PSV point mutation marker infectious clone

Abstract

The invention relates to a PSV (Point Sequence Virus) point mutation labeled infectious clone, in particular to a nucleic acid molecule with a sequence as shown in SEQ ID NO: 1 and mutation at the 2475th site, a nucleic acid construct of the nucleic acid molecule, and a point mutation labeled recombinant virus obtained through rescue.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to PSV point mutation-marked infectious clones. Background Art

[0002] my country is a large pig-raising country with a large number of pigs. The epidemic of pig infectious diseases is relatively complex. Traditional diseases that endanger the pig industry, such as swine fever, porcine epidemic diarrhea, and pseudorabies, continue to exist. In addition, due to the immune pressure of highly virulent vaccines, the mutation of epidemic strains has accelerated, making them more pathogenic to pigs and causing more serious harm. At the same time, reports of new pathogens infecting pigs continue to appear, forming a complex situation of "old diseases continue to exist and new diseases continue to emerge". Vaccines are an important means of preventing and controlling animal infectious diseases. Traditional diseases such as PRRSV, CSFV, PRV, and PEDV all have commercial vaccines for application, but as the epidemic strains continue to mutate, new vaccines need to be developed to obtain more effective immune effects. For some emerging diseases, such as African swine fever, Zaneka, and porcine Sapelo disease, there are currently no commercial vaccine products. It is imperative to develop effective vaccines to control the spread. Therefore, the update of existing vaccines and the development of vaccines for emerging diseases are the key to disease prevention and control.

[0003] Recombinant viral vector vaccines have unique advantages. They can not only induce immunized animals to produce a wide range of immune responses including humoral immunity, cellular immunity and mucosal immunity, but also have a large genome capacity, allowing the insertion of multiple antigen genes and their simultaneous expression, thereby achieving the purpose of preventing multiple diseases with one shot, providing the possibility for the development of polyvalent vaccines / multi-combination vaccines. Summary of the invention

[0004] This study took the emerging diarrhea pathogen porcine Sapelo virus (PSV) as the research object and established a point mutation-labeled PSV infectious cloning platform, laying a good foundation for subsequent recombinant virus vaccine research.

[0005] The first aspect of the present invention comprises a nucleic acid molecule comprising

[0006] (1) the sequence shown in SEQ ID NO: 1 and having a mutation at position 2475, or a sequence having at least 90% sequence identity thereto and retaining the mutation at position 2475, or

[0007] (2) The complementary sequence of (1).

[0008] In one or more embodiments, the mutation is to add an enzyme cleavage site at position 2475, preferably a SacI enzyme cleavage site.

[0009] In one or more embodiments, the mutation is a mutation at position 2475 to A, C or G. Preferably, the mutation is a mutation to C.

[0010] The present invention also provides a nucleic acid construct comprising the sequence shown in SEQ ID NO:1 or the nucleic acid molecule described in the first aspect of this document. Preferably, the nucleic acid construct comprises a promoter operably linked to the sequence shown in SEQ ID NO:1 or the nucleic acid molecule.

[0011] In one or more embodiments, the nucleic acid construct is a vector, such as a BAC plasmid.

[0012] In one or more embodiments, the backbone of the vector is pACYC184 (GenBank Accession: X06403).

[0013] In one or more embodiments, the nucleic acid construct is a cDNA infectious clone.

[0014] In one or more embodiments, the promoter is a T7 promoter.

[0015] The present invention also provides a cell comprising the nucleic acid molecule or nucleic acid construct.

[0016] In one or more embodiments, the cell is a prokaryotic cell, such as E. coli, Bacillus, or lactic acid bacteria. In one or more embodiments, the cell is a eukaryotic cell, such as a mammalian cell line.

[0017] In one or more embodiments, the cell is a BHK21 cell, a HEK293 cell, and / or a PK15 cell.

[0018] The present invention also provides a PSV virus, comprising the nucleic acid molecule described in any embodiment of the first aspect of this invention.

[0019] In one or more embodiments, the virus is a PSV virus produced by the cell described in any embodiment of the first aspect of the present invention.

[0020] In one or more embodiments, the cell comprises the nucleic acid construct as RNA.

[0021] In one or more embodiments, the nucleic acid construct comprises the nucleic acid molecule described in the first aspect herein.

[0022] The present invention also provides a method for producing a virus, comprising: incubating the cells described in any embodiment of the first aspect of this invention under conditions suitable for virus growth.

[0023] In one or more embodiments, the cell comprises the nucleic acid construct as RNA.

[0024] In one or more embodiments, the nucleic acid construct comprises the nucleic acid molecule described in the first aspect herein.

[0025] The present invention also provides the use of the nucleic acid molecule, nucleic acid construct, or cell described in any embodiment of the first aspect of this invention in preparing PSV virus.

[0026] In one or more embodiments, the cell comprises the nucleic acid construct as RNA.

[0027] The second aspect of the present invention provides a nucleic acid molecule combination, comprising a first, a second and a third nucleic acid molecule, wherein:

[0028] The sequence of the first nucleic acid molecule is as shown in SEQ ID NO: 2 or has at least 90% sequence identity thereto,

[0029] The sequence of the second nucleic acid molecule is as shown in SEQ ID NO: 3 or has at least 90% sequence identity thereto, and retains the sequence of the mutation at position 780,

[0030] The sequence of the third nucleic acid molecule is as shown in SEQ ID NO: 4 or has at least 90% sequence identity thereto.

[0031] In one or more embodiments, the mutation is to add an enzyme cleavage site at position 780 of the second nucleic acid molecule, preferably a Sad cleavage site.

[0032] In one or more embodiments, the mutation is a mutation of position 780 of the second nucleic acid molecule to A, C or G. Preferably, the mutation is a mutation to C.

[0033] The second aspect of the present invention also provides a nucleic acid construct, which:

[0034] The method comprises a first and a second nucleic acid construct, wherein (1) the first nucleic acid construct comprises the first nucleic acid molecule and the second nucleic acid molecule in series from 5' to 3', and the second nucleic acid construct comprises the third nucleic acid molecule, or (2) the first nucleic acid construct comprises the first nucleic acid molecule, and the second nucleic acid construct comprises the second nucleic acid molecule and the third nucleic acid molecule in series from 5' to 3', or

[0035] The invention comprises three nucleic acid constructs, which respectively comprise a first nucleic acid molecule, a second nucleic acid molecule and a third nucleic acid molecule.

[0036] In one or more embodiments, the 5' end of the first nucleic acid molecule comprises an operably linked promoter, such as a T7 promoter.

[0037] In one or more embodiments, the nucleic acid construct is a vector, such as a T-vector.

[0038] In one or more embodiments, the backbone of the vector is a pCE2 TA / Blunt-Zero vector, a pUC vector, a pBR322 vector, or a pET vector, preferably a pCE2 TA / Blunt-Zero vector.

[0039] The second aspect of the present invention also provides a cell comprising the nucleic acid molecule combination or nucleic acid construct described in the second aspect of the present invention.

[0040] In one or more embodiments, the cell is a prokaryotic cell, such as E. coli, Bacillus, or lactic acid bacteria. In one or more embodiments, the cell is a eukaryotic cell, such as a mammalian cell line.

[0041] In one or more embodiments, the cell is a BHK21 cell, a HEK293 cell, and / or a PK15 cell.

[0042] The beneficial effects of the present invention are:

[0043] An infectious cloning platform was established for the newly emerging swine diarrhea pathogen PSV, and point mutation-marked recombinant viruses were rescued without affecting the virus's proliferation and replication characteristics, laying a good foundation for subsequent research on PSV immune mechanisms and recombinant viral vector vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Construction and identification of PSV infectious clone plasmid.

[0045] Figure 2 Construction and identification of point mutation infectious clone plasmid.

[0046] Figure 3 Rescue the viruses for indirect immunofluorescence detection.

[0047] Figure 4 Identification of viruses marked by point mutations in PSV.

[0048] Figure 5 The kinetic curve of virus replication.

[0049] Figure 6 This is a map of the pCE2 TA / Blunt-Zero vector. DETAILED DESCRIPTION

[0050] The present invention can be implemented in many different forms and is not limited to the embodiments described herein. It should be understood that the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0051] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the technical field of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. Although the numerical ranges and parameter approximations shown in the broad scope of the present invention, the numerical values ​​shown in the specific embodiments are recorded as accurately as possible. However, any numerical value is bound to contain a certain error, which is caused by the standard deviation present in their respective measurements. In addition, all ranges disclosed herein should be understood to cover any and all sub-ranges contained therein.

[0052] The first aspect of the present invention provides a nucleic acid molecule comprising the sequence shown in SEQ ID NO:1 and having a mutation at position 2475, or a sequence having at least 90% sequence identity therewith and retaining the mutation at position 2475, or a complementary sequence of the above sequence. The present invention also provides a nucleic acid construct comprising the sequence shown in SEQ ID NO:1 or the nucleic acid molecule described in the first aspect of this article, preferably, the nucleic acid construct comprises an operably linked promoter. In one or more embodiments, the backbone of the vector is pACYC184. The present invention also provides a cell comprising the nucleic acid molecule or nucleic acid construct, and in one or more embodiments, the cell is a BHK21 cell, a HEK293 cell, or a PK15 cell. The present invention also provides a method for producing a virus, comprising: incubating the cell described in any embodiment of the first aspect of this article under conditions suitable for virus growth. The present invention also provides the use of the nucleic acid molecule, nucleic acid construct, and cell in the preparation of PSV virus.

[0053] The second aspect of the present invention provides a combination of nucleic acid molecules, comprising a first, a second and a third nucleic acid molecule, wherein the sequence of the first nucleic acid molecule is as shown in SEQ ID NO:2 or has at least 90% sequence identity thereto, the sequence of the second nucleic acid molecule is as shown in SEQ ID NO:3 or has at least 90% sequence identity thereto, and the sequence of the third nucleic acid molecule is as shown in SEQ ID NO:4 or has at least 90% sequence identity thereto. A nucleic acid construct is also provided, specifically, the nucleic acid construct comprises a first and a second nucleic acid construct, (1) the first nucleic acid construct comprises the first nucleic acid molecule and the second nucleic acid molecule connected in series from 5' to 3', and the second nucleic acid construct comprises the third nucleic acid molecule, or (2) the first nucleic acid construct comprises the first nucleic acid molecule, and the second nucleic acid construct comprises the second nucleic acid molecule and the third nucleic acid molecule connected in series from 5' to 3', or comprises three nucleic acid constructs, respectively comprising a first nucleic acid molecule, a second nucleic acid molecule and a third nucleic acid molecule. The present invention also provides a cell comprising a nucleic acid molecule or a nucleic acid construct, in one or more embodiments, the cell is a BHK21 cell, a HEK293 cell, or a PK15 cell.

[0054] The term "PSV virus" refers to Porcine sapelovirus (PSV), an RNA virus belonging to the genus Sapelovirus of the family Picornaviridae. PSV is closely related to members of the genus Enterovirus and was once called porcine enterovirus 8 (PEV-8). Similar to other porcine enteroviruses, PSV is mainly transmitted through the fecal-oral route, and can also be transmitted through contact and aerosols. In addition, the genetic recombination phenomenon and cross-species transmission risk of PSV pose a potential threat to the pig industry. Currently, a variety of detection methods such as nucleic acid level, protein level, and serology can be used for laboratory detection of PSV, and a variety of cell lines can be used to establish its in vitro infection model for related research on the virus. So far, research on PSV has mainly focused on epidemiological research and its isolation and identification. There are few studies on PSV infection and pathogenic mechanisms, and there are no commercial vaccines and effective antiviral drugs.

[0055] In this article, PSV virus was used as the research object, an infectious cloning platform was established, and relevant nucleic acid molecules, nucleic acid constructs and cells containing nucleic acid constructs were obtained. The nucleic acid constructs were used for in vitro transcription and RNA transfection of BHK21, 293T and / or PK-15 cells and proliferation to obtain rescued viruses, which did not affect the proliferation and replication characteristics of the virus. This laid a good foundation for the subsequent research on PSV immune mechanisms and recombinant viral vector vaccines.

[0056] The term "infectious clone" refers to a recombinant DNA molecule containing a complete genomic sequence of a virus or other pathogen constructed by genetic engineering technology, which can initiate the replication and reproduction of the pathogen in a suitable host cell to produce infectious virus or pathogen particles. The infectious clone of a virus is a plasmid form of a full-length clone of the viral genome that is infectious to eukaryotic cells. For example, in the first aspect of the present invention, the sheared linearized plasmid is first transcribed in vitro and then transfected into 293T cells and PK15 cells.

[0057] The construction of infectious clones is usually divided into several steps: viral genome acquisition, vector selection and construction, and transformation screening. For example, for viruses with known genome sequences, their sequence information can be directly obtained from the gene database, and the full-length genome sequence of the virus can be obtained by amplification, or a combination of n genome fragments can be obtained, where n can be 1, 2, 3, 4, 5, 6, 7, 8 or more. The obtained gene fragments are modified to facilitate the connection of the fragments. For example, restriction sites can be added to the fragments by mutation, or smooth ends or sticky ends can be obtained at both ends of the fragments. Select a suitable cloning vector. Commonly used cloning vectors include plasmids, bacteriophages, artificial chromosomes, etc. In order to enable the cloned viral genome to replicate and express normally in the host cell, it may be necessary to add some necessary regulatory elements to the plasmid, such as promoters, enhancers, terminators, etc. The fragments are then loaded into the vector and connected and transformed, such as the DNA ligase method, or the nucleic acid fragments are first connected and then loaded into the plasmid vector, such as the overlap lap PCR method. Verify and screen the recombinants obtained through cloning construction to determine whether the recombinant DNA molecule containing the target gene has been successfully constructed and the correct clone has been screened. Common screening methods include: antibiotic resistance screening, blue-white screening, enzyme digestion identification, PCR identification, and DNA sequencing identification.

[0058] In the first aspect of the present invention, the total RNA of the PSV strain SHCM2019 is first extracted, and the cDNA of its genome is obtained by reverse transcription, and the T at the 2475nt site in the SHCM2019 genome is mutated to C. Point mutation primers are designed, and SHCM2019cDNA is used as a template, and PCR amplification is performed using the PSV-BF / 2475SacI-R1 and 2475SacI-F2 / PSV-BR primer pairs to obtain 791bp and 1990bp size fragments. Then, the two fragments are fused together by overlapping extension PCR to obtain the PSV-B2475 fragment, which is then cloned into the T vector, and the correctly constructed recombinant plasmid T-PSV-B2475 is obtained by sequencing verification. T-PSV-B2475 is then connected and transformed into the pACYC184 plasmid to obtain the target clone.

[0059] The full-length nucleotide sequence of the present invention or its fragment can usually be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, the relevant sequence can be amplified according to the relevant nucleotide sequence disclosed in the present invention and using a commercially available DNA library or a cDNA library prepared by conventional methods known to those skilled in the art as a template. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified each time together in the correct order. Once the relevant sequence is obtained, the relevant sequence can be obtained in large quantities by recombination. Usually, it is cloned into a vector, then transferred into a cell, and then the relevant sequence is isolated from the host cell after proliferation by conventional methods. In addition, the relevant sequence can also be synthesized by artificial synthesis. At present, the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis.

[0060] The present invention also relates to variants of the above-mentioned polynucleotides, fragments, analogs and derivatives of polypeptides encoding the same amino acid sequence as the present invention. The variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a replacement form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not substantially change the function of the polypeptide it encodes. A "polynucleotide encoding a polypeptide" may be a polynucleotide that encodes the polypeptide, or may be a polynucleotide that also includes additional coding and / or non-coding sequences.

[0061] In the present invention, the wild-type sequence of the nucleic acid molecule is obtained by reverse transcription of RNA of PSV SHCM2019 strain. In one or more embodiments, the mutation is obtained by the following steps: (1) designing a point mutation primer pair PSV-BF / 2475SacI-R1 (SEQ ID NO: 5 and 7), 2475SacI-F2 / PSV-BR (SEQ ID NO: 6 and 8), (2) using the wild-type sequence as a template and using the primer pair to perform PCR amplification.

[0062] The present invention also provides a recombinant vector comprising the polynucleotide of the present invention. As a preferred mode, the promoter downstream of the recombinant vector comprises a multiple cloning site or at least one restriction site. When it is necessary to express the target gene of the present invention, the target gene is connected to a suitable multiple cloning site or restriction site, so that the target gene is operably connected to the promoter. As another preferred mode, the recombinant vector comprises (from 5' to 3' direction): a promoter (e.g., a T7 promoter), a target gene, and a terminator. If necessary, the recombinant vector may also include an element selected from the following group: a 3' polynucleotide signal; a non-translated nucleic acid sequence; a transport and targeting nucleic acid sequence; an enhancer; or an operator. The vector may be an expression vector or an integration vector, and exemplary vectors include, for example, λgt10, λgt11, λNM781, Charon4, Charon 21, pBabe-puro and its derivative vectors, and pLNCX.

[0063] Methods for preparing recombinant vectors are well known to those of ordinary skill in the art. Expression vectors can be bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses or other vectors. In short, any plasmid and vector can be used as long as it can replicate and be stable in the host.

[0064] Those skilled in the art can use well-known methods to construct expression vectors containing the gene of the present invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. When using the gene of the present invention to construct a recombinant expression vector, any one of an enhancing, constitutive, tissue-specific or inducible promoter can be added before the transcription initiation nucleotide.

[0065] The term "rescued virus" refers to the process of using genetic engineering technology to reconstruct complete infectious virus particles from viral genome fragments or cloned viral genes. In virology research, it helps to gain a deeper understanding of basic issues such as the virus replication cycle, gene function, and pathogenic mechanism. By rescuing viruses with specific gene mutations or deletions and comparing the biological characteristics of wild-type viruses and mutant viruses, it is possible to clarify the role of each gene in viral infection and pathogenicity. Rescued viruses can be used to study viral replication mechanisms, analyze virus-host interactions, and produce viral vaccines. Using reverse genetics to rescue viruses is a commonly used technique in the field of virus research. Different viruses have different levels of difficulty in rescue due to different genome sequences.

[0066] In the first aspect of this article, in vitro RNA transfection of 293T cells was first performed, and then transferred to the PSV-susceptible cell line PK15. 293T cells are used to ensure that more RNA is transfected into the cells, and PK-15 cells are a PSV-susceptible cell line suitable for virus proliferation. The combination of the two can improve the efficiency and probability of virus rescue. The rescued virus was then identified, and through PCR amplification and sequencing verification, it can be confirmed that rPSV and point mutation marker virus rPSV2475 have been successfully rescued.

[0067] The term "recombinant vector vaccine" uses attenuated live viruses or attenuated live bacteria as vectors, inserts genes encoding immunogenic proteins of specific pathogens into the vectors, and uses the vector's own replication and expression system to express the immunogenic proteins of pathogens in host cells, thereby inducing the body to produce a specific immune response against the pathogen. Its preparation process first requires determining the antigenic gene in the pathogen that can induce the body to produce an effective immune response, and then cloning it into a suitable vector genome through genetic engineering technology to construct a recombinant vector. Secondly, the constructed recombinant vector is transfected or transformed into the corresponding host cells or bacteria for large-scale culture and reproduction to produce a sufficient number of recombinant vectors. After that, a series of purification processes are used to remove impurities and non-recombinant vectors to obtain a high-purity recombinant vector vaccine. In this article, the nucleic acid construct or cell described in the first aspect can be used for the preparation of recombinant vaccines, laying the foundation for the research of recombinant vaccines.

[0068] Other aspects of the present invention are obvious to those skilled in the art due to the disclosure of this article. The present invention is further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0069] Example

[0070] Materials and Methods

[0071] 1. Materials

[0072] 1.1 Viruses, cells, bacteria and vectors

[0073] The PSV strain SHCM2019 was isolated, identified and preserved by our laboratory; the BHK21 and PK15 cell lines, and the genetically engineered bacterium E.Coli HB101 were all preserved by our laboratory.

[0074] 1.2 Reagents and Antibodies

[0075] 2×Phanta Max Master Mix and 5min TA / Blunt-Zero Cloning Kit were purchased from Vazyme; various restriction endonucleases were purchased from NEB; trypsin, DMEM medium and Opti-MEM medium were purchased from Gibco; SuperScript First-Strand Synthesis System for RT-PCR was purchased from Invitrogen; QIAprep○R Spin Miniprep Kit was purchased from QIAGEN; T7 RiboMAXTM Express Large Scale RNA Production System was purchased from Promega; DMRIE-C Reagent was purchased from Thermo; PSV VP1 monoclonal antibody (13C5) was prepared, identified and stored in this laboratory; HRP-labeled goat anti-mouse IgG and FITC-labeled goat anti-mouse IgG were purchased from Abcam.

[0076] 2. Methods

[0077] 2.1 Primer design

[0078] According to the full genome sequence of PSV strain SHCM2019, appropriate restriction sites were selected and three pairs of specific primers were designed to divide PSV into three fragments for amplification and construction of full-length infectious clones. The primer sequences are shown in Table 1.

[0079] Table 1. Primer sequences for PSV infectious clones

[0080]

[0081] 2.2 Construction and identification of PSV infectious clones

[0082] The total RNA of PSV strain SHCM2019 was extracted, and three cDNA fragments of its genome were amplified by RT-PCR and cloned into pCE2 TA / Blunt-Zero Vector. The suspected correct recombinant clones were obtained by preliminary screening through plasmid extraction and restriction digestion identification, and further sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequence determination to determine the correct recombinant clones T-PSV-A (with T7 promoter at the 5' end), T-PSV-B, and T-PSV-C.

[0083] In order to ensure the stability of the PSV infectious clone, the PSV genome was cloned into the low-copy vector pACYC184. The three fragments of PSV-A, PSV-B, and PSV-C were cloned in sequence at the SalI-EcoRV-ClaI-XbaI restriction enzyme sites, and the correct PSV infectious clone plasmid pACYC-PSV was obtained by plasmid extraction and double enzyme digestion identification.

[0084] 2.3 Construction of point mutation-labeled PSV infectious clones

[0085] In order to identify and distinguish the PSV rescued virus from the paternal virus, the T at the 2475nt site in the SHCM2019 genome was mutated to C, that is, a SacI restriction site was added. Point mutation primers were designed, and SHCM2019 cDNA was used as a template. PCR amplification was performed using the PSV-BF / 2475SacI-R1 and 2475SacI-F2 / PSV-BR primer pairs to obtain 791bp and 1990bp fragments. The two fragments were then fused together by overlapping extension PCR to obtain the PSV-B2475 fragment, which was then cloned into the T vector and the correctly constructed recombinant plasmid T-PSV-B2475 was obtained by sequencing verification.

[0086] T-PSV-B2475 and pACYC-PSV were double-digested with EcoRV and ClaI, and ligated for transformation. The PSV-B2475 fragment replaced the corresponding fragment in pACYC-PSV. The correctly constructed PSV point mutation-marked infectious clone pACYC-PSV2475 was screened and obtained through plasmid extraction and enzyme digestion identification.

[0087] 2.4 In vitro transcription

[0088] First, the pACYC-PSV and pACYC-PSV2475 infectious clone plasmids were respectively digested with XbaI restriction endonuclease to linearize them, and then cut and recovered from the gel. According to the instructions of T7 RiboMAXTM Express Large Scale RNA ProductionSystem, the linearized plasmid treated as above was transcribed in vitro. The specific reaction system was as follows: 8 μL linearized plasmid, 10 μL RiboMAX Express T7 2×buffer, 2 μL Enzyme Mix T7 Express, and incubated at 37°C for 30 min; 1.5 μL RQ RNase-Free DNase was added and incubated at 37°C for 15 min; an equal volume of phenol / chloroform was added, the mixture was shaken and mixed, and centrifuged at 12000 rpm for 10 min; the supernatant was aspirated, an equal volume of chloroform was added, the mixture was shaken and mixed, and centrifuged at 12000 rpm for 10 min; the supernatant was aspirated, 1 / 10 volume of 3M NaAc and 2.5 times volume of anhydrous ethanol were added, the mixture was spun on ice for 5 min, and centrifuged at 12000 rpm for 10 min; the supernatant was removed, 1 mL of 70% ethanol was added, and the mixture was centrifuged at 12000 rpm for 5 min; the supernatant was discarded, air-dried, and 20 μL RNase-Free H2O was added.

[0089] 2.5 RNA transfection

[0090] 24h before transfection, take 293T cells in good growth state, digest with trypsin and adjust the cell concentration, inoculate an appropriate amount in a 6-well cell culture plate, and culture in a carbon dioxide incubator. The next day, when the monolayer cell fusion reaches about 80%, discard the cell supernatant in the 6-well cell plate, wash twice with PBS, and add Opti-MEM medium. Then refer to the DMRIE-C Reagent manual for transfection: take 2 sterile enzyme-free EP tubes, add 500μL Opti-MEM and 2μg RNA to one EP tube, add 500μL Opti-MEM and 6μL DMRIE-C Reagent to the other EP tube, mix gently and let stand at room temperature for 10min; then mix the two, mix gently and let stand at room temperature for 20min, add to the 293T cells in the 6-well plate, and culture in a 37℃ incubator for 6h. After digestion of the cells in each well, transfer to PK15 cells in a 6-well plate, add DMEM culture medium containing 1 μg / ml TPCK trypsin, and continue to culture in a 37°C incubator for 72 hours. After blind passage for 3 generations, identify whether the virus rescue is successful or not.

[0091] 2.6 Identification of infectious virus particles

[0092] 2.6.1 Indirect immunofluorescence detection

[0093] The third generation rPSV, rPSV2475 and SHCM2019 were inoculated into PK15 cells in 96-well cell plates for indirect immunofluorescence detection. After 48 hours of culture, the cell supernatant was discarded and washed three times with PBST for 5 minutes each time; after drying at room temperature, 50 μL of 70% ethanol was added to fix the cells and fixed at -20°C for 15 minutes; the fixative was discarded and washed as above; then 50 μL of single PSV VP1 monoclonal antibody 13C5 (1:1000) was added to each well and incubated at 37°C for 1 hour; the primary antibody was discarded and washed as above; 50 μL of FITC-labeled goat anti-mouse IgG (1:2000) was added and incubated at 37°C for 1 hour; the secondary antibody was discarded and washed as above; DAPI with a final concentration of 1% was added and incubated at 37°C for 10 minutes, and then the results were observed under a fluorescence microscope. At the same time, an empty cell control was set up.

[0094] 2.6.2 PCR detection and sequencing

[0095] Total RNA of the third generation rPSV, rPSV2475 and SHCM2019 was extracted and reverse transcribed into cDNA, and then PCR identification was performed using PSV detection primers (PSV-F: 5'-GATGTGGCGCATGCTCTT-3'; PSV-R: 5'-TGCTGCCTCCTGTGTTGTTAT-3'). In addition, PCR amplification was performed using point mutation identification primers (2475-F: 5'-CAGCAGGAACAGGCATCAAATGG-3'; 2475-R: 5'-GTAGTATAATCCAGTGTGTCCTC-3') and sequencing was used to verify the mutation site.

[0096] 2.6.3 Plotting of virus titer growth curve

[0097] rPSV, rPSV2475 and SHCM2019 were used to infect monolayer PK15 cells, and DMEM culture medium containing 1% TPCK trypsin was added and cultured continuously. Cells were collected at 24h, 48h, 60h, 72h and 96h after infection, and their TCID50 was determined respectively. The specific method for determining the virus TCID50 was as follows: the virus solution was first diluted 10 times continuously, and then inoculated in a 96-well cell plate, 100μL / well, and each dilution was inoculated in 8 wells; after adsorption for 1h, the cell supernatant was replaced with DMEM culture medium containing 1% TPCK trypsin; after 96h of culture, the cell lesions were observed and counted, and the TCID50 of the virus at each time point was calculated according to the Reed-Muench method, and the virus titer growth curve was drawn.

[0098] Example 1, Construction and identification of PSV full-length cDNA infectious clone

[0099] Using SHCM2019 cDNA as a template, PCR amplification was performed using three primer pairs. The results showed that three specific bands of approximately 1943 bp, 2754 bp, and 3374 bp were amplified, and the sizes were correct and consistent with expectations ( Figure 1 A).

[0100] The three target fragments were further cloned into the T vector and sequenced, and the correct sequences of T-PSV-A, T-PSV-B and T-PSV-C were screened and cloned into the pACYC184 plasmid in sequence, and the recombinant plasmid pACYC-PSV was screened. Enzyme digestion showed ( Figure 1 B), two target fragments of 1866 bp and 9572 bp were obtained by double digestion with SalI and EcoRV, two target fragments of 3524 bp and 7914 bp were obtained by double digestion with EcoRV and CalI, and a single target fragment of 11438 bp was obtained by XbaI, indicating that the PSV infectious clone plasmid pACYC-PSV was constructed correctly.

[0101] Example 2, Construction and Identification of PSV Point Mutation Infectious Cloning Plasmid

[0102] By designing point mutation primers, overlap extension PCR amplification was used to obtain a fragment containing the mutation at the 2475 nt site ( Figure 2 A), after sequencing verification, the fragment was double-digested with EcoRV and ClaI to replace the corresponding fragment in pACYC-PSV to obtain the point mutation infectious clone plasmid pACYC-PSV2475. Enzyme digestion identification showed ( Figure 2 B), SacI single enzyme digestion can cut pACYC-PSV2475 into a single band of 11438 bp, while pACYC-PSV cannot be cut into linear fragments. Further sequencing confirmed that the "T" at the 2475 nt site was successfully mutated to "C".

[0103] Example 3, virus rescue and identification

[0104] The PSV VP1 monoclonal antibody (13C5) was used to perform indirect immunofluorescence detection on the third-generation rPSV, rPSV2475 and the parental virus SHCM2019. The results showed that ( Figure 3 ), green specific fluorescence was detected in the cytoplasm, while no green fluorescence was observed in the blank cell wells.

[0105] Total RNA of the third generation rPSV, rPSV2475 and parental virus SHCM2019 was extracted and PCR amplified using PSV detection primers, and a 624 bp target fragment was amplified ( Figure 4A). PCR amplification was further performed using point mutation primers and sequencing verification. The results showed that the 2475th nt in the amplified fragment of rPSV2475 was "C", while both rPSV and SHCM2019 were "T" ( Figure 4 B) It was confirmed that rPSV and point mutation marker virus rPSV2475 were successfully rescued.

[0106] Example 4, virus growth kinetics curve

[0107] The viral titer growth curves of the rescued virus rPSV, the point mutant virus rPSV2475, and the parental virus SHCM2019 were drawn, and it was found that the replication characteristics of the three were similar, suggesting that the mutation at the 2475nt site did not affect the proliferation and replication of PSV ( Figure 5 ).

[0108] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the disclosed scope of this application. Applications of some of the basic features may be made within the scope of the following appended claims.

[0109] Sequence of the present invention:

[0110] SEQ ID NO: 1: Point mutation PSV.

[0111]

[0112] SEQ ID NO:2:PSV-A

[0113]

[0114] SEQ ID NO:3:PSV-B

[0115]

[0116] SEQ ID NO:4:PSV-C

[0117]

[0118] aga

[0119] SEQ ID NO:5: PSV-BF

[0120] CTGCCAGGTAGAGTGACTAATTTACTTCAAG

[0121] SEQ ID NO:6: PSV-BR

[0122] GTGGCCATATTTGTTGCCTAACTC

[0123] SEQ ID NO:7: 2475SacI-R1

[0124] TTAGTTGCCTGGAGCTCCATTGTGGACCCA

[0125] SEQ ID NO:8: 2475SacI-F2

[0126] GTCCACAATGGAGCTCCAGGCAACTAACTGTGTAT

[0127] SEQ ID NO:9: PSV-AF

[0128] CGGTCGACTAATACGACTCACTATAACATGGGGGTACGCAT

[0129] SEQ ID NO:10: PSV-AR

[0130] GAGCCTCTATAATTTGCATACATCCTAGC

[0131] SEQ ID NO:11: PSV-CF

[0132] TTCCTATGTTCCAAATTGATGCAGC

[0133] SEQ ID NO:12: PSV-CR

[0134] TCTAGACGAGGAGGTGGAGATGCCATGCCGACCCTTTTTTTTTTTTTTTTTTTTTTTTTT

[0135] TTTTGTAGACCCTATAG

[0136] SEQ ID NO:13: PSV detection primer PSV-F

[0137] GATGTGGCGCATGCTCTT

[0138] SEQ ID NO: 14: PSV detection primer PSV-R

[0139] TGCTGCCTCCTGTGTTGTTAT

[0140] SEQ ID NO: 15: Primer 2475-F for point mutation identification

[0141] CAGCAGGAACAGGCATCAAATGG

[0142] SEQ ID NO: 16: Primer 2475-R for point mutation identification

[0143] GTAGTATAATCCAGTGTGTCCTC

Claims

1. A nucleic acid molecule comprising: (1) the sequence shown in SEQ ID NO: 1 and having a mutation at position 2475, or a sequence having at least 90% sequence identity thereto and retaining the mutation at position 2475, or (2) The complementary sequence of (1).

2. The nucleic acid molecule according to claim 1, wherein The mutation is to A, C or G at position 2475, preferably, the mutation is to C.

3. A nucleic acid construct comprising the sequence shown in SEQ ID NO: 1 or the nucleic acid molecule according to claim 1, Preferably, the nucleic acid construct is a vector.

4. A cell comprising the nucleic acid molecule according to claim 1 or the nucleic acid construct according to claim 3, Preferably, the cell is a prokaryotic cell or a eukaryotic cell, More preferably, the cells are BHK21 cells, HEK293 cells, or PK15 cells.

5. A PSV virus comprising the nucleic acid molecule of claim 1, preferably, the virus is a PSV virus produced by the cell of claim 4.

6. A method for producing a virus, comprising: The cell of claim 4 is incubated under conditions suitable for viral growth, preferably the cell contains the nucleic acid construct of claim 3 as RNA.

7. Use of the nucleic acid molecule according to claim 1, the nucleic acid construct according to claim 3, or the cell according to claim 4 in preparing PSV virus.

8. A nucleic acid molecule combination comprising a first, a second and a third nucleic acid molecule, wherein: The sequence of the first nucleic acid molecule is as shown in SEQ ID NO: 2 or has at least 90% sequence identity thereto, The sequence of the second nucleic acid molecule is as shown in SEQ ID NO: 3 or has at least 90% sequence identity thereto, and retains the sequence of the mutation at position 780, The sequence of the third nucleic acid molecule is as shown in SEQ ID NO: 4 or has at least 90% sequence identity thereto, Preferably, the mutation is that position 780 of the second nucleic acid molecule is mutated to A, C or G, More preferably, the mutation is to C.

9. A nucleic acid construct, which: Comprising a first and a second nucleic acid construct, (1) the first nucleic acid construct comprises, from 5' to 3', the first nucleic acid molecule and the second nucleic acid molecule described in claim 8 in series, and the second nucleic acid construct comprises the third nucleic acid molecule described in claim 8, or (2) the first nucleic acid construct comprises the first nucleic acid molecule described in claim 8, and the second nucleic acid construct comprises, from 5' to 3', the second nucleic acid molecule and the third nucleic acid molecule described in claim 8 in series, or The method comprises three nucleic acid constructs, which respectively comprise the first nucleic acid molecule, the second nucleic acid molecule and the third nucleic acid molecule described in claim 8.

10. A cell comprising the nucleic acid molecule combination according to claim 8 or the nucleic acid construct according to claim 9, Preferably, the cells are BHK21 cells, HEK293 cells, or PK15 cells.

Images