A loach sex-specific SNP marker and genetic sex identification method
By obtaining sex-specific SNP markers for loach through whole-genome resequencing and GWAS analysis, combined with PCR amplification and Sanger sequencing, the problems of accuracy and early identification of loach sex were solved, and efficient identification of genetic sex and breeding applications were achieved.
Patent Information
- Application Number
- CN202510289489.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-12
- Publication Date
- 2025-10-14
- Estimated Expiration
- 2045-03-12
AI Technical Summary
Existing loach sex identification methods can only identify physiological sex, but cannot accurately identify genetic sex. Traditional methods are harmful to individuals and cannot perform sex identification in the early stages.
Through whole-genome resequencing and GWAS analysis, sex-specific SNP markers of loach were obtained, and specific primers were developed for genetic sex identification. The SNP site genotype was read using PCR amplification and Sanger sequencing technology to achieve accurate identification of genetic sex.
It realizes genetic sex identification in the early stage of individual development with high accuracy, does not affect individual survival, has the ability to screen pseudo-male and pseudo-female fish, and has important breeding application value.
Smart Images

Figure CN119955915B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of fish genetic breeding, and more particularly to a loach gender-specific SNP marker and a genetic gender identification method. BACKGROUND
[0002] Growth performance is the most important economic trait of farmed fish. Growth difference between males and females is common in fish, and for economic fish with significant growth difference between males and females, the breeding benefit is closely related to the gender of the population. Loach is a typical gender dimorphic fish, and the growth and body size of female loach have significant advantages compared with male loach. Therefore, breeding all-female population and carrying out single-sex breeding have important production significance for improving the breeding benefit of loach.
[0003] Previous studies have found that the physiological gender of loach is easily affected by the environment (such as water temperature, density, hormones, etc.), so the physiological gender of loach is not completely the same as the genetic gender; the traditional gonadal feature observation method can only identify the physiological gender. Accurate and rapid identification of the genetic gender of individuals is the first step to carry out gender control breeding of loach, and gender-specific molecular markers are the most accurate and most convincing for identifying the genetic gender of individuals. At the same time, gender-specific molecular markers can also be used to screen out pseudo-male fish, pseudo-female fish or super-male fish obtained by artificial induction. Therefore, there is an urgent need for a widely used molecular marker that can accurately identify the genetic gender to carry out gender control breeding and gender-related research of loach.
[0004] Therefore, it is an urgent problem for those skilled in the art to provide a loach gender-specific SNP marker and a genetic gender identification method. SUMMARY
[0005] Therefore, the present application provides a loach gender-specific SNP marker and a genetic gender identification method.
[0006] The present application obtains a loach gender-specific SNP marker through whole genome resequencing and GWAS analysis, and develops specific primers for the marker for genetic gender identification. The traditional gonadal feature observation method can only identify the physiological gender, while the gender-specific marker and identification method of the present application can accurately identify the genetic gender of individuals and screen out pseudo-male fish, pseudo-female fish, etc., and can also identify the gender at an early stage of individual development, with the advantages of minimal damage to the tested individual and no impact on survival. The present application has important application value in parent gender identification in gender control breeding of loach.
[0007] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:
[0008] The first object of the present invention is to provide a sex-specific SNP marker for loach, wherein the nucleotide sequence of the SNP marker is shown in SEQ ID NO. 1. Specifically,
[0009] 5'- AGAGGGACAACAGCCAAAG CTCTGGAGCCATTGCTGGCCTCAG CATAAAGAGCGCCGGGAACAGGATGCTAGATCCATCAAAAACAGCTC G ATTTTTTATAGCTACAAAATAAAACTGGCTGG G AAAACGCAATGGGGGAGTTTTATATCAGTGCTATCCAACAGACTG TCCTTGGTCTTCGTTCTGA -3'; SEQ ID NO.1.
[0010] There are two sex-specific SNP sites (positions 91 and 124) in this nucleotide sequence, which are obviously different in the Sanger sequencing peak diagrams of female and male individuals: the sequencing peak diagrams of positions 91 and 124 in males are heterozygous peaks, with genotypes of G / A and A / G, respectively, while the sequencing peak diagrams of positions 91 and 124 in females are homozygous single peaks, with genotypes of G and G, respectively.
[0011] The second object of the present invention is to provide primer sequences for amplifying sex-specific SNP markers of loach.
[0012] The nucleotide sequences of the upstream and downstream primers used to amplify the sex-specific SNP markers of loach are shown in SEQ ID NO. 2 and SEQ ID NO. 3. Specifically:
[0013] Upstream primer: 5'-AGAGGGACAACAGCCAAAG-3'; SEQ ID NO. 2;
[0014] Downstream primer: 5'-TCAGAACGAAGACCAAGGA-3'; SEQ ID NO. 3.
[0015] The third object of the present invention is to provide the use of the above-mentioned sex-specific SNP marker and primers thereof in loach sex identification.
[0016] Furthermore, a method for identifying the genetic sex of loach comprises the following steps:
[0017] (1) Extracting genomic DNA from the individual to be tested;
[0018] (2) Using genomic DNA as a template, PCR amplification was performed using SEQ ID NO. 2 and SEQ ID NO. 3, and the amplified products were subjected to Sanger sequencing;
[0019] (3) Read the genotypes of the 91st and 124th positions in SEQ ID NO. 1: if the sequencing peak charts of the two SNP sites are both hybrid peak, and the genotypes are G / A and A / G respectively, it is determined to be genetic male; if the sequencing peak charts of the two SNP sites are both homologous single peak, and the genotypes are G and G respectively, it is determined to be genetic female.
[0020] Further, the PCR amplification system in step (2) comprises: 1-2 μL (100 ng / μL) of DNA template, 0.4 μL (10 μmol / μL) of each of the upper and lower primers, 10 μL of 2×Taq PCR Mix, and RNase-free ddH2O to 20 μL.
[0021] Further, the PCR amplification procedure in step (2) comprises: 95°C pre-denaturation for 3 min; 94°C pre-denaturation for 25 s, 52°C annealing for 25 s, 72°C extension for 10 s, 35 cycles; and 72°C extension for 5 min.
[0022] Further, the Sanger sequencing peak chart is read by using Snapgene software in step (3).
[0023] Further, the loach gender-specific SNP marker and genetic sex identification method are suitable for diploid loaches.
[0024] According to the technical solution, compared with the prior art, the loach gender-specific SNP marker and genetic sex identification method provided by the present disclosure have the following beneficial effects:
[0025] (1) Since the physiological sex of loaches is easily affected by the living environment, the physiological sex may not be the same as the genetic sex. The existing loach gender identification methods, such as mature individual gonad feature observation method, chest fin and other secondary sex characteristic observation method, and tissue section observation method of non-sex mature individual, can only identify the physiological sex of the individual. The gender-specific SNP marker developed by the present disclosure can accurately identify the genetic sex of the individual, which is very important for accurately screening pseudo-male fish and pseudo-female fish in gender control breeding.
[0026] (2) In the existing loach gender identification methods, the mature individual gonad feature observation method and the tissue section observation method of non-sex mature individual both need to kill the measured object, which results in that the measured individual cannot be used as a parent to breed the next generation; and the chest fin and other secondary sex characteristic observation method cannot be used for gender identification of immature individuals. The gender-specific SNP marker and identification method provided by the present disclosure can complete gender identification only by a small amount of fin strip tissue to extract genomic DNA. Therefore, the method can complete gender identification at an early stage of individual development (such as the fry stage), and has the advantages of minimal damage to the measured individual and no impact on survival.
[0027] (3) The sex-specific SNP loci of the loach of the present invention were obtained based on whole-genome resequencing and GWAS analysis. GWAS analysis can accurately identify genomic regions associated with important economic traits. Therefore, the sex-specific SNP markers of the present invention can not only be used for genetic sex identification, but also for analyzing the key genes and sex determination mechanisms of loach. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.
[0029] Figure 1 This is the Sanger sequencing peak diagram of the specific SNP marker of the present invention;
[0030] Among them, A is the Sanger sequencing peak diagram of the specific SNP marker in female loach; B is the Sanger sequencing peak diagram of the specific SNP marker in male loach. DETAILED DESCRIPTION
[0031] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0032] The reagents required in the embodiments of the present invention are conventional experimental reagents purchased from commercial channels; the experimental methods not mentioned in detail in the embodiments are conventional experimental methods and will not be described in detail here.
[0033] Example 1
[0034] 1) Extraction of loach genomic DNA
[0035] Thirty male and 30 female loaches were selected, and their fin ray tissues were taken for extraction of genomic DNA using the ammonium acetate / isopropanol method.
[0036] 2) Screening of SNPs with significant associations with loach sex
[0037] ① Perform whole-genome resequencing of each individual's genomic DNA, use the Bayesian model to detect polymorphic sites in the population, and obtain high-quality SNPs;
[0038] ②Through GWAS (based on the FarmCPU model) analysis, SNP sites significantly associated with the sex of loach were discovered.
[0039] 3) Screening of sex-specific SNP markers
[0040] (1) Primer design for amplifying sex-significantly associated SNP sites
[0041] Extract 300 bp of flanking sequences upstream and downstream of the SNP sites with significant sex association, and use Primer 5 to design PCR primers for amplifying each SNP site;
[0042] (2) Amplify SNP sites significantly associated with sex
[0043] The PCR amplification system consisted of 1–2 μL of DNA template (100 ng / μL), 0.4 μL of each upstream and downstream primer (10 μmol / μL), 10 μL of 2× Taq PCR Mix, and RNase-free ddH₂O to a volume of 20 μL. The PCR amplification protocol included a 3-min initial denaturation at 95°C, followed by 35 cycles of 25 s of initial denaturation at 94°C, 25 s of annealing at 52°C, and 10 s of extension at 72°C, followed by a final extension at 72°C for 5 min.
[0044] (3) Sanger sequencing and genotyping
[0045] The PCR amplification products were subjected to Sanger sequencing, and the sequencing peaks were read using Snapgene software. By comparing the sequencing peaks with the actual sex, two sex-specific SNP markers were ultimately identified on chromosome 6. Further analysis revealed that the two sites were located at positions 91 and 124 of the nucleotide sequence SEQ ID NO.1, respectively. PCR primers designed with Primer 5 to amplify these SNP markers are SEQ ID NO.2 and SEQ ID NO.3, and the flanking nucleotide sequence used in the primer design is SEQ ID NO.4. The specific sequences are as follows:
[0046] 5'- AGAGGGACAACAGCCAAAG CTCTGGAGCCATTGCTGGCCTCAG CATAAAGAGCGCCGGGAACAGGATGCTAGATCCATCAAAAACAGCTC G ATTTTTTATAGCTACAAAATAAAACTGGCTGG G AAAACGCAATGGGGGAGTTTTATATCAGTGCTATCCAACAGACTG TCCTTGGTCTTCGTTCTGA -3';SEQ ID NO.1;
[0047] 5'-AGAGGGACAACAGCCAAAG-3'; SEQ ID NO. 2;
[0048] 5'-TCAGAACGAAGACCAAGGA-3'; SEQ ID NO. 3;
[0049] 5'-TAAGTCAAATCAGACAATACTTTCGATTATTCTGTACAATAATTT GCAATCATTAAATCATATTATATATATTAATTTCCGACATGCATTCAGTTCAAATACTGCTGAATTTACCACATGAAAGCTCAACAGTACTGTGAATTGGAAGAGATCGTCAGTCTTACAAAACGTCTCTTATCTCACGCAAAGCCCATTTGTTTGCCTTCCACAAGAGGGACAACAGCCAAAGCTCTGGAGCCATTGCTGGCCTCAGCATAAAGAGCGCCGGGAACAGGATGCTAGATCCATCAAAAACAGCTC G ATTTTTTATAGCTACAAAATAAAACTGGCTGG G AAAACGCAATGGGGGAGTTTTATATCAGTGCTATCCAACAGACTGTCCTTGGTCTTCGTTCTGAAGATGATATCCATGCCTTTCTGAGATAAGGGTGGACACATTGTGATATCTCAAGAACGCAAGCGTCTGAAACATTGGCACGGCGGCAAGGTCAAAACTCGTAAACGCTACTTCTGCCGAAATGGTTTAAAGGGGACATAACACCGAAAGCATGATTTTTCAAGGTTTTACGTAATAAAAGAGTTTAACGTACTATGTGGGTATACTAAAACATTAAAATCGCCAACCAACTGTCTG-3'; SEQ ID NO. 4.
[0050] 4) Verification of the loach gender-specific SNP marker
[0051] Another 141 loaches from Huanggang, Hubei were taken, and fin strip tissues were taken to extract genomic DNA. The primers SEQ ID NO. 2 and SEQ ID NO. 3 were used for PCR amplification, and the genotypes at positions 91 and 124 in sequence SEQ ID NO. 1 were analyzed, with the actual gender as a control, to verify the accuracy of the SNP marker of the present application.
[0052] The results showed that all the female individuals tested had homozygous single peaks at positions 91 and 124, and the genotypes were G and G ( Figure 1 A), the 91st and 124th sequencing peaks of all tested male individuals were heterozygous peaks, and the genotypes were G / A and A / G respectively ( Figure 1 B) Therefore, the SNP markers of the present invention can accurately identify the genetic sex of Hubei Huanggang loach (Table 1).
[0053] Table 1 Sex identification results of the Hubei Huanggang loach population based on sex-specific SNP markers
[0054]
[0055] Example 2
[0056] 124 loaches from Kaifeng, Henan were collected to verify the accuracy of the SNP markers of the present invention, and the specific steps were the same as step 4) of Example 1.
[0057] The analysis results showed that the SNP markers of the present invention could accurately identify the genetic sex of loaches in Kaifeng, Henan Province with 100% accuracy (Table 2).
[0058] Table 2 Sex identification results of the Henan Kaifeng loach population based on sex-specific SNP markers
[0059]
[0060] Example 3
[0061] 139 loaches from Linyi, Shandong were used to verify the accuracy of the SNP markers of the present invention. The specific steps were the same as step 4) of Example 1.
[0062] The analysis results showed that the SNP markers of the present invention could accurately identify the genetic sex of loaches in Linyi, Shandong Province with 100% accuracy (Table 3).
[0063] Table 3 Sex identification results of Shandong Linyi loach population based on sex-specific SNP markers
[0064]
[0065] The loach sex-specific SNP marker and genetic sex identification method provided by the present invention can accurately identify the sex of loach while breaking through the limitations of existing loach sex identification technology. It has the advantages of minimizing damage to the tested individuals and not affecting survival. It has important application value in parent sex identification in loach sex-controlled breeding.
[0066] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. Use of primers for amplifying sex-specific SNP markers of loach in genetic sex identification of loach, characterized in that: The SNP markers are two SNP sites located at positions 91 and 124 of SEQ ID NO. 1, the polymorphism of the 91st SNP site is G / A, and the polymorphism of the 124th SNP site is A / G.
2. The use according to claim 1, characterized in that The nucleotide sequences of the primers are SEQ ID NO.2 and SEQ ID NO.
3.
3. A method for identifying the genetic sex of loach, characterized in that: The steps include: (1) Extracting genomic DNA from the individual to be tested; (2) Using genomic DNA as a template, perform PCR amplification using the primers described in claim 2, and perform Sanger sequencing on the amplified product; (3) Read the genotype of the sex-specific SNP site of the loach as described in claim 1 to identify the genetic sex of the individual to be tested: if the sequencing peaks at positions 91 and 124 are heterozygous peaks and the genotypes are G / A and A / G, respectively, the individual is determined to be genetically male; if the sequencing peaks at positions 91 and 124 are homozygous single peaks and the genotypes are G and G, respectively, the individual is determined to be genetically female.
Citation Information
Patent Citations
Specific molecular marker for coilia ectenes sex determination, molecular marker combination and application thereof
CN118406776A
Specific molecular marker for sex chromosome of paraphyllous hemsleyanus as well as screening method and primer of specific molecular marker
CN118516451A