the CsPUB21 gene promoter is shown in Sequence 1.

[0047] The transcription factor MYC2 mentioned above is the transcription factor CsMYC2. The amino acid sequence and coding region sequence (CDS) of the transcription factor CsMYC2 are described in the invention patent application document with publication number CN115160421A.

[0048] In any of the above applications or methods, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0049] The dicotyledonous plants mentioned are plants of the Rutales order.

[0050] The plants mentioned belong to the Rutaceae family.

[0051] The plant in question belongs to the genus Citrus.

[0052] The Citrus species mentioned are citrus.

[0053] In some embodiments, the citrus fruit may be at least one of the following varieties: Simons sweet orange (C. sinensis), mandarin orange (C. reticulata), Daoxian wild orange (C. daoxianensis), Linwu orange (C. linwuensis), Mangshan wild orange (C. mangshanensis), and Fumin trifoliata (P. trifoliata).

[0054] This invention employs multiple sequence alignment (MSA) to analyze the genome sequences of Huanglongbing-susceptible species (Simons sweet orange, mandarin orange), tolerant species (Daoxian wild orange, Linwu orange, Mangshan wild orange, Fumin trifoliate orange), and resistant species (Australian lemon, Murraya paniculata, curry). The analysis revealed a 150bp Helitron transposon insertion in the promoter region of the disease-susceptible gene PUB21 in both susceptible and tolerant species. Furthermore, this invention identified multiple DNA motifs (G-box like: CANNTG) that bind to the transcription factor MYC2. MYC2 can bind to these motifs and exert its transcriptional activity to activate the expression of the PUB21 gene, forming a tight feedback loop of PUB21pro-PUB21-MYC2. This invention is the first to identify the presence of a DNA transposon Helitron insertion in the promoter (PUB21pro) of the E3 ubiquitin ligase gene PUB21 in citrus, clarifying the tight feedback loop composed of PUB21 and its ubiquitination substrate MYC2 transcription factor. This explains the molecular mechanism underlying the different susceptibility of different species to Huanglongbing (HLB) and provides a breeding strategy to reduce the expression level of the susceptible gene PUB21 by knocking out (deleting) or modifying the Helitron transposon fragment in the promoter region of the susceptible gene PUB21, thereby enhancing the disease resistance of citrus. This resistance breeding strategy can effectively resist the replication and spread of HLB pathogens and has excellent potential application value for the control of citrus HLB. Attached Figure Description

[0055] Figure 1 The insertion of the Helitron promoter of the PUB21 gene in species with different susceptibility to Huanglongbing (HLB) is shown. Figure 1 A shows a schematic diagram of Helitron insertion in the PUB21 promoter region of Rutaceae species. Helitron insertion is present in the PUB21 gene promoter of Huanglongbing-sensitive and resistant species (Simons sweet orange, Daoxian wild orange, Mangshan wild orange, Fumin trifoliate orange, etc.), while Helitron insertion is not present in Huanglongbing-resistant species (Australian lemon, Murraya paniculata, curry). Figure 1 B shows that a Helitron insertion exists in the CsPUB21 promoter of sweet orange.

[0056] Figure 2 CsMYC2 can bind to the G-box like motif (CANNTG) in Helitron and exert transcription factor activity to transcribe and activate the expression of the PUB21 gene. Figure 2 A shows the relative expression levels of the CsPUB21 gene in citrus with CsMYC2 silencing and transient overexpression. Values ​​are mean ± SEM (n = 3) (**P < 0.01, Student's t-test). Figure 2 B shows that the CsMYC2 protein directly targets the CsPUB21 gene by binding to its promoter. The relative enrichment folds of CsMYC2 protein with various DNA regions of the CsPUB21 promoter were shown in chromatin immunoprecipitation (ChIP). Data represent mean ± SEM (n=4) (ns indicate no significant difference; *P<0.05, **P<0.01, Student's t-test). Figure 2 C shows the electrophoretic mobility assay (EMSA) of the binding of CsMYC2 protein to the CsPUB21 promoter DNA region. Figure 2 D shows the DNA-binding activity of the CsMYC2 protein with each G-box like motif in the Helitron transposon. "G" indicates a G-box like motif, and "mG" indicates a mutated G-box like motif.

[0057] Figure 3 Analysis of the expression of the PUB21 gene transcribed by the CsMYC2 protein. Figure 3 A shows a schematic diagram of the constructs of CsMYC2 as the effector and PUB21pro-LUC as the reporter system. CsPUB21 promoter-luciferase (LUC); CsPUB21 ΔhelThe promoter-LUC; MpPUB21 promoter-LUC; MpPUB21 promoter-LUC is used as the reporting system builder. YFP and CsMYC2 driven by the 35S promoter are used as effector builder. Figure 3 B shows the relative luciferase activity intensity of CsMYC2 activating the PUB21 promoter in tobacco. Data represent mean ± SEM (n = 8). Lowercase letters indicate significant differences between columns based on one-way ANOVA and Duncan's multiple range test (P < 0.05). Figure 3 C shows luciferase imaging of the transcriptional activity of YFP and CsMYC2 on different PUB21 promoters in tobacco. Figure 3 D shows the β-glucuronidase (GUS) staining of YFP and CsMYC2 in tobacco for transcriptional activity against different PUB21 promoters. Figure 3 E shows the relative β-glucuronidase activity intensity of CsMYC2 activating the PUB21 promoter in tobacco. Values ​​are mean ± SEM (n = 8). According to one-way ANOVA and Duncan's multiple range test, lowercase letters indicate significant differences between different columns (P < 0.05).

[0058] Figure 4 To illustrate and analyze the deletion region of Helitron in sweet orange protoplasts using the CRISPR-Cas9 system, and to determine the gene expression level of CsPUB21 and the relative titer of pathogen CLas in Huanglongbing-infected protoplasts after Helitron editing. Figure 4 A shows the editing efficiency of the CRISPR-Cas9 system in citrus protoplasts (Cas9-CsPUB21) identified by PCR / RE assay. Δhel (Promoter). Strip intensity was measured using ImageJ, and editing efficiency was analyzed based on strip intensity differences. Figure 4 B shows a partial diagram of the CsPUB21 promoter locus and Helitron design in the Crispr-Cas9 construct, along with illustrations of the edited and deleted sequences. PAM and Crispr-Cas9-recognized cleavage sequences are marked in red and red underlines, respectively, while G-box-like motifs in the Helitron are marked with blue boxes. Regions where fragments were deleted during protoplasmic editing transformation are marked with black "--". Figure 4 C shows the gene expression level of CsPUB21 after editing Helitron in citrus protoplasts using the Crispr-Cas9 system. Values ​​are mean ± SEM (n = 3) (*P < 0.05, Student's t-test). Figure 4D shows the relative titers of CLas after transfection of Huanglongbing-positive citrus protoplasts with the CRISPR-Cas9 system to edit Helitron. Values ​​are mean ± SEM (n = 4) (*P < 0.05, Student's t-test). Detailed Implementation

[0059] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0060] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0061] The pENTR-3C vector used in the following examples is a product of Invitrogen, and the antibiotic used is kanamycin (Kan). The pH7-YFP-DC vector used in the following examples is a product of Invitrogen, and the antibiotic used is spectinomycin (Spe).

[0062] The pBA-DC-myc vector used in the following examples is a product of Invitrogen, and the antibiotic used is spectinomycin (Spe). The pH7GWIWG2(II) vector used in the following examples is a product of Invitrogen, and the antibiotic used is spectinomycin (Spe).

[0063] The pGEX-MBP vector used in the following examples is a product of Invitrogen, and the antibiotic used is ampicillin (Amp).

[0064] The pKGWFS7.0-GUS vector used in the following examples is a product of Invitrogen, and the antibiotic used is spectinomycin (Spe).

[0065] The pGWB435-LUC vector used in the following examples is a product of Invitrogen, and the antibiotic used is spectinomycin (Spe).

[0066] The 35S:YFP control vector in the following examples is the vector obtained by cloning the YFP gene into the pBA-DC-myc vector.

[0067] The CRISPR-Cas9 vector used in the following examples is described in the literature "Yi Zhang, Zhen Liang, Yuan Zong, Yanpeng Wang, Jinxing Liu, Kunling Chen, Jin-Long Qiu, Caixia Gao. Efficient and transgene-free genome editing in wheat through transient expression of CRISPR / Cas9 DNA or RNA. Nat Commun., 2016, 7:12617.", and the antibiotic used is kanamycin (Kan).

[0068] The PE2(V2) vector in the following examples is described in the literature “Zhen Liang, Yuqing Wu, Yingjie Guo, Sha Wei. Addition of the T5 exonuclease increases the prime editing efficiency in plants. Journal of Genetics and Genomics, 2023, 50(8):582-588.”, and the antibiotic used is kanamycin.

[0069] The following examples used *Citrus maxima*, a Rutaceae plant, which was collected from Danzhou City, Hainan Province; *Citrus sinensis*, *Citrus daoxianensis*, *Microcitrus australis*, *Citrus mangshanensis*, and *Murrayakoenigii* were all collected from the Citrus Resource Nursery of the Citrus Research Institute of Southwest University, Chongqing; *Poncirus polyandra* was collected from Kunming City, Yunnan Province; and *Murraya paniculata* was collected from Guangzhou City, Guangzhou Province. *Citrus sinensis*, *Citrus maxima*, and *Murraya paniculata* were cultivated in a laboratory greenhouse at a temperature maintained at 27°C and a relative humidity of 50%.

[0070] The main reagents and their sources in the following examples are as follows:

[0071] Reagents used in molecular cloning: EX Taq DNA polymerase and LA Taq DNA polymerase are both products of Takara Bio; restriction endonucleases and T4 DNA ligases are both products of NEB Biotech; homologous recombination ligase VazymeClonExpressII One Step Cloning C112 is a product of Novizumab; antibiotics used are products of Inolco Biotech; 1Kb DNA marker and 2000bp DNA marker are both products of Biomed Biotech; and SYBR qPCRMix is ​​a product of TOYOBO Biotech.

[0072] Reagents used in protein-related experiments: Cocktail protease inhibitor is a product of Roche, IPTG is a product of Inolco, 40% Acrylamide is a product of Sigma, the primary and secondary antibodies are products of Beijing TransGen Biotech Co., Ltd., and the pre-stained protein molecular weight marker is a product of Bio-Edge Biotechnology Co., Ltd.

[0073] Reagent kits: The plasmid mini-extraction kit, plasmid large-scale extraction kit, agarose gel DNA recovery kit, and DNA purification and recovery kit were all products of AxyGen. The plant RNA mini-extraction kit was a product of Qiagen. The ECL luminescence solution was a product of GE Healthcare. The reverse transcription kit was a product of Beijing TransGen Biotechnology Co., Ltd. The conventional primers used in the following examples were synthesized by Qingke Biotechnology Co., Ltd., and related sequencing work was performed. The biotin-labeled EMSA primers were synthesized by Tianyi Huiyuan Biotechnology Co., Ltd.

[0074] The nucleotide sequence of the CsPUB21 gene promoter in the following examples is shown in Sequence 1, and the nucleotide sequence of Helitron is shown in Sequence 2.

[0075] The nucleotide sequence of the MpPUB21 gene promoter in the following examples is shown in Sequence 3.

[0076] The nucleotide sequence of the BkPUB21 gene promoter in the following examples is shown in Sequence 4.

[0077] The amino acid sequence of the CsMYC2 protein and the CsMYC2 gene coding region sequence (CDS) in the following examples are described in the invention patent application document with publication number CN115160421A.

[0078] Example 1: Detection of the insertion of the PUB21 gene promoter Helitron in different Rutaceae species

[0079] I. Sequence alignment of the PUB21 gene promoter in different Rutaceae species

[0080] 1. Retrieval of PUB21 starter sequence

[0081] The genome sequences of plants such as *C. sinensis*, *C. reticulata*, *C. daoxianensis*, *C. linwuensis*, *C. mangshanensis*, *P. trifoliata*, *C. maxima*, *C. hongheensis*, *C. ichangensis*, *M. australasica*, *C. medica*, *M. paniculata*, and *B. koenigii* were searched using the CsPUB21 sequence of *C. sinensis*. The most similar PUB21 sequence in other plant genomes was found by comparing the CsPUB21 sequence of *C. sinensis*. Based on the location of the PUB21 sequence in the genome, the promoter sequence upstream of the PUB21 sequence was searched for within 2000 bp. The found promoter sequences were saved as text.

[0082] 2. Comparative analysis of PUB21 promoter sequences

[0083] Multiple sequence alignment (MSA) analysis of the promoter nucleotide sequences of different Rutaceae species was performed using DNAMAN sequence analysis software. Sequence difference analysis revealed that a fragment of 87-150 bp was inserted in the PUB21 promoter (841 bp upstream of the transcription start site) of several plants susceptible to and resistant to Huanglongbing (HLB). However, this fragment was not present in the PUB21 promoter of plants with high resistance to HLB, such as Hainan Sanhong Honey Pomelo (C. maxima), Lianjiang Red Orange (C. hongheensis), Yichang Orange (C. ichangensis), Australian Finger Lemon (M. australasica), Citron (C. medica), Murraya paniculata (M. paniculata), and Curry (B. koenigii). Further analysis of the sequence characteristics of the inserted fragment revealed that it is rich in characteristic motifs (G-box like: CANNTG) for binding to transcription factor CsMYC2 (N represents A, T, C, G), indicating that the inserted fragment may be related to further transcriptional activation or inhibition of PUB21 gene expression by binding to transcription factor CsMYC2.

[0084] II. Identification of the DNA fragment inserted into the PUB21 promoter

[0085] Transposon annotation of the Simmons sweet orange genome was performed using the EDTA method. The annotated transposon library was then compared with a 150bp insertion sequence in the CsPUB21 promoter using the Repeatmaker method. The result showed that this insertion sequence belongs to the class III transposon, Helitron. Helitron transposons are repetitive single-stranded (ssDNA) virus-like DNA transposons that significantly influence genomic variation by capturing and manipulating host genome sequences.

[0086] Example 2: CsMYC2 binding to G-box-like motifs in Helitron regulates PUB21 gene expression. I. Construction of vectors for silencing and overexpressing the citrus CsMYC2 gene.

[0087] 1. Design primers for gene fragment amplification. The primer sequences are as follows:

[0088] CsMYC2-Fw(KpnI): CAAG GGTACC ATGACGGACTACCGGTTACC;

[0089] CsMYC2-Rv(XhoI): CAAG CTCGAG TTATTGGGTATCTCCAACTT;

[0090] CsMYC2-800RNAi-Rv(XhoI):CAAG CTCGAG GGCCAAGTACCAATCTCCAT;

[0091] The underlined nucleotide sequences represent the restriction enzyme recognition sites GGTACC for KpnI and CTCGAG for XhoI.

[0092] 2. Using Simmons orange cDNA as a template, PCR amplification was performed using primers CsMYC2-Fw (KpnI) and CsMYC2-Rv (XhoI) to obtain a gene fragment of 2058 bp.

[0093] Using Simmons orange cDNA as a template, PCR amplification was performed using primers CsMYC2-Fw (KpnI) and CsMYC2-800RNAi-Rv (XhoI) to obtain an 800bp CsMYC2 gene silencing fragment, the nucleotide sequence of which is shown in Sequence 5.

[0094] 3. The pENTR-3C vector was double-digested with restriction endonucleases KpnI and XhoI to obtain the backbone vector. Then, the backbone vector was ligated with the 2058bp CsMYC2 gene and the 800bp CsMYC2 gene silencing fragment from step 2 using T4 DNA ligase to obtain the intermediate vectors pENTR-3C-CsMYC2 and pENTR-3C-CsMYC2-RNAi, respectively.

[0095] 4. The intermediate vector pENTR-3C-CsMYC2 and the expression vector pH7-YFP-DC were ligated by the LR reaction using the recombinase (Gateway LR Clonase II) to obtain the overexpression vector 35S:YFP-CsMYC2.

[0096] The intermediate vector pENTR-3C-CsMYC2-RNAi and the gene silencing vector pH7GWIWG2(II) were ligated using the recombinase (Gateway LR Clonase II) via the LR reaction to obtain the gene silencing vector CsMYC2-RNAi.

[0097] 5. The overexpression vector 35S:YFP-CsMYC2 and the gene silencing vector CsMYC2-RNAi, as well as the control vector (35S promoter-driven YFP expression vector 35S:YFP) prepared in step 4, were transformed into Agrobacterium GV3101 strain by electroporation.

[0098] II. CsMYC2 gene silencing and overexpression in citrus leaves

[0099] 1. First, spread Xanthomonas citri subsp. citri (Xcc) on antibiotic-free LB agar plates and incubate overnight at 28°C. Collect the bacterial cells with sterile water and adjust the OD. 600nm The value was 0.5. Then, Xcc bacterial solution (which weakens the immunity of citrus and increases the expression of the vector gene in citrus leaves) was injected into the Simmons sweet orange leaves with 1 mL syringe to obtain sweet orange leaves injected with Xcc bacterial solution, and then placed in the greenhouse for further cultivation.

[0100] 2. Agrobacterium GV3101 containing the overexpression vector 35S:YFP-CsMYC2, the gene silencing vector CsMYC2-RNAi, and the control vector were respectively plated on LB agar plates containing kanamycin and rifampicin. The cells were incubated overnight at 28°C. The cells were collected using MMA solution (10 mM MgCl2, 10 mM MES, 150 μM Acetosyringone), and the OD was adjusted. 600nm The value is 1.0, and it should be left to stand at room temperature for more than three hours.

[0101] 3. Six to eight hours after injecting the Xcc bacterial solution into the leaves, the leaves of sweet oranges injected with the Xcc bacterial solution were immersed in the bacterial solution containing the overexpression vector, the gene silencing vector, and the control vector, respectively, using a vacuum injection method. The leaves were then placed in a plant growth chamber and grown for 72 hours.

[0102] III. CsMYC2 can effectively regulate the expression level of the CsPUB21 gene.

[0103] 1. Leaf samples were collected 3 days after growth. RNA was extracted from the samples using an RNA extraction kit, and cDNA was synthesized by reverse transcription. Overexpression and silenced genes were detected by real-time PCR with COX as the internal reference gene. The quantitative primer sequences are as follows: Citrus CsMYC2 gene detection primer CsMYC2-qF: CTACAGCCGACCCCATGAAG;

[0104] Citrus CsMYC2 gene detection primers: CsMYC2-qR: TACCCATCGCCCCATCCTAA;

[0105] Citrus internal reference gene detection primers COX-qF: GTATGCCACGTCGCATTCCAGA;

[0106] Citrus internal reference gene detection primers COX-qR: GCCAAAACTGCTAAGGGCATTC;

[0107] The results are as follows Figure 2 As shown in Figure A, the results indicate that the expression level of the CsMYC2 gene in the CsMYC2 overexpressing citrus samples was significantly higher than that in the control samples, while the expression level of the CsMYC2 gene in the CsMYC2 gene-silenced citrus samples was significantly lower than that in the control samples. This suggests that the constructed overexpression and silencing vectors can effectively overexpress and silence the expression level of the CsMYC2 gene.

[0108] 2. Simultaneously, using the cDNA samples from step 1, the expression level of the CsPUB21 gene in CsMYC2-overexpressing citrus samples and CsMYC2 gene-silenced citrus samples was detected by real-time quantitative PCR, with COX as the internal reference gene. The quantitative primer sequences are as follows:

[0109] Citrus CsPUB21 gene detection primers CsPUB21-qF: CGTTGGTCGTCGTCTATCGT;

[0110] Citrus CsPUB21 gene detection primers: CsPUB21-qR: AATGGAGACTGCGAACTCCG.

[0111] The results are as follows Figure 1As shown in Figure B, the results indicate that the expression level of the CsPUB21 gene in the CsMYC2 gene-silenced citrus samples was significantly lower than that in the control samples, while the expression level of the CsPUB21 gene in the CsMYC2-overexpressed citrus samples was significantly higher than that in the control samples, indicating that CsMYC2 can effectively regulate the expression level of the CsPUB21 gene.

[0112] IV. Verification of CsMYC2 binding to G-box-like motifs in Helitron using chromatin immunoprecipitation (CHIP) technique

[0113] 1. Synthesis of primers for detecting the PUB21 promoter G-box like motif

[0114] DNAMAN software was used to predict the CsMYC2 binding G-box-like motif in the CsPUB21 promoter sequence of sweet orange. A total of 14 motifs were predicted, distributed in the pre-, mid-, and post-promoter regions. Based on the distribution location of the motifs, they were divided into segments I, II, III, and IV, each 150 bp in length, containing an indefinite number of G-box-like motifs. The 150 bp upstream of the promoter without any G-box-like motifs was selected as the control region. Quantitative detection primers for segments I, II, III, IV, and the control region were synthesized using the NCBI-prime blast website. The quantitative primer sequences are as follows:

[0115] CsPUB21pro-I-qF: AGGAGGAAATATAACTCAAA;

[0116] CsPUB21pro-I-qR:GAATAAATCAAATCAAAGCT;

[0117] CsPUB21pro-Ⅱ-qF: AGGATCAGGCTACGGTGTAA;

[0118] CsPUB21pro-Ⅱ-qR: CACACAATAAATTACGGGGG;

[0119] CsPUB21pro-Ⅲ-qF:GTGACAGTAAATTCAACTCATC;

[0120] CsPUB21pro-Ⅲ-qR: GCTGAGTTCATTAGTTTCAC;

[0121] CsPUB21pro-IV-qF: CAGTCTAATATGAGCGCCTC;

[0122] CsPUB21pro-IV-qR: GTGCTTTGAGCGTGATTTAA;

[0123] CsPUB21pro-ck-qF:GTCAAGATTAGCATACACACT;

[0124] CsPUB21pro-ck-qR:TATCCAATGGATATACGTGT.

[0125] 2. Construction of MBP-CsMYC2 protein expression and purification vector and protein purification

[0126] (1) Based on the intermediate vector pENTR-3C-CsMYC2 obtained in step one, the intermediate vector pENTR-3C-CsMYC2 and the protein expression purification vector pGEX-MBP were linked by the LR reaction using the recombinase (Gateway LRClonase II) to obtain the CsMYC2 protein expression purification vector pGEX-CsMYC2-MBP.

[0127] (2) The pGEX-CsMYC2-MBP vector constructed in step (1) above was transformed into BL21(DE3) competent cells for protein induction and purification. The MBP-CsMYC2 fusion protein was obtained by purification with anti-MBP Tag immunomagnetic beads. At the same time, the pGEX-MBP empty vector was transformed into BL21(DE3) competent cells for protein induction and purification. The MBP-tagged protein was obtained by purification with anti-MBP Tag immunomagnetic beads.

[0128] 3. The enrichment fold of CsMYC2 binding to the CsPUB21 promoter was verified using chromatin immunoprecipitation (CHIP).

[0129] The binding ability of MBP-CsMYC2 protein to regions I, II, III, and IV of the PUB21 promoter and the control region was detected in vitro using chromatin immunoprecipitation. The concentrations of regions I, II, III, and IV and the control region after enrichment were detected by quantitative real-time PCR using the final DNA product, with COX as the internal reference gene. The specific primer sequences are described in step 1 above.

[0130] The results are as follows Figure 2 As shown in B, the results show that compared with the relative enrichment fold of the control region, segments I, II, and III can significantly bind to and enrich MBP-CsMYC2. Among them, MBP-CsMYC2 has the strongest binding ability to segments II and III, which are rich in G-box like motifs, indicating that CsMYC2 can bind to the CsPUB21 promoter by binding to G-box like motifs.

[0131] V. Verification of CsMYC2 binding to G-box-like motifs in Helitron using electrophoretic mobility analysis (EMSA)

[0132] 1. Synthesis of biotin-tagged primers for the CsPUB21 promoter EMSA

[0133] Based on the division of the CsPUB21 promoter into G-box-like motif-rich regions I, II, and III in step four above, biomarker-encapsulated EMSA detection primers for regions I, II, III, and the control region were designed and synthesized. The primer sequences are as follows:

[0134] CsPUB21pro-I-Fw:AGGAGGAAATATAACTCAAA;

[0135] CsPUB21pro-I-Rv:GAATAAATCAAATCAAAGCT;

[0136] CsPUB21pro-II-Fw:AGGATCAGGCTACGGTGTAA;

[0137] CsPUB21pro-II-Rv:CACACAATAAATTACGGGGG;

[0138] CsPUB21pro-III-Fw:GTGACAGTAAATTCAACTCATC;

[0139] CsPUB21pro-III-Rv: GCTGAGTTCATTAGTTTCAC;

[0140] Separate EMSA detection primers and mutation detection primers were designed for the G-box-like motif-rich region II of the Helitron insertion. The primer sequences are as follows:

[0141] CsPUB21pro-H123-Fw: CCGTACTACAGTTGCATCCAGCTGTTGGATGCACTTGGATTAGTG;

[0142] CsPUB21pro-H123-Rv:CACTAATCCAAGTGCATCCAACAGCTGGATGCAACTGTAGTACGG;

[0143] CsPUB21pro-Hm123-Fw: CCGTACTATTGTAACATCCAGCTGTTGGATGCACTTGGATTAGTG;

[0144] CsPUB21pro-Hm123-Rv:CACTAATCCAAGTGCATCCAACAGCTGGATGTTACAATAGTACGG;

[0145] CsPUB21pro-Hm1m23-Fw:CCGTACTATTGTAACATCTTGCAATTGGATGCACTTGGATTAGTG;

[0146] CsPUB21pro-Hm1m23-Rv:CACTAATCCAAGTGCATCCAATTGCAAGATGTTACAATAGTACGG;

[0147] CsPUB21pro-Hm12m3-Fw:CCGTACTATTGTAACATCCAGCTGTTGGATGTTCTAAGATTAGTG;

[0148] CsPUB21pro-Hm12m3-Rv:CACTAATCTTAGAACATCCAACAGCTGGATGTTACAATAGTACGG;

[0149] CsPUB21pro-Hm1m2m3-Fw:CCGTACTATTGTAACATCTTGCAATTGGATGTTCTAAGATTAGTG;

[0150] CsPUB21pro-Hm1m2m3-Rv:CACTAATCTTAGAACATCCAATTGCAAGATGTTACAATAGTACGG;

[0151] CsPUB21pro-H12m3-Fw:CCGTACTACAGTTGCATCTTGCAATTGGATGCACTTGGATTAGTG;

[0152] CsPUB21pro-H12m3-Rv:CACTAATCCAAGTGCATCCAATTGCAAGATGCAACTGTAGTACGG;

[0153] CsPUB21pro-Hm45-Fw:GCTTGATGTTACAATAACACAGTACCACAGTTGCACCAT;

[0154] CsPUB21pro-Hm45-Rv:ATGGTGCAACTGTGGTACTGTGTTATTGTAACATCAAGC;

[0155] CsPUB21pro-H4m5-Fw:GCTTGATGCAACTGTAACACAGTACCATTGTAACACCAT;

[0156] CsPUB21pro-H4m5-Rv: ATGGTGTTACAATGGTACTGTGTTACAGTTGCATCAAGC;

[0157] CsPUB21pro-H45-Fw:GCTTGATGCAACTGTAACACAGTACCACAGTTGCACCAT;

[0158] CsPUB21pro-H45-Rv: ATGGTGCAACTGTGGTACTGTGTTACAGTTGCATCAAGC.

[0159] The synthesized primers were mixed in a 1:1 molar ratio and added to the annealing solution. The mixture was annealed at 75°C for 30 min to form DNA dimers. The mixture was then allowed to cool naturally to room temperature and kept at -20°C.

[0160] 2. Electrophoretic mobility analysis (EMSA) was used to verify the binding ability of CsMYC2 to G-box-like motifs in Helitron.

[0161] The binding affinity of MBP-CsMYC2 protein to regions I, II, and III of the CsPUB21 promoter was determined in vitro using electrophoretic mobility assay. The binding affinity of MBP-CsMYC2 to G-box-like motifs in the Helitron region of CsPUB21 promoter regions I, II, and III was assessed using electrophoretic mobility assay, with MBP-tagged proteins serving as controls.

[0162] The results are as follows Figure 2 As shown in Figure C, the results indicate that, compared to the control tag protein MBP, which does not form a CsMYC2-DNA complex with DNA dimers in regions I, II, and III of the CsPUB21 promoter, the MBP-CsMYC2 protein can significantly bind to DNA dimers in regions I, II, and III of the CsPUB21 promoter to form a CsMYC2-DNA complex. This results in a decrease in the electrophoretic mobility of the DNA dimer and the formation of a distinct CsMYC2-DNA complex binding band.

[0163] Further analysis of the binding affinity of CsMYC2 to each G-box-like motif in Helitron yielded the following results: Figure 2As shown in Figure D, the results indicate that the MBP-CsMYC2 protein can significantly bind to each G-box like motif in the Helitron and form a CsMYC2-DNA complex. However, when a completely mutated G-box like motif is used, this binding ability disappears, and no CsMYC2-DNA complex is formed. This suggests that CsMYC2 can bind to the CsPUB21 promoter by binding to G-box like motifs. The inserted Helitron is rich in G-box like motifs, which can significantly enhance the binding ability of CsMYC2 to the CsPUB21 promoter and thus promote the expression of the disease-susceptibility gene CsPUB21.

[0164] Example 3: CsMYC2 protein transcriptional activation of PUB21 gene expression

[0165] I. Construction of the PUB21 promoter activity reporter system (LUC / GUS) vector

[0166] 1. Design primers for promoter fragment amplification. The primer sequences are as follows:

[0167] CsPUB21pro-Fw(BamHI): CCAATTCAGTCGACTGGATCC TCACGCTCAAAGCACTACGA;

[0168] CsPUB21pro-Rv(XhoI): GCTGGGTCTAGATATCTCGAG GCAAGCCAGCAGTATGCAAG;

[0169] MpPUB21pro-Fw(BamHI): CCAATTCAGTCGACTGGATCC GTGGTCTAATATGAACGCCTC;

[0170] MpPUB21pro-Rv(XhoI): GCTGGGTCTAGATATCTCGAG GCAAGCCAGCAATACGCAAG;

[0171] BkPUB21pro-Fw(BamHI): CCAATTCAGTCGACTGGATCC TCGAATGCCTGGCCGATTTT;

[0172] BkPUB21pro-Rv(XhoI): GCTGGGTCTAGATATCTCGAG CCTTGAACAAAAGAAGCAGGCC;

[0173] CsPUB21 ΔHel pro-Fw: CATTTAGATACATGA AATTTATTGTGTGTTTTCAATTAAGG;

[0174] CsPUB21ΔHel pro-Rv: AACACACAATAAAT TCATGTATCTAAATGTTATTATCGCG; where the underlined nucleotide sequence is the homologous arm sequence with the BamHI restriction site and the XhoI restriction site.

[0175] 2. Using Simmons orange cDNA as a template, PCR amplification was performed using primers CsPUB21pro-Fw (BamHI) and CsPUB21pro-Rv (XhoI) to obtain a CsPUB21pro gene fragment (sequence 1) with a size of 2059 bp.

[0176] Using Murraya paniculata cDNA as a template, PCR amplification was performed using primers MpPUB21pro-Fw (BamHI) and MpPUB21pro-Rv (XhoI) to obtain a 1949bp MpPUB21pro gene fragment (sequence 3).

[0177] Using curry cDNA as a template, PCR amplification was performed using primers BkPUB21pro-Fw (BamHI) and BkPUB21pro-Rv (XhoI) to obtain a 1758 bp BkPUB21pro gene fragment (sequence 4).

[0178] Using the CsPUB21pro gene fragment as a template, primers CsPUB21pro-Fw(BamHI) and CsPUB21 were used respectively. ΔHel pro-Rv and primer CsPUB21 ΔHel PCR amplification was performed using pro-Fw and CsPUB21pro-Rv(XhoI) to obtain gene fragments of 1068 bp and 841 bp, respectively. 100 ng of each fragment was then used for PCR with primers CsPUB21pro-Fw(BamHI) and CsPUB21pro-Rv(XhoI) to splice them together, resulting in a 1909 bp CsPUB21pro gene fragment lacking Helitron, which was designated CsPUB21. ΔHel pro gene fragment. CsPUB21 ΔHel The pro gene fragment is obtained by deleting positions 1069-1218 of sequence 1.

[0179] 3. The pENTR-3C vector was double-digested with restriction endonucleases BamHI and XhoI to obtain the backbone vector; then, the backbone vector was ligated with the four fragments from step 2 (CsPUB21pro gene fragment, MpPUB21pro gene fragment, BkPUB21pro gene fragment, or CsPUB21) using T4 DNA ligase.ΔHel The pro gene fragment was ligated to obtain the intermediate vectors pENTR-3C-CsPUB21pro, pENTR-3C-MpPUB21pro, pENTR-3C-BkPUB21pro, and pENTR-3C-CsPUB21, respectively. ΔHel pro.

[0180] 4. Using the recombinase (Gateway LR Clonase II), the intermediate vectors pENTR-3C-CsPUB21pro, pENTR-3C-MpPUB21pro, pENTR-3C-BkPUB21pro, and pENTR-3C-CsPUB21 were respectively transfected. ΔHel The pro expression vector pKGWFS7.0-GUS was ligated to the expression vector pKGWFS7.0-GUS via a LR reaction, yielding the recombinant vectors pKGWFS7.0-CsPUB21pro-GUS, pKGWFS7.0-MpPUB21pro-GUS, pKGWFS7.0-BkPUB21pro-GUS, and pKGWFS7.0-CsPUB21, respectively. ΔHel pro-GUS.

[0181] Using the recombinase (Gateway LR Clonase II), the intermediate vectors pENTR-3C-CsPUB21pro, pENTR-3C-MpPUB21pro, pENTR-3C-BkPUB21pro, and pENTR-3C-CsPUB21 were respectively transfected. ΔHel The pro expression vector pGWB435-LUC was ligated to the expression vector pGWB435-LUC via an LR reaction, yielding the recombinant vectors pGWB435-CsPUB21pro-LUC, pGWB435-MpPUB21pro-LUC, pGWB435-BkPUB21pro-LUC, and pGWB435-CsPUB21, respectively. ΔHel pro-LUC. Structural diagrams of each recombinant vector are shown below. Figure 3 As shown in Figure A.

[0182] 5. The recombinant vectors prepared in step 4 were transformed into Agrobacterium GV3101 strain by electroporation.

[0183] II. Validation of the reporter system for CsMYC2 transcriptional activation of PUB21-LUC in tobacco leaves

[0184] 1. Agrobacterium GV3101 containing the overexpression vector 35S:YFP-CsMYC2 or the control vector 35S:YFP, and the LUC reporter system vectors pGWB435-CsPUB21pro-LUC, pGWB435-MpPUB21pro-LUC, pGWB435-BkPUB21pro-LUC, or pGWB435-CsPUB21 ΔHel Agrobacterium GV3101 pro-LUC was plated on LB agar plates containing spectinomycin and rifampicin, incubated overnight at 28°C, and the bacterial cells were collected using MMA solution. OD was adjusted. 600nm The value is 1.0, and it should be left to stand at room temperature for more than three hours.

[0185] 2. According to Figure 3 The combination shown in C is mixed with the bacterial solution at a volume ratio of 1:1. The mixed bacterial solution is injected into the tobacco leaves using a 1mL syringe, and the leaves are then placed in a greenhouse for further cultivation for 48 hours.

[0186] 3. The effect of CsMYC2-YFP on the transcriptional activity of different PUB21 promoters was observed using cryo-fluorescence imaging.

[0187] The results are as follows Figure 3 As shown in B and 3C, the results indicate that, compared to the control YFP, CsMYC2-YFP can activate the PUB21 promoter and exhibit luciferase activity; among them, CsMYC2-YFP has the strongest ability to activate the CsPUB21 promoter and exhibits the most significant luciferase activity, while the CsPUB21 promoter lacking Helitron... ΔHel The activity of pro-luciferase was significantly weakened, and the activity of luciferase was even lower in the MpPUB21 promoter and BkPUB21 promoter lacking Helitron insertion. These results indicate that the transcriptional activation of PUB21 gene expression by the CsMYC2 transcription factor mainly functions through the Helitron insertion in the promoter region.

[0188] III. Validation of the PUB21-GUS reporter system for CsMYC2 transcriptional activation in tobacco leaves

[0189] 1. Agrobacterium GV3101 expressing the overexpression vector 35S:YFP-CsMYC2 or the control vector 35S:YFP, and containing the GUS reporter system vectors pKGWFS7.0-CsPUB21pro-GUS, pKGWFS7.0-MpPUB21pro-GUS, pKGWFS7.0-BkPUB21pro-GUS, or pKGWFS7.0-CsPUB21... ΔHelAgrobacterium GV3101 pro-GUS was plated on LB agar plates containing spectinomycin and rifampicin, incubated overnight at 28°C, and the bacterial cells were collected with MMA solution. OD was adjusted. 600nm The value is 1.0, and it should be left to stand at room temperature for more than three hours.

[0190] 2. According to Figure 3 The combination shown in C is mixed with the bacterial solution at a volume ratio of 1:1. The mixed bacterial solution is injected into the tobacco leaves using a 1mL syringe, and the leaves are then placed in a greenhouse for further cultivation for 48 hours.

[0191] 3. The effect of CsMYC2-YFP on the transcriptional activity of different PUB21 promoters was observed using β-glucuronidase (GUS) staining.

[0192] The results are as follows Figure 3 As shown in Figures D and 3E, the results indicate that, compared to the control YFP, CsMYC2-YFP significantly activated the PUB21 promoter, exhibiting a significant GUS staining response. Among them, CsMYC2-YFP demonstrated the strongest activation ability of the CsPUB21 promoter, exhibiting the most significant relative GUS activity. In contrast, the CsPUB21 promoter lacking Helitron… ΔHel The activity of proluciferase was significantly reduced, and the relative GUS activity of the MpPUB21 promoter lacking the Helitron insertion was even lower, verifying that the inserted Helitron transposon plays a major role in the transcriptional activation of PUB21 expression by the CsMYC2 transcription factor.

[0193] Example 4: Effective CLAs resistance by knocking out the Heliton region of the CsPUB21 promoter using the CRISPR-Cas9 editor.

[0194] To further confirm the impact of the PUB21 promoter Heliton on the pathogenic mechanism of the Huanglongbing susceptibility gene PUB21 itself, this invention uses the CRISPR-Cas9 editing system to delete and edit the Heliton region in the CsPUB21 promoter of susceptible citrus protoplasts to observe the resistance to Huanglongbing fungus. The specific steps are as follows:

[0195] I. Optimization of the CRISPR-Cas9 editing system starter

[0196] Since the initiating sgRNA and Cas9 promoters in the original CRISPR-Cas9 editing system are derived from OsU3 and MaUbi from rice and maize, the editing efficiency in citrus is low. Therefore, this invention optimizes the promoters in the CRISPR-Cas9 editing system.

[0197] 1. Design promoter amplification primers. The primer sequences are as follows:

[0198] CsU6-Cas9-Fw: AAAACGACGGCCAGTGCCAAGCTT GCGCTCAGGAGCCGGTTGAA;

[0199] CsU6-Cas9-Rv: GCTATTTCTAGCTCTAAAACCGAGACC TTGTGTTGGTCTCG;

[0200] CmYLCV-Cas9-Fw: TACTGCTTGCTGCTAAGCTT TGGCAGACATACTGTCCCAC;

[0201] CmYLCV-Cas9-Rv: GATCCGTCGACAAGCTCCTAGG AAGCTTAGCTCTTACCTGTTTTCG;

[0202] The underlined nucleotide sequences are the homologous arm sequences at both ends of the original promoter of the CRISPR-Cas9 editing system. Using Simmons orange cDNA as a template, PCR amplification was performed using primers CsU6-Cas9-Fw and CsU6-Cas9-Rv to obtain a 665bp CsU6 promoter gene fragment containing homologous arms, the nucleotide sequence of which is shown in Sequence 6.

[0203] Based on the CmYLCV promoter sequence downloaded from NCBI, a commercially synthesized CmYLCV promoter gene fragment with a size of 465 bp containing homologous arms was obtained at Qingke Biotechnology Co., Ltd., and its nucleotide sequence is shown in Sequence 7.

[0204] 2. Design primers for amplifying the intermediate fragment. The primer sequences are as follows:

[0205] Gap-sgRNA-Cas9-Fw: CGAGACCAACACAA GGTCTCGGTTTTAGAGCTAGAAATAGC;

[0206] Gap-sgRNA-Cas9-Fw: GTGGGACAGTATGTCTGCCA AAGCTTAGCAGCAAGCAGTA;

[0207] The underlined nucleotide sequences are the homologous arm sequences at both ends of the intermediate fragment of the CRISPR-Cas9 editing system.

[0208] Using the guide editing vector PE2(V2) as a template, PCR amplification was performed using primers Gap-sgRNA-Cas9-Fw and Gap-sgRNA-Cas9-Fw to obtain a 414bp intermediate fragment sequence of Gap-sgRNA containing homologous arms. Its nucleotide sequence is shown in Sequence 8.

[0209] 3. The CRISPR-Cas9 vector was digested with the restriction endonuclease HindШ to obtain a 16657 bp backbone vector fragment and a 2033 bp fragment. The 16657 bp backbone vector fragment was recovered. The recovered 16657 bp backbone vector fragment was then digested again with the restriction endonuclease AvrII to obtain a 14696 bp backbone vector fragment and a 2000 bp fragment. The 14696 bp backbone vector fragment was recovered.

[0210] 4. Take 100 ng of each of the CsU6 promoter, Gap-sgRNA and CmYLCV promoter fragments obtained by PCR in steps 1 and 2 and perform PCR using primers CsU6-Cas9-Fw and CmYLCV-Cas9-Rv to splice a fusion gene fragment of 1652 bp in size. Its nucleotide sequence is shown in sequence 9.

[0211] 5. Finally, the fusion fragment of 1652 bp from step 4 was recombined with the backbone vector of 14696 bp obtained in step 3 using C112 homologous recombinase. After ligation, transformation and identification, the promoter-optimized editing vector PHUE-CsU6-Gap-CmYLCV-Cas9 was obtained.

[0212] II. Construction of the Cas9-PUB21pro editing platform

[0213] 1. Design primers for Cas9-CsPUB21pro-sgRNA amplification. The primer sequences are as follows:

[0214] Cas9-CsPUB21pro-sgRNA-Fw: GTTG AGCTGGATGCAACTGTAGTA;

[0215] Cas9-CsPUB21pro-sgRNA-Rv: AAAC TACTACAGTTGCATCCAGCT;

[0216] The underlined nucleotide sequences are the sticky ends at both ends of the original gap region of the optimized editing vector PHUE-CsU6-Gap-CmYLCV-Cas9.

[0217] The primers Cas9-CsPUB21pro-sgRNA-Fw and Cas9-CsPUB21pro-sgRNA-Rv were mixed in a volume ratio of 1:1, treated at 95°C for 5 min, and then allowed to cool naturally at room temperature to form double-stranded DNA with sticky ends.

[0218] 2. The PHUE-CsU6-Gap-CmYLCV-Cas9 vector was digested with restriction endonuclease BsaI to obtain a linear backbone vector; then, the linear backbone vector was ligated with the double-stranded DNA fragment with sticky ends obtained in step 1 using C112 homologous recombinase to obtain the CRISPR-Cas9 editing vector PHUE-CsU6-CsPUB21pro-CmYLCV-Cas9.

[0219] The Crispr-Cas9 editing vector PHUE-CsU6-CsPUB21pro-CmYLCV-Cas9 contains an sgRNA gene expression cassette and a Cas9 gene expression cassette, expressing sgRNA and Cas9 protein targeting the Heliton region of the CsPUB21 promoter. Specifically, in the sgRNA gene expression cassette, the target sequence of the sgRNA is positions 1105-1124 of sequence 1, and the promoter used to initiate sgRNA gene expression is the CsU6 promoter; in the Cas9 gene expression cassette, the promoter used to initiate Cas9 gene expression is the CmYLCV promoter.

[0220] III. CRISPR-Cas9 editing and knocking out the CsPUB21 promoter Heliton can reduce the CLAs titer in the protoplasts of infected leaves.

[0221] 1. Large-scale extraction of the PHUE-CsU6-CsPUB21pro-CmYLCV-Cas9 recombinant plasmid

[0222] PHUE-CsU6-CsPUB21pro-CmYLCV-Cas9 was transferred into DH5α competent cells, streaked overnight on a solid LB agar plate containing Kan antibiotic, single colonies were picked and cultured overnight in 10 mL liquid LB agar containing Kan antibiotic, the bacterial culture was transferred to 200 mL liquid LB agar containing Kan antibiotic and cultured for 12 hours, the bacterial cells were collected and plasmids were extracted using the Tiangen (endotoxin-free) plasmid extraction kit.

[0223] 2. The plasmid extracted in step 1 was transformed into citrus protoplasts. First, infected young citrus (sweet orange) leaves were collected (infected citrus trees were grown in a laboratory greenhouse; infection was determined before the experiment by detecting the amount of the pathogen CLAs). The veins were removed, and the leaves were cut into thin strips. The strips were soaked in citrus leaf enzymatic hydrolysate and shaken in the dark for 5 hours. The hydrolysate was filtered through gauze, and after two washings, the protoplast precipitate was collected and placed on ice for about 30 minutes. Protoplast transformation was then performed using PEG4000-mediated transformation. The PHUE-CsU6-CsPUB21pro-CmYLCV-Cas9 recombinant plasmid was transformed in a 37℃ water bath for 30 minutes. After transformation, the supernatant was briefly removed by centrifugation, and protoplast culture medium was added and cultured in the dark for 48 hours. Simultaneously, the PHUE-CsU6-Gap-CmYLCV-Cas9 vector was used as a control.

[0224] 3. After culturing protoplasts for 48 hours, samples were collected, and protoplast DNA was extracted using the CTAB method. Primers for editing site enrichment and specific detection were synthesized. The primer sequences are as follows:

[0225] CsPUB21pro-Id-Fw:GTAAAAAAATGCACGGCC;

[0226] CsPUB21pro-Id-Rv:TTACTATCATTTCTTCTAACC.

[0227] Using extracted protoplast DNA as a template, PCR amplification was performed using the editing identification primers CsPUB21pro-Id-Fw and CsPUB21pro-Id-Rv to obtain a 491 bp CsPUB21pro-Id gene fragment. The PCR product was treated with the SfcI restriction endonuclease contained in the CsPUB21pro-sgRNA sequence. The editing efficiency of the digested PCR product was detected by agarose gel electrophoresis, with the amplified product of the wild-type genome without editing serving as a control. If editing occurred, a band of the same size as the amplified fragment could be detected.

[0228] The results are as follows Figure 4 As shown in Figure A, the results indicate that, compared with the undigested and digested wild-type CsPUB21pro-Id fragments, the CsPUB21pro-Id edited group exhibited a 491bp band of the same size as the amplified fragment. The band intensity was measured using ImageJ, and the measured band intensity indicated an editing efficiency of 10%.

[0229] Simultaneously, the amplified 491bp CsPUB21pro-Id gene fragment was ligated into a TA clone and single-colony sequencing was performed.

[0230] The results are as follows Figure 4 As shown in B, the results show that the CRISPR-Cas9 editing system can effectively cleave the sgRNA-PAM recognition site 8 nt downstream of the Heliton region of the CsPUB21 promoter in citrus protoplasts, successfully deleting an 84 bp fragment located at positions 1113-1196 of sequence 1, with an editing efficiency of 10%.

[0231] The expression level of the CsPUB21 gene in citrus protoplasts edited with Cas9-CsPUB21pro was detected by real-time PCR, following the steps in step three of Example 2.

[0232] The results are as follows Figure 4 As shown in Figure C, the results indicate that compared with the control group transformed with the empty vector, Cas9-CsPUB21pro editing significantly reduced the expression level of the CsPUB21 gene. This demonstrates that successful knockout of the Heliton region of the CsPUB21 promoter by CRISPR-Cas9 editing can significantly reduce the expression level of the disease-susceptibility gene CsPUB21.

[0233] 4. Using the protoplast DNA extracted in step 3 as a template, the concentration of pathogenic bacteria CLas in citrus protoplasts edited with Cas9-CsPUB21pro was detected by real-time quantitative PCR, with COX as an internal reference gene. The quantitative primer sequences are as follows:

[0234] HLBas primers for specific detection of Huanglongbing pathogen CLAs: GTCGAGCGCGTATGCAATACG;

[0235] HLBr primers for specific detection of CLas, the pathogen of Huanglongbing (HLB): GCGTTATCCCGTAGAAAAAGGTAG;

[0236] Citrus internal reference gene detection primers COXf: GGTATGCCACGTCGCATTCCAGA;

[0237] Citrus internal reference gene detection primer COXr: GCCAAAACTGCTAAGGGCATTC.

[0238] The results are as follows Figure 4 As shown in Figure D, the results indicate that Cas9-CsPUB21pro editing significantly reduced the concentration of CLAs in susceptible protoplasts, showing a significant difference in CLAs concentration compared to the control group transformed with empty vector. This suggests that CRISPR-Cas9 editing and knocking out the Heliton region of the CsPUB21 promoter can enhance the resistance of citrus to Huanglongbing fungus and demonstrate an effective anti-CLAs effect.

Claims

1. A DNA molecule, said DNA molecule being the DNA molecule shown in sequence 2.

2. The use of the substance that knocks out the full length or a portion of the DNA molecule as described in claim 1 in any of the following A1)-A6): A1) Improve plant resistance to Huanglongbing (HLB); A2) Prepare products that enhance plant resistance to Huanglongbing (HLB); A3) Cultivate plants resistant to Huanglongbing (HLB); A4) Prepare products that cultivate plants resistant to Huanglongbing (HLB); A5) Control of plant Huanglongbing (HLB); A6) Prepare products for the prevention and control of plant Huanglongbing (HLB); The fragment contains a characteristic motif that binds to the transcription factor MYC2, and the sequence of the characteristic motif is CANNTG, where N represents A, T, C, or G. The plant is a sweet orange ( Citrus sinensis ),tangerine( Citrus reticulata ) and / or Daoxian wild orange ( Citrus daoxianensis ).

3. The application according to claim 2, characterized in that: The substance that knocks out the full-length or partial fragment of the DNA molecule of claim 1 is a CRISPR / Cas9 gene editing vector that knocks out the full-length or partial fragment of the DNA molecule of claim 1; the CRISPR / Cas9 gene editing vector expresses sgRNA and Cas9 protein targeting the full-length or partial fragment of the DNA molecule of claim 1.

4. The application according to claim 3, characterized in that: The target sequence of the sgRNA is shown in positions 1105-1124 of sequence 1.

5. A method for improving plant resistance to Huanglongbing or cultivating Huanglongbing-resistant plants, the method comprising the step of knocking out a full-length or partial fragment of the DNA molecule of claim 1 in a recipient plant; wherein the PUB21 gene promoter in the recipient plant contains the DNA molecule of claim 1; The fragment contains a characteristic motif that binds to the transcription factor MYC2, and the sequence of the characteristic motif is CANNTG, where N represents A, T, C, or G; The plant is a sweet orange ( Citrus sinensis ),tangerine( Citrus reticulata ) and / or Daoxian wild orange ( Citrus daoxianensis ).

6. The method according to claim 5, characterized in that: The method for knocking out the full length or a portion of the DNA molecule of claim 1 in the recipient plant is to introduce a substance that knocks out the full length or a portion of the DNA molecule of claim 1 into the recipient plant.

7. The method according to claim 5 or 6, characterized in that: The substance that knocks out the full-length or partial fragment of the DNA molecule of claim 1 is a CRISPR / Cas9 gene editing vector that knocks out the full-length or partial fragment of the DNA molecule of claim 1; the CRISPR / Cas9 gene editing vector expresses sgRNA and Cas9 protein targeting the full-length or partial fragment of the DNA molecule of claim 1.

8. The method according to claim 7, characterized in that: The target sequence of the sgRNA is shown in positions 1105-1124 of sequence 1.

9. A method for improving plant resistance to Huanglongbing (HLB) or cultivating HLB-resistant plants, the method comprising the step of deleting positions 1113-1196 of the PUB21 gene promoter in the genomic DNA of the recipient plant; the nucleotide sequence of the PUB21 gene promoter is shown in Sequence 1; the plant is sweet orange (… Citrus sinensis ),tangerine( Citrus reticulata ) and / or Daoxian wild orange ( Citrus daoxianensis ).

Citation Information

Patent Citations

  • Citrus huanglongbing resistance related protein as well as coding gene and application thereof

    CN115160421A