Gantong 1 no. ccmyb17 gene and expression protein and application thereof

Abstract

The application discloses Gantong No.1 CcMYB17 gene, an expression protein thereof and application, and belongs to the technical field of plant genetic engineering.The nucleotide sequence of the Gantong No.1 CcMYB17 gene is shown in SEQ ID NO.1, and the amino acid sequence of the expression protein thereof is shown in SEQ ID NO.2.A plant expression vector of the Gantong No.1 CcMYB17 gene is constructed, the constructed plant expression vector is transformed into the leaves of '84K poplar', and '84K poplar' plants overexpressing the Gantong No.1 CcMYB17 gene are obtained through cultivation and screening.The poplar leaves overexpressing the Gantong No.1 CcMYB17 gene constructed in the application have deep leaf color and present obvious red spots;the total anthocyanin content is significantly increased and is significantly higher than that of the wild type.The application provides a research foundation and theoretical basis for camphor tree germplasm improvement.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and more particularly relates to a Gantong No. 1 CcMYB17 gene, an expression protein thereof and application thereof. BACKGROUND

[0002] Cinnamomum camphora is a plant of the genus Cinnamomum in the family Lauraceae, and is evergreen, tall and straight, has a beautiful posture and rich leaf color, and is a tree species for landscaping and landscape that is deeply loved by people. The new variety Gantong No. 1 of Cinnamomum camphora keeps fresh red color in spring, winter and early summer, and the newly born leaves are orange, and has high ornamental value and landscaping application prospect.

[0003] MYB transcription factors widely exist in plants, are key factors for regulating anthocyanin biosynthesis and accumulation, and they combine with cis-acting elements on the promoter sequence of structural genes in the anthocyanin synthesis pathway, further activate or inhibit the expression of genes, so as to realize the regulation of anthocyanin biosynthesis. Zhong et al. analyzed the color forming mechanism of the bark of Gantong No. 1 by using metabolome and transcriptome data, found that pelargonidin, cyanidin and peonidin are the main pigments that make Gantong No. 1 red; in addition, 24 up-regulated differential genes involved in anthocyanin biosynthesis were identified, and 6 transcription factors (3 MYBs and 3 bHLHs) may be candidate regulatory factors of the anthocyanin synthesis pathway of Gantong No. 1. SUMMARY

[0004] In view of the above problems existing in the prior art, the technical problems to be solved by the present application are to provide a Gantong No. 1 CcMYB17 gene, to provide an expression protein of the Gantong No. 1 CcMYB17 gene, and to provide an application of the Gantong No. 1 CcMYB17 gene for improving the Cinnamomum camphora germplasm.

[0005] In order to solve the above technical problems, the technical scheme adopted by the present application is as follows:

[0006] The Gantong No. 1 CcMYB17 gene has a nucleotide sequence as shown in SEQ ID NO. 1.

[0007] The Gantong No. 1 CcMYB17 gene has an amino acid sequence of the expression protein as shown in SEQ ID NO. 2.

[0008] The vector and the recombinant bacteria containing the Gantong No. 1 CcMYB17 gene.

[0009] The application of the Gantong No. 1 CcMYB17 gene in regulating leaf color, which is to promote the leaf color to turn red, comprises the following steps:

[0010] 1) Constructing a plant expression vector of Gantong No. 1 CcMYB17 gene;

[0011] 2) Transforming the constructed plant expression vector into the leaves of '84K poplar';

[0012] 3) Cultivating the '84K poplar' plants with red leaf color screened.

[0013] The plant expression vector is pBI121-CcMYB17-eGFP.

[0014] The application of Gantong No. 1 CcMYB17 gene in regulating the anthocyanin content in plants, the regulation of the anthocyanin content in plants is to promote the increase of the anthocyanin content in plants, comprising the following steps:

[0015] 1) Constructing a plant expression vector of Gantong No. 1 CcMYB17 gene;

[0016] 2) Transforming the constructed plant expression vector into the leaves of '84K poplar';

[0017] 3) Cultivating the '84K poplar' plants with significantly increased anthocyanin content screened.

[0018] Compared with the prior art, the beneficial effects of the present application are:

[0019] 1) The present application is the first time to find and successfully isolate Gantong No. 1 CcMYB17 gene in Gantong No. 1, the nucleotide sequence of which is shown as SEQ ID NO. 1, and the amino acid sequence of the expressed protein is shown as SEQ ID NO. 2. The present application constructs a plant expression vector of Gantong No. 1 CcMYB17 gene; transforms the constructed plant expression vector into the leaves of '84K poplar'; and cultivates the '84K poplar' plants overexpressing Gantong No. 1 CcMYB17 gene screened.

[0020] 2) The poplar leaves overexpressing Gantong No. 1 CcMYB17 gene constructed by the present application have deep leaf color and present obvious red spots.

[0021] 3) The total anthocyanin content of the poplar overexpressing Gantong No. 1 CcMYB17 gene constructed by the present application is significantly increased and is significantly higher than that of the wild type. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 It is a CcMYB17 gene PCR agarose gel electrophoresis map;

[0023] Figure 2 It is a CcMYB17 protein and Arabidopsis MYB full family phylogenetic tree map;

[0024] Figure 3Figure 4 is an amino acid alignment diagram of CcMYB17 protein and Arabidopsis AtMYB75, AtMYB90, AtMYB113, AtMYB114 and Populus PtrMYB113, PdMYB113;

[0025] Figure 4 Figure 5 is a schematic diagram of subcellular localization of CcMYB17 protein;

[0026] Figure 5 Figure 6 is a DNA level detection diagram of Populus overexpressing CcMYB17 gene;

[0027] Figure 6 Figure 7 is a RNA level detection diagram of Populus overexpressing CcMYB17 gene;

[0028] Figure 7 Figure 8 is a phenotype diagram of Populus overexpressing CcMYB17 gene;

[0029] Figure 8 Figure 9 is a total anthocyanin content detection diagram of Populus overexpressing CcMYB17 gene. DETAILED DESCRIPTION

[0030] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described below in combination with specific examples. In the following examples, the technical means used are all conventional means well known to those skilled in the art, unless otherwise specified.

[0031] The experimental material of the present application, Gantong No. 1, is from the same half-sib family as the control plant, and is from Jiangxi Academy of Biological Resources Institute. It is used for the present research by means of tender branch cutting.

[0032] The roots, flowers, phloem, leaves, xylem and stem tips of Gantong No. 1 were collected in April 2020, and the fruits were collected in November 2020, for a total of 7 tissues.

[0033] Example 1

[0034] 1. Total RNA extraction and reverse transcription

[0035] The total RNA of Gantong No. 1 was extracted by RNAprepPure polysaccharide polyphenol total RNA extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). The plant total RNA was reverse transcribed into cDNA by FastKing cDNA first strand synthesis kit (degenomic) (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). The degenomic reaction system was: 5x gDNA Buffer 2 μL, Total RNA (500 ng / μL) 2 μL, RNase-Free ddH2O 6 μL, incubated at 42°C for 3 min, and placed on ice; the reverse transcription reaction system was: 10x King RT Buffer 2 μL, FastKing RT Enzyme Mix 1 μL, FQ-RT Primer Mix 2 μL, RNase-Free ddH2O 5 μL; the reverse transcription system was added to the degenomic system and mixed well, incubated at 42°C for 15 min, incubated at 95°C for 3 min, and the cDNA solution was obtained.

[0036] 2. Primer design

[0037] Based on the camphor tree genome database (T. F. Shen, H. R. Qi, X. Y. Luan, et al. The chromosome-level genome sequence of the camphor tree provides insights into Lauraceae evolution and terpene biosynthesis [J]. Plant Biotechnol. J., 2022, 20, 2, 244-246.), the CcMYB17 gene sequence was obtained, and the CcMYB17 gene CDS cloning primer was designed by using Primer 3 Plus software (https: / / www.primer3plus.com / ). The primer sequence is as follows:

[0038] CcMYB17-F: 5'-ATGGAGCATCTTGGTGTGAGA-3',

[0039] CcMYB17-R: 5'-TTATGTCTCGAACAGACCCCA-3'.

[0040] 3. Cloning of CcMYB17 gene

[0041] CcMYB17 gene was amplified using TransTaq DNA Polymerase High Fidelity (HiFi) DNA polymerase (purchased from Beijing Quanshi Gold Biotechnology Co., Ltd.) with cDNA as template.

[0042] PCR reaction system: cDNA 2 μL, forward primer (10 μM) 1 μL, reverse primer (10 μM) 1 μL, 10×TransTaq HiFi Buffer I / II 5 μL, 2.5 mM dNTPs 4 μL, TransTaq HiFi DNA Polymerase 1 μL, Nuclease-free Water 36 μL.

[0043] PCR amplification procedure: 94°C 3 min; 94°C 30 sec, 55°C 30 sec, 72°C 1 min, 34 cycles; 72°C 5 min.

[0044] After amplification, 1% agarose gel was used for detection, and the results are shown in Figure 1 The single band was cut off, and an agarose DNA recovery kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used for recovery to obtain a purified DNA solution.

[0045] 4. Ligation transformation

[0046] The purified DNA solution was ligated with pMD19-T vector (purchased from Baosheng Bioengineering (Dalian) Co., Ltd.), and the ligation system was as follows: pMD19-T Vector 1 μL, recovered product (100 ng / μL) 1 μL, Nuclease-free Water 3 μL. 5 μL of Solution I was added, and the reaction was carried out at 16°C for 30 min.

[0047] All ligation products were added to 100 μL of TOP10 competent cells, placed on ice for 30 min, heated at 42°C for 45 sec, placed on ice for 2 min, added to 700 μL of antibiotic-free LB medium, and incubated at 37°C for 60 min. The culture was spread on LB solid plates containing ampicillin, and incubated at 37°C for 12 h. Single colonies were picked as templates, M13-F and M13-R were primers, and 2×Taq PCR MasterMix (purchased from Nanjing Novozyme Bio-tech Co., Ltd.) was used for colony PCR. The primer sequences are as follows:

[0048] M13-F: 5'-TGTAAAACGACGGCCAGT-3',

[0049] M13-R: 5'-CAGGAAACAGCTATGACC-3'.

[0050] The PCR reaction system consisted of: 1 μL of bacterial culture, 0.8 μL of forward primer (10 μM), 0.8 μL of reverse primer (10 μM), 10 μL of 2×MasterMix, and 7.4 μL of Nuclease-free Water.

[0051] The PCR amplification program was as follows: 94℃ for 5 min; 94℃ for 30 sec, 53℃ for 30 sec, 72℃ for 1 min, 34 cycles; 72℃ for 5 min.

[0052] Detection was performed using 1% agarose gel electrophoresis. Single colonies with the correct band size were selected and added to LB broth containing ampicillin, and cultured at 37°C with shaking for 12 h. The bacterial culture was then sent to the company for sequencing. Based on the sequencing results, the nucleotide sequence of the CcMYB17 gene was determined as shown in SEQ ID NO.1, with a length of 762 bp; the amino acid sequence of its expressed protein was shown as shown in SEQ ID NO.2, with a length of 253 bp.

[0053] Example 2

[0054] 1. Evolutionary Tree Analysis

[0055] All protein sequences of the Arabidopsis MYB family were downloaded from the Arabidopsis TAIR website (https: / / www.arabidopsis.org / ), and phylogenetic analysis was performed using Mega7 software (bootstraps set to 1000). The results showed that CcMYB17 is most closely related to Arabidopsis AtMYB75, AtMYB90, AtMYB113, and AtMYB114. Figure 2 The amino acid sequences of CcMYB17 were compared with those of Arabidopsis thaliana AtMYB75, AtMYB90, AtMYB113, AtMYB114, Populus tomentosa PtrMYB113, and Populus alba PdMYB113. The results showed that the N-terminus contains R2 and R3 domains, indicating high conservation. Figure 3 This suggests that the function of CcMYB17 may be related to anthocyanin synthesis.

[0056] 2. Carrier Construction

[0057] The CcMYB17 target gene, constructed into a simplified T-vector, was seamlessly recombined into the plant binary expression vector pBI121-eGFP. A full-length primer with stop codon removal and linkers containing Xba I and Sma I restriction sites was designed. The upstream primer was 5'- TCTAGA ATGGAGCATCTTGGTGTGAGA -3′ (underlined part is the Xba I restriction site); downstream primer: 5'- CCCGGGGTGTCTCGAACAGACCCCA-3' (underlined part is Sma I enzyme cutting site). CcMYB17 gene with homologous arms was amplified using 2x TransStart FastPfu Fly PCR SuperMix (purchased from Beijing Zisyang Biotechnology Co., Ltd.) with CcMYB17-T vector plasmid as template, and the pBI121-eGFP expression vector was double digested with Xba I and Sma I endonuclease (purchased from Baosheng Engineering (Dalian) Co., Ltd.), and the linearized vector and the target fragment containing sticky ends were obtained after recovery. The target fragment containing sticky ends and the linearized vector were ligated by homologous recombination enzyme (purchased from Tiangeng Biochemical Technology (Beijing) Co., Ltd.), and the ligation product was transformed into E. coli competent cells Top10, and PCR colony detection and sequencing were performed using vector primers to obtain the recombinant expression vector pBI121-CcMYB17-eGFP. The detection primer sequences are as follows:

[0058] 35S-F: 5'-GACGCACAATCCCACTATCC-3',

[0059] eGFP-R: 5'-GGACACGCTGAACTTGTGG-3'.

[0060] 3. Agrobacterium transformation

[0061] After the pBI121-CcMYB17-eGFP recombinant vector plasmid was obtained, the Agrobacterium GV3101 competent cells were transformed by liquid nitrogen freeze-thaw method, and the steps were as follows:

[0062] After the competent cells GV3101 were thawed in ice bath, 1 μg of recombinant plasmid DNA was added, mixed gently, and incubated on ice for 5 min; after quick freezing in liquid nitrogen for 5 min, it was quickly transferred to 37°C water bath for 5 min, and then ice bath for 5 min. Under sterile conditions, 800 μL of YEB liquid medium was added, and the bacteria were cultured at 28°C for 3 h to promote recovery. The bacteria were collected by centrifugation at 5000 rpm for 1 min, and 100 μL of supernatant was resuspended and plated on YEB solid medium containing 50 mg / L Kan and 40 mg / L rip, and incubated at 28°C for 24-48 h. Single colonies were picked for PCR detection, and the correct single colonies were shaken and stored at -80°C with glycerol.

[0063] 3. Subcellular localization

[0064] The tobacco transient transformation system was used to mix pBI121-eGFP and pBI121-CcMYB17-GFP Agrobacterium with NLS-mCherry, vacuum infiltration into N. benthamiana leaves, 22°C dark culture for 24 h, then light culture for 48 h, and the localization of the fusion protein in the tobacco epidermal cells was observed by fluorescence microscopy. The nucleus was labeled with the nuclear localization marker NLS-mCherry.

[0065] The results are shown in Figure 4 pBI121-eGFP was expressed in the organelles of the whole cell, and pBI121-CcMYB17-GFP was only localized in the nucleus, completely fused with the nuclear localization marker.

[0066] 4. Genetic transformation and screening of 84K poplar

[0067] The pBI121-CcMYB17-GFP vector successfully transformed into Agrobacterium GV3101 competent cells was inoculated into 50 mL of YEB liquid medium containing 50 mg / L Kan and 40 mg / L rip for expansion culture, and shaken at 28°C until OD 600 = 0.6-0.8, centrifuged at 4000 rpm for 5 min to collect the bacteria, and resuspended the bacteria in MS resuspension solution to OD 600 = 0.6. The 84K poplar leaf square pre-cultured for 2 days was immersed in the bacterial solution for 10-15 min, then dried and plated on differentiation medium for dark culture for 2 d. The leaves were transferred to differentiation medium containing 30 mg / L Kan and 300 mg / L Cef for screening culture. After the leaves differentiated into adventitious shoots, the adventitious shoots were separated from the leaves and inoculated into rooting medium containing 30 mg / L Kan and 300 mg / L Cef for growth.

[0068] 5. Identification of transgenic positive plants

[0069] The wild type and successfully rooted poplar tissue culture seedlings under screening pressure were taken for DNA extraction using the polysaccharide polyphenol plant genomic DNA extraction kit of Tiangen, and the instructions were followed.

[0070] The extracted genomic DNA of the wild type and the successfully rooted poplar was subjected to PCR detection according to the sequence of vector primer 35S-F+eGFP-R, and the results are shown in Figure 5 There were 5 strains with bands, which were positive plants, and the transgenic poplar strains containing the target band were preserved and observed. The wild type and transgenic poplar leaves grown for 1 month were taken for RNA level identification, with PtrActin7 as the internal reference gene, to detect the change of CcMYB17 gene expression level in the plants. The fluorescence quantitative primer sequence is as follows:

[0071] PtrActin7-F: 5'-AAACTGTAATGGTCCTCCCTCCG-3',

[0072] PtrActin7-R: 5'-GCATCATCACAATCACTCTCCGA-3';

[0073] CcMYB17-F: 5'-TCTCTCATTGCAGGTAGGCTTC-3',

[0074] CcMYB17-R: 5'-TTGTGCCCCTTTTTGCATGG-3'.

[0075] The results are as follows Figure 6 As shown, the CcMYB17 transcript is absent in WT, and the expression level of CcMYB17 is highest in overexpression lines 7, 9 and 10.

[0076] 6. Phenotype of overexpression lines

[0077] Wild-type and transgenic poplar stem segments from the same location were simultaneously inoculated into rooting medium and cultured under the same conditions for 30 days. The tissue-cultured seedlings were then transplanted into soil and cultured under the same conditions for 2 months. Leaf samples were taken for phenotypic observation, and anthocyanin content was determined using a total anthocyanin (total anthocyanin) content kit (purchased from Suzhou Gres Biotechnology Co., Ltd.).

[0078] The results are as follows Figure 7 As shown, the leaves of poplars overexpressing the CcMYB17 gene are darker in color and have obvious red spots, while the wild type is light green and has no red accumulation.

[0079] The results are as follows Figure 8 As shown, the total anthocyanin content of strains 7, 9, and 10, which overexpress the CcMYB17 gene, was significantly higher than that of the wild type, indicating that the CcMYB17 gene promotes anthocyanin synthesis.

[0080] The above description is illustrative only and not restrictive of the present invention. Those skilled in the art will understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all such modifications, variations or equivalents will fall within the protection scope of the present invention.

Claims

1. A CcMYB17 gene of Gantong No. 1, the nucleotide sequence of which is shown as SEQ ID NO.

1.

2. A vector or a recombinant bacterium containing the CcMYB17 gene of Gantong No. 1 according to claim 1.

3. Use of the CcMYB17 gene of Gantong No. 1 according to claim 1 in promoting the color change of leaves of ‘84K poplar’ to red.

4. Use according to claim 3, characterized in that, The method comprises the following steps: 1) constructing a plant expression vector of the CcMYB17 gene of Gantong No. 1; 2) transforming the constructed plant expression vector into leaves of ‘84K poplar’; 3) cultivating and screening to obtain ‘84K poplar’ plants with red leaves.

5. Use according to claim 4, characterized in that, The plant expression vector is pBI121-CcMYB17-eGFP.

6. Use of the CcMYB17 gene of Gantong No. 1 according to claim 1 in promoting the increase of anthocyanin content in vivo of ‘84K poplar’.

7. Use according to claim 6, characterized in that, The method comprises the following steps: 1) constructing a plant expression vector of the CcMYB17 gene of Gantong No. 1; 2) transforming the constructed plant expression vector into leaves of ‘84K poplar’; 3) cultivating and screening to obtain ‘84K poplar’ plants with significantly increased anthocyanin content.

Images