Construction method and application of oncolytic vaccinia virus vector with F14L gene deletion and adenosine deaminase expression

Abstract

The invention relates to a construction method and application of an oncolytic vaccinia virus vector with F14L gene deletion and adenosine deaminase expression, the virus vector is vaccinia virus, the F14L gene is deleted on the basis of deleting the J2R gene, and the vector can be inserted into any antigen gene beneficial to tumor treatment or used for vaccines for infectious diseases. The constructed vector VV [delta] TK [delta] F14L has specificity, safety and high efficiency, can carry various antigen genes for treating tumors, has targeting property, and is used for treating various solid tumors. The constructed vector VV [delta] TK [delta] F14L-mADA uses the mADA gene as a therapeutic gene to reduce the level of immunosuppressive adenosine in tumor tissues, and the vector can improve the immunosuppressive microenvironment, has tumor targeting and anti-tumor effects, lays a foundation for clinical application of tumor targeting genetic engineering drugs, and provides an effective method for tumor treatment.

Description

Technical Field

[0001] The present invention relates to a construction method and application of an oncolytic vaccinia virus vector with F14L gene deletion and expression of adenosine deaminase, belonging to the field of biotechnology and gene therapy. Background Art

[0002] Vaccinia virus has been systematically studied as an oncolytic virus (OV). Pexa-Vec is a representative of vaccinia virus as an oncolytic agent that has been clinically tested. The virus is a Wyeth strain of vaccinia virus that lacks the TK gene and expresses human GM-CSF. Its tumor selectivity, viral replication, secretion of GM-CSF by infected cancer cells, and induction of anti-tumor immune responses have been confirmed. It can also induce antibody-mediated, complement-dependent tumor cell lysis in tumor patients, showing good anti-tumor efficacy and safety. However, the Phase III clinical trial of Pexa-Vec for advanced liver cancer has been terminated, and the interim results showed that the study was difficult to achieve the main goal of overall survival. Therefore, it is necessary to optimize and transform the oncolytic vaccinia virus vector based on the latest research results to enhance the safety and practicality of the oncolytic vaccinia virus vector and improve its anti-tumor immune ability.

[0003] Vaccinia virus has a huge DNA genome that encodes many proteins specifically designed to evade host immunity. Some of these proteins are secreted from infected cells, where they bind and neutralize complement factors, interferons, cytokines, and chemokines. Other VACV proteins act intracellularly to inhibit apoptosis or signaling pathways that lead to the production of interferons, proinflammatory cytokines, and chemokines. Studies have shown that the F14L gene in vaccinia virus (VV) is not essential for viral replication in vitro. The F14 protein it encodes mimics the transactivation domain of the NF-kB p65 subunit, selectively inhibits the expression of NK-kB regulatory genes, and can reduce NF-kB activation by reducing p65 translocation into the nucleus. Animal experiments using VACV strains lacking F14L can induce stronger CD8+T cell responses. Therefore, it is possible to try to delete the F14L gene to construct a more efficient and safe oncolytic vaccinia virus vector.

[0004] Adenosine, as an immunosuppressive nucleoside, plays an immunosuppressive role in the tumor microenvironment. Adenosine deaminase (ADA) has a wide range of biological functions. As a natural enzyme that effectively consumes adenosine in the body, it can catalyze the conversion of adenosine into inosine. This process alleviates the immunosuppressive state of the tumor microenvironment, enhances the effectiveness of immunotherapy, and thus improves the anti-tumor immune response. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention provides a method for constructing a tumor-targeted vaccinia virus vector VVΔTKΔF14L that simultaneously deletes the J2R (thymidine kinase, TK) and F14L genes. The viral vector carries genes for treating tumors and has the characteristics of targeting, safety, and strong anti-tumor ability.

[0006] The present invention also provides a method for constructing a tumor-targeted vaccinia virus vector VVΔTKΔF14L-mADA, which uses the mAD A (mouse adenosine deaminase) gene as a therapeutic gene, can improve the tumor microenvironment, alleviate its immunosuppressive state, and enhance the anti-tumor effect.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] A method for constructing an oncolytic vaccinia virus vector, which deletes two intrinsic genes of the vaccinia virus, the J2R gene and the F14L gene, and inserts any gene that helps treat tumors or an antigen gene used in an infectious disease vaccine.

[0009] The gene that helps treat tumors is the mouse adenosine deaminase mAD gene.

[0010] The oncolytic vaccinia virus vector is VVΔTKΔF14L, and the construction method comprises the following steps:

[0011] (1) Using gene synthesis method, the upstream sequence of F14L gene SEQ ID NO: 1, the reporter gene red fluorescent protein gene sequence SEQ ID NO: 3 and the downstream sequence of F14L gene SEQ ID NO: 2 were sequentially connected to the vector plasmid pUC57 to construct the shuttle vector plasmid pUC-F14L;

[0012] (2) Designing the gRNA sequence SEQ ID NO: 4 according to the F14L gene sequence, and connecting the gRNA sequence to the PB-gRNA vector to construct the vector plasmid PB-gRNA-F14L;

[0013] (3) CV1 cells were inoculated onto a six-well plate. When the cells reached a confluence of more than 90%, a mixed plasmid of the vector plasmid Cas9 and the vector plasmid PB-gRNA-F14L was transfected simultaneously. After 24 hours, VVΔTK with the TK gene deleted was infected; 2 hours later, the shuttle vector plasmid pUC-F14L was transfected; after 48 hours, the supernatant and cell mixture were collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at 5 μl / well; after 48 hours, monoclonal cells with red fluorescence were picked under a fluorescence microscope; the monoclonal solution was frozen and thawed and added to a six-well plate filled with CV1 cells at 5 μl / well; after 48 hours, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope, which was the oncolytic vaccinia virus vector VVΔTKΔF14L.

[0014] The oncolytic vaccinia virus vector is VVΔTKΔF14L-mADA, and the construction method comprises the following steps:

[0015] (1) Using gene synthesis method, the upstream sequence of F14L gene SEQ ID NO: 1, the reporter gene red fluorescent protein gene sequence SEQ ID NO: 3 and the downstream sequence of F14L gene SEQ ID NO: 2 were sequentially connected to the vector plasmid pUC57 to construct the shuttle vector plasmid pUC-F14L;

[0016] (2) Designing the gRNA sequence SEQ ID NO: 4 according to the F14L gene sequence, and connecting the gRNA sequence to the PB-gRNA vector to construct the vector plasmid PB-gRNA-F14L;

[0017] (3) synthesizing the mADA gene sequence SEQ ID NO:5 and inserting it into the vector plasmid pUC57 to obtain the pUC-mADA vector, double-digesting the pUC-mADA vector and the shuttle vector plasmid pUC-F14L with Sal I and Nhe I, purifying the mADA gene fragment and the pUC-F14L fragment respectively, and then connecting the mADA gene fragment and the pUC-F14L fragment with T4 DNA polymerase to construct the vector plasmid pUC-F14L-mADA;

[0018] (4) CV1 cells were inoculated into a six-well plate. When the cells reached a confluence of more than 90%, a mixed plasmid of the vector plasmid Cas9 and the vector plasmid PB-gRNA-F14L was transfected at the same time. After 24 hours, VVΔTK with the TK gene deleted was infected; 2 hours later, the vector plasmid pUC-F14L-mADA was transfected; after another 48 hours, the supernatant and cell mixture were collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at 5 μl / well; 48 hours later, monoclonal cells with red fluorescence were picked under a fluorescence microscope; the monoclonal solution was frozen and thawed and added to a six-well plate filled with CV1 cells at 5 μl / well; 48 hours later, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope, which was the oncolytic vaccinia virus vector VVΔTKΔF14L-mADA.

[0019] The oncolytic vaccinia virus vector VVΔTKΔF14L obtained by the construction method is used in the preparation of drugs for treating tumors or infectious diseases.

[0020] The oncolytic vaccinia virus vector VVΔTKΔF14L-mADA obtained by the construction method is used in the preparation of drugs for treating tumors or infectious diseases.

[0021] The tumor is a solid tumor, and the infectious disease is a viral, bacterial or fungal infectious disease.

[0022] The solid tumors include pancreatic cancer, kidney cancer, head and neck tumors, lung cancer, esophageal cancer, breast cancer, ovarian cancer, colorectal cancer or gastric cancer.

[0023] Beneficial Effects of the Invention

[0024] (1) The tumor-targeted vaccinia virus vector VVΔTKΔF14L provided by the present invention has two vaccinia virus intrinsic genes J2R and F14L deleted, can carry various genes for treating tumors, has targeting properties, and can be used for the treatment of various cancers (such as pancreatic cancer, lung cancer, gastric cancer, colorectal cancer, ovarian cancer, cervical cancer and liver cancer, etc.). Therefore, VVΔTKΔF14L can be used as an efficient and safe vector system for treating tumors.

[0025] (2) The tumor-targeted vaccinia virus vector VVΔTKΔF14L-mADA of the present invention uses the mAD gene as a therapeutic gene, which can improve the immunosuppressive environment in the tumor microenvironment and enhance the anti-tumor effect. Animal experiments have shown that the virus vector can selectively kill tumor cells and eliminate some tumor-bearing mice.

[0026] (3) The tumor-targeted vaccinia virus vector VVΔTKΔF14L-mADA of the present invention has tumor targeting and anti-tumor effects, laying a foundation for the clinical application of tumor-targeted genetic engineering drugs and providing an effective treatment method for tumor patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Schematic diagram of the structure of tumor-targeted vaccinia virus vectors VVΔTKΔF14L and VVΔTKΔF14L-mADA.

[0028] Figure 2 Schematic diagram of the killing ability of the tumor-targeted vaccinia virus vector VVΔTKΔF14L and its control virus VVΔTK against common human tumor cells.

[0029] Figure 3 Comparison of tumor growth curves of tumor-targeted vaccinia virus vectors VVΔTKΔF14L and VVΔTK in tumor-bearing C57BL / 6 mice.

[0030] Figure 4 Comparison of tumor clearance rates of tumor-targeted vaccinia virus vectors VVΔTKΔF14L and VVΔTK in tumor-bearing C57BL / 6 mice.

[0031] Figure 5 Comparison of tumor growth curves of tumor-targeted vaccinia virus vectors VVΔTKΔF14L and VVΔTKΔF14L-mADA in tumor-bearing C57BL / 6 mice.

[0032] Figure 6 Comparison of tumor clearance rates of tumor-targeted vaccinia virus vectors VVΔTKΔF14L-mADA and VVΔTKΔF14L in tumor-bearing C57BL / 6 mice. DETAILED DESCRIPTION

[0033] The specific implementation modes of the present invention are further described in detail below in conjunction with the embodiments.

[0034] The vaccinia virus used in the embodiments of the present invention is Western Reserve virus (WR strain), and vaccinia virus strains such as Listerine strain, Copenhagen strain, Weyth strain or Tiantan strain can also be used.

[0035] Example 1. Construction of tumor-targeted vaccinia virus vector VVΔTKΔF14L

[0036] (1) First, the gene fragments on both sides of the sequence F14L to be modified and the reporter gene red fluorescent protein (RFP) gene sequence were obtained by gene synthesis. The upstream sequence of the F14L gene was called the left arm, and the downstream sequence was called the right arm. The left arm, the reporter gene, and the right arm were sequentially connected to the vector plasmid pUC57 by genetic engineering methods to construct the shuttle vector plasmid pUC-F14L;

[0037] The upstream sequence, downstream sequence, and red fluorescent protein reporter gene sequence of the F14L gene are SEQ ID NO: 1-SEQ ID NO: 3, respectively;

[0038] (2) The gRNA sequence (SEQ ID NO: 4) was designed based on the F14L gene sequence, and the gRNA sequence was connected to the PB-gRNA vector (Nucleic Acids Res (2014) 42: e155) to construct the vector plasmid PB-gRNA-F14L.

[0039] (3) CV1 cells were inoculated into six-well plates. On the second day, when the cells reached a confluence of more than 90%, the vector plasmid Cas9 and the vector plasmid PB-gRNA-F14L mixed plasmid were transfected at the same time. After 24 hours, VVΔTK (Gene Therapy (2015) 22, 476–484) with the J2R gene of the VV wild-type vaccinia virus deleted was infected, and 2 hours later, the shuttle vector plasmid pUC-F14L was transfected. After another 48 hours, the supernatant and cell mixture were collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at 5 μl / well. After 48 hours, monoclonal cells with red fluorescence were picked under a fluorescence microscope. After freezing and thawing the monoclonal solution, 5 μl / well was added to a six-well plate filled with CV1 cells. After 48 hours, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope, which was the vaccinia virus vector VVΔTKΔF14L with the J2R and F14L genes deleted (see the structural diagram). Figure 1 ).

[0040] Depend on Figure 1 It can be seen that compared with the wild-type vaccinia virus (VV wild type, GenBank: DQ121394.1), VVΔTKΔF14L has deleted both the J2R and F14L genes.

[0041] Example 2. Construction of tumor-targeted vaccinia virus vector VVΔTKΔF14L-mADA

[0042] (1) The mADA gene sequence (SEQ ID NO: 5) was synthesized and inserted into the pUC cloning vector to obtain the pUC-mADA vector. The pUC-mADA vector and the shuttle vector plasmid pUC-F14L (Example 1) plasmid were double-digested with Sal I and Nhe I, and the digested mADA gene fragment and pUC-F14L fragment were purified respectively. Then, the excised mADA gene fragment and the pUC-F14L fragment were ligated with T4 DNA polymerase to construct the vector plasmid pUC-F14L-mADA;

[0043] (2) CV1 cells were inoculated into a six-well plate. On the second day, when the cells reached a confluence of more than 90%, a mixed plasmid of the vector plasmid Cas9 and the vector plasmid PB-gRNA-F14L was transfected at the same time. After 24 hours, VVΔTK in which the VV wild-type vaccinia virus J2R gene was deleted was infected, and the vector plasmid pUC-F14L-mADA was transfected 2 hours later. After another 48 hours, the supernatant and cell mixture were collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at 5 μl / well. After 48 hours, monoclonal cells with red fluorescence were picked under a fluorescence microscope. After the monoclonal solution was frozen and thawed, 5 μl / well was added to a six-well plate filled with CV1 cells. After 48 hours, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope, which was the vaccinia virus vector VVΔTKΔF14L-mADA (the structural diagram is shown in Figure 1 shown).

[0044] Depend on Figure 1 It can be seen that compared with the wild-type vaccinia virus (VV wild type), VVΔTKΔF14L-mADA deleted the J2R and F14L genes and inserted the mADA gene at the F14L position.

[0045] Example 3. Detection of the killing ability of tumor-targeted vaccinia virus vector VVΔTKΔF14L and control virus VVΔTK on common human tumor cells

[0046] A549 (lung adenocarcinoma) cells and KYSE-30 (esophageal cancer) cells in the logarithmic growth phase were collected, counted, and inoculated in 96-well plates at 2000 cells / well; SUIT-2 (pancreatic cancer) cells were collected, counted, and inoculated in 96-well plates at 1000 cells / well. When cell adhesion was observed after 12 hours, the virus VVΔTKΔF14L and the control virus VVΔTK were diluted. The highest concentration of 100 pfu / cell was added to the 96-well plate, and each column decreased by 10 times. The 10th column was a blank control. Six days later, the cell activity was detected by the MTS method, and then the cell activity was converted into EC 50 (i.e., the amount of virus required for each virus to kill 50% of tumor cells, EC 50 The lower the value, the stronger the killing ability of the virus).

[0047] Depend on Figure 2 It can be seen that compared with the control virus VVΔTK, VVΔTKΔF14L has about twice the killing ability of common human tumor cells such as lung adenocarcinoma and pancreatic cancer. In the figure, * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, ****p<0.0001 (the asterisks in other figures have the same meaning as this).

[0048] Example 4. Detection of the therapeutic effects of tumor-targeted vaccinia virus vector VVΔTKΔF14L and control virus VVΔTK on tumor-bearing C57BL / 6 mice

[0049] DT6606 pancreatic cancer cell line (mouse pancreatic cancer cell line) was subcutaneously inoculated on the right back of 5-6 week-old male C57BL / 6 mice. Each C57BL / 6 mouse was inoculated with 2×10 6 cells, and the tumor reached 120 mm after 5 days 3 The mice were divided into 3 groups: treatment group, control group 1 and control group 2, with 7 mice in each group.

[0050] The treatment group was injected with 1×10 8 pfu / mouse VVΔTKΔF14L, control group 1 was injected with phosphate buffered saline (PBS), control group 2 was injected with VVΔTK, and treatment was performed once on days 0, 2, and 4. The tumor volume was measured every 3 days. The experimental results are shown in Figure 3 , Figure 4 shown.

[0051] Depend on Figure 3 It can be seen that the treatment time of VVΔTKΔF14L is significantly shorter than that of VVΔTK, and the treatment effect is better.

[0052] Depend on Figure 4 It can be seen that VVΔTKΔF14L can significantly inhibit tumor growth more than VVΔTK. Treatment with VVΔTKΔF14L vaccinia virus vector alone can completely eliminate 57% of tumors in C57BL / 6 mice, while VVΔTK can only cause 14% tumor elimination in C57BL / 6 mice (the proportion of cured mice in each group).

[0053] Example 5. Therapeutic effects of tumor-targeted vaccinia virus vector VVΔTKΔF14L-mADA and control virus VVΔTKΔF14L on tumor-bearing C57BL / 6 mice

[0054] DT6606 pancreatic cancer cell line (mouse pancreatic cancer cell line) was subcutaneously inoculated on the right back of 4-5 week-old male C57BL / 6 mice. Each C57BL / 6 mouse was inoculated with 2×10 6 cells, and the tumor reached 160 mm after 6 days3 The mice were divided into 3 groups: treatment group, control group 1 and control group 2, with 8 mice in each group.

[0055] The treatment group was injected with 5×10 7 The mice were treated with VVΔTKΔF14L-mADA at pfu / mouse. The control group 1 was injected with phosphate buffered saline (PBS), and the control group 2 was injected with VVΔTKΔF14L. The mice were treated once on the 1st, 2nd and 4th day, and the tumor volume was measured twice a week.

[0056] Depend on Figure 5 It can be seen that after VVΔTKΔF14L-mADA treatment, the tumor growth curve was stable and had a downward trend. VVΔTKΔF14L-mADA can better inhibit tumor growth than VVΔTKΔF14L.

[0057] Depend on Figure 6 It can be seen that VVΔTKΔF14L-mADA can significantly inhibit tumor growth more than VVΔTKΔF14L. Treatment with VVΔTKΔF14L vaccinia virus vector alone cannot eliminate tumors in tumor-bearing C57BL / 6 mice, while VVΔTKΔF14L-mADA can eliminate 50% of tumors in C57BL / 6 mice (the proportion of cured mice in each group).

[0058] The sequences SEQ ID NO:1-SEQ ID NO:5 involved in the present invention are as follows:

[0059] SEQ ID NO: 1: Upstream sequence of F14L gene

[0060] CCGTTTCATTTTCAACAGCCTCAGTTTCAATATCTCCTTCCTGGGTTTGTATTAACGTGTATTGATAAAGTTTCGAAACAGCAAAAAAAATGTAAATATTGTATCTCTAATCGTGGAGATGATGATAGTTTAAGCATTAATCTATTTATTCCGACTATTAACAAGTCTATATATATTATTATCGGTTTACGGATGAAAAATTTTTGGAAGCCTAAATTCGAAATAGAATAATGTTTTTATATTATACATGTTCTAAAAGAATAATCGATACAGTTTAAGTGAAAGCTAGAGAGGGGTTTTTAAATGGTCATCGGTCTAGTCATATTCGTGTCTGTGGCGGCCGCCATCGTCGGTGTGTTGTCTAACGTATTGGACATGCTTATGTACGTAGAAGAAAATAATGAAGAGGATGCTAGAATCAAGGAGGAGCAAGAACTACTGTTGCTATATTGATACATAATTGAAAATCTACCAACTTAAATACACCGCCTATAAATTTACA。

[0061] SEQ ID NO:2: Downstream sequence of the F14L gene

[0062] AAGCTTGTTTTTATGTTAACTAAATGTGGCCATTTGCATCTGTACCTGCGGGAGCAAAATGTAGGCTGGTAGAAACACTACCAGAAAATATGGATTTTAGATCCGATCATTTAACAACATTTGAATGTTTTAACGAAATTATCACTCTAGCTAAGAAATATATATACATAGCATCTTTTTGTTGTAATCCTCTGAGTACGACTAGGGGAGCGCTTATTTTTGATAAACTAAAAGAGGCATCTGAAAAAGGGATTAAAATAATAGTTTTGCTAGATGAACGAGGGAAAAGAAATCTGGGAGAGCTACAAAGTCACTGCCCGGATATAAATTTTATAACCGTTAATATAGATAAAAAAAATAATGTGGGACTACTACTCGGTTGTTTTTGGGTGTCAGATGATGAAAGATGTTATGTAGGAAACGCGTCATTTACTGGAGGATCTATACATACGATTAAAACGTTAGGTGTATATTCTGATTATCCCCCGCTGGCCACAGATCTTCGTAGAAGATTTGATACTTTTAAAGCCTTTAATAGCGCAAAAAATTCATGGTTGAATTTATGCTCTGCG。

[0063] SEQ ID NO:3: Sequence of the reporter gene red fluorescent protein gene

[0064] ATGGCCTCCTCCGAGGACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTTCAGGACGGCTCCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACTATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATGGCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCGCCGAGGGCCGCCACCACCTGTTCCTGTAG。

[0065] SEQ ID NO:4: gRNA sequence designed according to the F14L gene sequence

[0066] ATCGGTCAACAATCTACAA。

[0067] SEQ ID NO:5: mADA gene sequence

[0068]

Claims

1. A method for constructing an oncolytic vaccinia virus vector, characterized in that: Delete the two intrinsic genes of vaccinia virus, J2R gene and F14L gene, and insert any gene that helps to treat tumors or antigen gene used in infectious disease vaccines.

2. The method for constructing an oncolytic vaccinia virus vector according to claim 1, characterized in that: The gene that helps treat tumors is the mouse adenosine deaminase mAD gene.

3. The method for constructing an oncolytic vaccinia virus vector according to claim 1, characterized in that: The oncolytic vaccinia virus vector is VVΔTKΔF14L, and the construction method comprises the following steps: (1) Using gene synthesis method, the upstream sequence of F14L gene SEQ ID NO: 1, the reporter gene red fluorescent protein gene sequence SEQ ID NO: 3 and the downstream sequence of F14L gene SEQ ID NO: 2 were sequentially connected to the vector plasmid pUC57 to construct the shuttle vector plasmid pUC-F14L; (2) Designing the gRNA sequence SEQ ID NO: 4 according to the F14L gene sequence, and connecting the gRNA sequence to the PB-gRNA vector to construct the vector plasmid PB-gRNA-F14L; (3) CV1 cells were inoculated onto a six-well plate. When the cells reached a confluence of more than 90%, a mixed plasmid of the vector plasmid Cas9 and the vector plasmid PB-gRNA-F14L was transfected simultaneously. After 24 hours, VVΔTK with the TK gene deleted was infected; 2 hours later, the shuttle vector plasmid pUC-F14L was transfected; after 48 hours, the supernatant and cell mixture were collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at 5 μl / well; after 48 hours, monoclonal cells with red fluorescence were picked under a fluorescence microscope; the monoclonal solution was frozen and thawed and added to a six-well plate filled with CV1 cells at 5 μl / well; after 48 hours, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope, which was the oncolytic vaccinia virus vector VVΔTKΔF14L.

4. The method for constructing an oncolytic vaccinia virus vector according to claim 1 or 2, characterized in that: The oncolytic vaccinia virus vector is VVΔTKΔF14L-mADA, and the construction method comprises the following steps: (1) Using gene synthesis method, the upstream sequence of F14L gene SEQ ID NO: 1, the reporter gene red fluorescent protein gene sequence SEQ ID NO: 3 and the downstream sequence of F14L gene SEQ ID NO: 2 were sequentially connected to the vector plasmid pUC57 to construct the shuttle vector plasmid pUC-F14L; (2) Designing the gRNA sequence SEQ ID NO: 4 according to the F14L gene sequence, and connecting the gRNA sequence to the PB-gRNA vector to construct the vector plasmid PB-gRNA-F14L; (3) synthesizing the mADA gene sequence SEQ ID NO:5 and inserting it into the vector plasmid pUC57 to obtain the pUC-mADA vector, double-digesting the pUC-mADA vector and the shuttle vector plasmid pUC-F14L with Sal I and Nhe I, purifying the mADA gene fragment and the pUC-F14L fragment respectively, and then connecting the mADA gene fragment and the pUC-F14L fragment with T4 DNA polymerase to construct the vector plasmid pUC-F14L-mADA; (4) CV1 cells were inoculated into a six-well plate. When the cells reached a confluence of more than 90%, a mixed plasmid of the vector plasmid Cas9 and the vector plasmid PB-gRNA-F14L was transfected at the same time. After 24 hours, VVΔTK with the TK gene deleted was infected; 2 hours later, the vector plasmid pUC-F14L-mADA was transfected; after another 48 hours, the supernatant and cell mixture were collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at 5 μl / well; 48 hours later, monoclonal cells with red fluorescence were picked under a fluorescence microscope; the monoclonal solution was frozen and thawed and added to a six-well plate filled with CV1 cells at 5 μl / well; 48 hours later, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope, which was the oncolytic vaccinia virus vector VVΔTKΔF14L-mADA.

5. Use of the oncolytic vaccinia virus vector VVΔTKΔF14L obtained by the construction method according to claim 3 in the preparation of a drug for treating tumors or infectious diseases.

6. Use of the oncolytic vaccinia virus vector VVΔTKΔF14L-mADA obtained by the construction method according to claim 4 in the preparation of a drug for treating tumors or infectious diseases.

7. The use according to any one of claims 5 to 6, characterized in that: The tumor is a solid tumor, and the infectious disease is a viral, bacterial or fungal infectious disease.

8. The use according to claim 7, characterized in that The solid tumors include pancreatic cancer, kidney cancer, head and neck tumors, lung cancer, esophageal cancer, breast cancer, ovarian cancer, colorectal cancer or gastric cancer.

Images