Gene Jiangxi No. 1 CcMYB17 as well as expression protein and application thereof

Abstract

The invention discloses a Jiangxi No. 1 CcMYB17 gene as well as an expression protein and application thereof, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the Jiangxi No. 1 CcMYB17 gene disclosed by the invention is as shown in SEQ ID NO.1, and the amino acid sequence of the expression protein of the Jiangxi No. 1 CcMYB17 gene is as shown in SEQ ID NO.2. The method comprises the following steps: constructing a plant expression vector of the Jiangxi No. 1 CcMYB17 gene; transforming the constructed plant expression vector into a '84K poplar' leaf; and cultivating and screening to obtain a '84K poplar' plant which overexpresses the Jiangxi No. 1 CcMYB17 gene. The poplar leaves of the overexpression Jiangxi No. 1 CcMYB17 gene constructed by the invention are deep in color and show obvious red spots; the total anthocyanin content is obviously increased and is obviously higher than that of a wild type. The invention provides a research basis and a theoretical basis for germplasm improvement of the camphor tree.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and more specifically, relates to the Gan Tong No. 1 CcMYB17 gene and its expression protein and application. Background Art

[0002] Camphor tree (Cinnamomum camphora) is a plant of the genus Cinnamomum in the Lauraceae family. It is evergreen, tall and straight, with a beautiful tree shape and rich leaf colors. It is a popular garden and landscape tree species. The new red-stem camphor variety Gantong No. 1 has bright red branches in spring, winter and early summer, and its newly grown leaves are orange, which has high ornamental value and prospects for application in gardening and greening.

[0003] MYB transcription factors are widely present in plants and are key factors in regulating anthocyanin biosynthesis and accumulation. They further activate or inhibit gene expression by binding to cis-acting elements on the promoter sequences of structural genes in the anthocyanin biosynthesis pathway, thereby achieving regulation of anthocyanin biosynthesis. Zhong et al. used metabolome and transcriptome data to analyze the color formation mechanism of Gan Tong No. 1 bark and found that pelargonidin, cyanidin and peony are the main pigments that make Gan Tong No. 1 red; in addition, 24 up-regulated differentially expressed genes were identified to be involved in anthocyanin biosynthesis, of which 6 transcription factors (3 MYBs and 3 bHLHs) may be candidate regulators of the anthocyanin biosynthesis pathway of Gan Tong No. 1. Summary of the invention

[0004] In view of the above-mentioned problems existing in the prior art, the technical problem to be solved by the present invention is to provide the Gan Tong No. 1 CcMYB17 gene; another technical problem to be solved by the present invention is to provide the expression protein of the Gan Tong No. 1 CcMYB17 gene; and another technical problem to be solved by the present invention is to provide the application of the Gan Tong No. 1 CcMYB17 gene for camphor germplasm improvement.

[0005] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0006] The nucleotide sequence of the CcMYB17 gene of Gan Tong No. 1 is shown in SEQ ID NO.1.

[0007] The amino acid sequence of the CcMYB17 gene of Gan Tong No. 1 and its expressed protein is shown in SEQ ID NO.2.

[0008] Vectors and recombinant bacteria containing the CcMYB17 gene of Gan Tong No. 1.

[0009] Application of the CcMYB17 gene of Gan Tong No. 1 in regulating leaf color, wherein the regulating leaf color is to promote the leaf color to turn red, comprising the following steps:

[0010] 1) Construction of plant expression vector of CcMYB17 gene of Gan Tong No. 1;

[0011] 2) Transform the constructed plant expression vector into leaves of '84K poplar';

[0012] 3) Cultivate and select '84K poplar' plants with red leaves.

[0013] The plant expression vector is pBI121-CcMYB17-eGFP.

[0014] The application of the CcMYB17 gene of Gan Tong No. 1 in regulating the anthocyanin content in plants, wherein the regulating the anthocyanin content in plants is to promote the increase of the anthocyanin content in plants, comprising the following steps:

[0015] 1) Construction of plant expression vector of CcMYB17 gene of Gan Tong No. 1;

[0016] 2) Transform the constructed plant expression vector into leaves of '84K poplar';

[0017] 3) Cultivate and screen '84K poplar' plants with significantly increased anthocyanin content.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1) The present invention is the first to discover and successfully isolate the Gan Tong No. 1 CcMYB17 gene in Gan Tong No. 1, the nucleotide sequence of which is shown in SEQ ID NO. 1, and the amino acid sequence of its expressed protein is shown in SEQ ID NO. 2. The present invention constructs a plant expression vector of the Gan Tong No. 1 CcMYB17 gene; transforms the constructed plant expression vector into '84K poplar' leaves; and cultivates and screens to obtain '84K poplar' plants that overexpress the Gan Tong No. 1 CcMYB17 gene.

[0020] 2) The leaves of the poplar tree overexpressing the Gan Tong No. 1 CcMYB17 gene constructed in the present invention are dark in color and show obvious red spots.

[0021] 3) The total anthocyanin content of the poplar trees overexpressing the Gan Tong No. 1 CcMYB17 gene constructed by the present invention was significantly increased and significantly higher than that of the wild type. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is the PCR agarose gel electrophoresis diagram of CcMYB17 gene;

[0023] Figure 2 This is the evolutionary tree diagram of CcMYB17 protein and the entire Arabidopsis MYB family;

[0024] Figure 3The amino acid alignment of CcMYB17 protein with Arabidopsis AtMYB75, AtMYB90, AtMYB113, AtMYB114 and poplar PtrMYB113, PdMYB113;

[0025] Figure 4 Schematic diagram of the subcellular localization of CcMYB17 protein;

[0026] Figure 5 This is a picture showing the DNA level detection of poplar trees overexpressing the CcMYB17 gene;

[0027] Figure 6 This is the detection diagram of RNA level in poplar trees overexpressing CcMYB17 gene;

[0028] Figure 7 This is the phenotype of poplar trees overexpressing the CcMYB17 gene;

[0029] Figure 8 This is a graph showing the detection of total anthocyanin content in poplar trees overexpressing the CcMYB17 gene. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. In the following embodiments, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art.

[0031] The experimental materials of the present application, Gan Tong No. 1 and the control plants from the same half-sibling family, were sourced from the Institute of Biological Resources of Jiangxi Academy of Sciences and were used in this study through softwood cuttings.

[0032] The roots, flowers, phloem, leaves, xylem and stem tips of Gantong No. 1 were collected in April 2020, and the fruits were collected in November 2020, for a total of 7 tissues.

[0033] Example 1

[0034] 1. Total RNA extraction and reverse transcription

[0035] The total RNA of Gan Tong No. 1 was extracted using RNAprepPure Polysaccharide and Polyphenol Total RNA Extraction Kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). The total RNA of the plant was reverse transcribed into cDNA using FastKing cDNA First Strand Synthesis Kit (Genomic Detoxification) (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). The genome detoxification reaction system was: 5×gDNABuffer 2μL, Total RNA (500 ng / μL) 2μL, RNase-Free ddH2O 6μL, incubated at 42℃ for 3 min and placed on ice; the reverse transcription reaction system was 10×King RT Buffer 2μL, FastKing RT Enzyme Mix 1μL, FQ-RT Primer Mix 2μL, RNase-Free ddH2O 5 μL; the reverse transcription system was added to the genome detoxification system and mixed thoroughly, incubated at 42℃ for 15 min, and incubated at 95℃ for 3 min to obtain cDNA solution.

[0036] 2. Primer design

[0037] Based on the camphor tree genome database (TF Shen, HR Qi, XY Luan, et al. The chromosome-level genome sequence of the camphor tree provides insights into Lauraceae evolution and terpene biosynthesis [J]. Plant Biotechnol. J., 2022, 20, 2, 244-246.), the CcMYB17 gene sequence was obtained, and the cloning primers of the CcMYB17 gene CDS were designed using Primer 3 Plus software (https: / / www.primer3plus.com / ). The primer sequences are shown below:

[0038] CcMYB17-F: 5'-ATGGAGCATCTTGGTGTGAGA-3',

[0039] CcMYB17-R: 5'-TTATGTCTCGAACAGACCCCA-3'.

[0040] 3. CcMYB17 gene cloning

[0041] Using cDNA as a template, TransTaq DNA Polymerase High Fidelity (HiFi) DNA polymerase (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) was used to amplify the CcMYB17 gene.

[0042] The PCR reaction system was: cDNA 2μL, forward primer (10μM) 1μL, reverse primer (10μM) 1μL, 10×TransTaq HiFi Buffer I / II 5μL, 2.5mM dNTPs 4μL, TransTaq HiFi DNA Polymerase 1μL, and Nuclease-free Water 36μL.

[0043] The PCR amplification program was: 94°C for 3 min; 94°C for 30 sec, 55°C for 30 sec, 72°C for 1 min, 34 cycles; 72°C for 5 min.

[0044] After amplification, 1% agarose gel was used for detection. The results were as follows Figure 1 As shown, the band is clear and single, with a position size of about 762 bp. After the single band is cut out, it is recovered using an agarose DNA recovery kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) to obtain a purified DNA solution.

[0045] 4. Connection conversion

[0046] The purified DNA solution was connected to the pMD19-T vector (purchased from Takara Biotechnology (Dalian) Co., Ltd.) with the following connection system: pMD19-T Vector 1μL, recovered product (100ng / μL) 1μL, Nuclease-free Water 3μL. Add 5 μL of Solution I and react at 16℃ for 30min.

[0047] All ligation products were added to 100 μL of TOP10 competent cells, placed on ice for 30 min, heat-shocked at 42°C for 45 sec, placed on ice for 2 min, added to 700 μL of LB medium without antibiotics, cultured at 37°C with shaking for 60 min, spread on LB solid plates containing ampicillin resistance, and cultured inverted at 37°C for 12 h. A single colony was picked as a template, M13-F and M13-R were used as primers, and colony PCR was performed using 2×Taq PCR MasterMix (purchased from Nanjing Novozyme Biotechnology Co., Ltd.). The primer sequences are as follows:

[0048] M13-F: 5'-TGTAAAACGAGCGGCCAGT-3',

[0049] M13-R: 5'-CAGGAAACAGCTATGACC-3'.

[0050] The PCR reaction system was: 1 μL bacterial solution, 0.8 μL forward primer (10 μM), 0.8 μL reverse primer (10 μM), 10 μL 2×MasterMix, and 7.4 μL Nuclease-free Water.

[0051] The PCR amplification program was: 94°C for 5 min; 94°C for 30 sec, 53°C for 30 sec, 72°C for 1 min, 34 cycles; 72°C for 5 min.

[0052] 1% agarose gel was used for detection, and single colonies with the correct band size were selected and added to LB liquid medium containing ampicillin resistance, and cultured at 37°C for 12 hours. The bacterial solution was sent to the company for sequencing. According to the sequencing results, the nucleotide sequence of the CcMYB17 gene was determined to be SEQ ID NO.1, with a length of 762 bp; the amino acid sequence of its expressed protein was shown in SEQ ID NO.2, with a length of 253 bp.

[0053] Example 2

[0054] 1. Evolutionary tree analysis

[0055] All protein sequences of the Arabidopsis MYB family were downloaded from the Arabidopsis TAIR website (https: / / www.arabidopsis.org / ), and phylogenetic tree analysis was performed using Mega7 software (bootstraps was 1000). The results showed that CcMYB17 was most closely related to Arabidopsis AtMYB75, AtMYB90, AtMYB113, and AtMYB114 ( Figure 2 ), the amino acid sequence of CcMYB17 was compared with that of Arabidopsis thaliana AtMYB75, AtMYB90, AtMYB113, AtMYB114, Populus trichocarpa PtrMYB113 and Populus deltoides PdMYB113. The results showed that the N-terminal had R2 and R3 domains, which were highly conserved ( Figure 3 ), indicating that the function of CcMYB17 may be related to anthocyanin synthesis.

[0056] 2. Vector Construction

[0057] The CcMYB17 target gene constructed into the simple T vector was seamlessly recombined into the plant binary expression vector pBI121-eGFP, and a full-length primer containing the Xba I and Sma I restriction site linker was designed to remove the stop codon. The upstream primer: 5'- TCTAGA ATGGAGCATCTTGGTGTGAGA -3′ (the underlined part is the Xba I restriction site); downstream primer: 5′- CCCGGGGTGTCTCGAACAGACCCCA-3′ (the underlined part is the Sma I restriction site). Using the CcMYB17-T vector plasmid as a template, 2×TransStart FastPfu Fly PCR SuperMix (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) was used to amplify the CcMYB17 gene plus homology arms, and the pBI121-eGFP expression vector was double-digested with Xba I and Sma I endonucleases (purchased from Bao Biotechnology (Dalian) Co., Ltd.), and the linearized vector and the target fragment with sticky ends were obtained after recovery. The target fragment with sticky ends and the linearized vector were ligated by homologous recombination enzyme (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the ligation product was transformed into Escherichia coli competent cells Top10. The vector primers were used for PCR colony detection and sequencing to obtain the recombinant expression vector pBI121-CcMYB17-eGFP. The detection primer sequences are as follows:

[0058] 35S-F: 5'-GACGCACAATCCCACTATCC-3',

[0059] eGFP-R: 5'-GGACACGCTGAACTTGTGG-3'.

[0060] 3. Agrobacterium transformation

[0061] After the pBI121-CcMYB17-eGFP recombinant vector plasmid obtained above was extracted, the liquid nitrogen freeze-thaw method was used to transform Agrobacterium GV3101 competent cells, and the steps were as follows:

[0062] After the competent cells GV3101 were thawed in an ice bath, 1 µg of recombinant plasmid DNA was added, flicked to mix, and placed on ice for 5 min; after quick freezing in liquid nitrogen for 5 min, the cells were quickly transferred to a 37°C water bath for 5 min, iced for 5 min, and 800 µL of YEB liquid culture medium was added under sterile conditions. The cells were cultured on a shaker at 28°C for 3 h to promote bacterial recovery; the cells were collected by centrifugation at 5000 rpm for 1 min, 100 µL of the supernatant was retained for resuspending, and the cells were spread on YEB solid culture medium containing 50 mg / L Kan and 40 mg / L rip, and cultured in a constant temperature incubator at 28°C for 24-48 h; a single colony was picked for PCR detection, and the correct single colony was shaken and stored at -80°C with glycerol.

[0063] 3. Subcellular localization

[0064] The pBI121-eGFP and pBI121-CcMYB17-GFP Agrobacterium were mixed with NLS-mCherry using the tobacco transient transformation system and then vacuum infiltrated into Nicotiana benthamiana leaves. The cells were cultured in the dark at 22°C for 24 h and then in the light for 48 h. The localization of the fusion protein in tobacco epidermal cells was observed using a fluorescence microscope, and the nuclear localization marker NLS-mCherry was used to label the cell nucleus.

[0065] The results are as follows Figure 4 As shown, pBI121-eGFP is expressed in organelles throughout the cell, and pBI121-CcMYB17-GFP is only localized in the nucleus and completely fused with the nuclear localization marker.

[0066] 4. Genetic transformation and screening of 84K poplar

[0067] The pBI121-CcMYB17-GFP vector successfully transformed into Agrobacterium GV3101 competent cells was inoculated into 50 mL YEB liquid medium containing 50 mg / L Kan and 40 mg / L rip for expansion and culture at 28°C until OD 600 =0.6-0.8, centrifuge at 4000 rpm for 5 min to collect the cells, and resuspend the cells in MS resuspension solution to OD 600 =0.6. Place the 84K poplar leaf cubes pre-cultured for 2 days in the bacterial solution for 10-15 min, dry the bacterial solution and spread them on the differentiation medium, and culture them in the dark for 2 days. Transfer the leaves to the differentiation medium containing 30 mg / L Kan and 300 mg / L Cef for screening and culture. After the leaves differentiate into adventitious buds, separate the adventitious buds from the leaves and inoculate them into the rooting medium containing 30 mg / L Kan and 300 mg / L Cef for growth.

[0068] 5. Identification of transgenic positive plants

[0069] Using Tiangen's polysaccharide and polyphenol plant genomic DNA extraction kit, DNA was extracted from leaves of wild-type and poplar tissue culture seedlings that successfully rooted under screening pressure, according to the instructions.

[0070] The genomic DNA extracted from wild type and rooted poplars was tested by PCR according to the vector primer 35S-F+eGFP-R sequence. The results are as follows Figure 5 As shown, there are 5 lines with positive bands, and the transgenic poplar lines containing the target bands were preserved. Wild-type and transgenic poplar leaves grown for one month were taken for RNA level identification, and PtrActin7 was used as the internal reference gene to detect the changes in the expression level of the CcMYB17 gene in the plants. The sequences of the fluorescence quantitative primers are as follows:

[0071] PtrActin7-F: 5'-AAACTGTAATGGTCCTCCCTCCG-3',

[0072] PtrActin7-R: 5'-GCATCATCACAATCACTCTCCGA-3';

[0073] CcMYB17-F: 5'-TCTCTCATTGCAGGTAGGCTTC-3',

[0074] CcMYB17-R: 5'-TTGTGCCCCTTTTTGCATGG-3'.

[0075] The results are as follows Figure 6 As shown, there was no CcMYB17 transcript in WT, and the expression level of CcMYB17 was the highest in overexpressing strains 7, 9, and 10.

[0076] 6. Phenotype of overexpression strains

[0077] Wild-type and transgenic poplar stem segments from the same part were inoculated into rooting medium at the same time and cultured under the same environment for 30 days; then the tissue culture seedlings were transplanted into soil and cultured under the same environment for 2 months. Leaves were taken for phenotypic observation, and anthocyanin content was determined using a total anthocyanin (total anthocyanin) content kit (purchased from Suzhou Gres Biotechnology Co., Ltd.).

[0078] The results are as follows Figure 7 As shown, the leaves of poplars overexpressing the CcMYB17 gene were dark in color and showed obvious red spots, while the wild type was light green without any red accumulation.

[0079] The results are as follows Figure 8 As shown, the total anthocyanin content of strains 7, 9 and 10 overexpressing the CcMYB17 gene was significantly higher than that of the wild type. The results showed that the CcMYB17 gene promoted the synthesis of anthocyanins.

[0080] The above description is only illustrative rather than restrictive of the present invention. Those skilled in the art will understand that many modifications, changes or equivalents may be made without departing from the spirit and scope defined by the appended claims, but all will fall within the scope of protection of the present invention.

Claims

1. The CcMYB17 gene of Gan Tong No. 1, whose nucleotide sequence is shown in SEQ ID NO.

1.

2. The CcMYB17 gene of Gan Tong No. 1 according to claim 1, the amino acid sequence of its expressed protein is shown in SEQ ID NO.

2.

3. A vector and recombinant bacteria containing the Gan Tong No. 1 CcMYB17 gene according to claim 1.

4. Use of the Gan Tong No. 1 CcMYB17 gene according to claim 1 in regulating leaf color.

5. The use according to claim 4, characterized in that: The regulating leaf color is to promote the leaf color to turn red.

6. The use according to claim 5, characterized in that: The following steps are involved: 1) Construction of plant expression vector of CcMYB17 gene of Gan Tong No. 1; 2) Transform the constructed plant expression vector into leaves of '84K poplar'; 3) Cultivate and select '84K poplar' plants with red leaves.

7. The use according to claim 6, characterized in that: The plant expression vector is pBI121-CcMYB17-eGFP.

8. Use of the Gan Tong No. 1 CcMYB17 gene according to claim 1 in regulating the anthocyanin content in plants.

9. The use according to claim 8, characterized in that: The regulating the anthocyanin content in the plant is to promote the increase of the anthocyanin content in the plant.

10. The use according to claim 9, characterized in that: The following steps are involved: 1) Construction of plant expression vector of CcMYB17 gene of Gan Tong No. 1; 2) Transform the constructed plant expression vector into leaves of '84K poplar'; 3) Cultivate and screen '84K poplar' plants with significantly increased anthocyanin content.

Images