Application of reagents for detecting SNP site rs1531641 in the preparation of AMS susceptible population screening products
By detecting the genotype of SNP site rs1531641, especially the TT type, the problem of insufficient research on AMS susceptibility was solved, efficient screening and scientific intervention of AMS susceptible populations were achieved, the risk of AMS was reduced, and effective preventive measures were provided.
Patent Information
- Application Number
- CN202510151173.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-11
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2045-02-11
AI Technical Summary
The genetic susceptibility of acute alpine disease (AMS) in the prior art is limited, especially the association between genomic region 3q25.1 polymorphism and AMS susceptibility has not been fully explored, resulting in a lack of effective means for screening and preventive measures for AMS susceptible populations.
By detecting the genotype of SNP site rs1531641, especially the TT type, the detection is performed using primers and probes, and combined with sequencing and analysis devices, screening and scientific intervention of AMS susceptible populations can be achieved to reduce AMS risks.
It realizes efficient, low-cost and accurate screening and prediction of AMS susceptible populations, provides a theoretical basis for clinical treatment and prognosis assessment, and reduces the risk of AMS.
Smart Images
Figure CN119955927B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to application of a reagent for detecting the SNP site rs1531641 in preparing an AMS susceptible population screening product. Background Art
[0002] Acute mountain sickness (AMS) is the most common illness at high altitude, typically occurring shortly after a rapid ascent to an oxygen-deprived environment. The incidence of AMS increases with altitude, reaching 5.8% at 2,850 meters, 2.1% at 3,050 meters, 14.8% at 3,650 meters, and 21.9% at 4,559 meters. Key symptoms include headache, loss of appetite, nausea, dizziness, fatigue, and insomnia. While altitude sickness itself is not life-threatening, it can develop into more serious conditions such as high-altitude pulmonary edema (HAPE) and high-altitude cerebral edema (HACE), which can be fatal if not treated promptly. With increasing numbers of people traveling, working, and exercising at high altitudes, altitude sickness has become a significant public health concern. However, the precise pathophysiology of AMS remains poorly understood.
[0003] Studies have shown that genetic factors play an important role in susceptibility to AMS, with certain genotypes favoring rapid adaptation to high-altitude environments. Association studies based on candidate genes have identified several single nucleotide polymorphisms (SNPs) that are significantly associated with AMS risk. The genes associated with these SNPs were mainly divided into the following four categories: (a) hypoxia-inducible factor (HIF) pathway genes, such as EPAS1 (index SNPs, rs6756667, rs4953348) and EGLN1 (rs12097901, rs2790859); (b) genes involved in angiogenesis, vascular permeability, and vascular smooth muscle relaxation, such as VEGFA (rs3025039), eNOS3 (rs1799983), and EDN1 (rs2070699); (c) heat shock protein (HSP) genes, such as HSPA1A (rs1008438), HSPA1B (rs10661581), and HSPA1L (rs2227956); and (d) genes in the renin-angiotensin system, such as ACE (rs4340) and AGT (rs699). However, the selection of candidate genes is limited by our understanding of the physiological mechanisms underlying AMS susceptibility. Furthermore, this approach does not fully explain the overall heritability of AMS.
[0004] Currently, there are no studies reporting a correlation between polymorphisms in the genomic region 3q25.1 (RNF13) and susceptibility to AMS.
[0005] In view of this, the present invention is proposed. Summary of the Invention
[0006] The first object of the present invention is to provide a reagent for detecting the SNP site rs1531641 for use in preparing an AMS susceptible population screening product to solve the above technical problems.
[0007] The second object of the present invention is to provide a reagent for screening AMS susceptible populations.
[0008] The third object of the present invention is to provide a kit for screening AMS susceptible populations.
[0009] The fourth object of the present invention is to provide a device for screening AMS-susceptible populations.
[0010] In order to achieve the above objectives, the following technical solutions are adopted:
[0011] In a first aspect, the present invention provides the use of a reagent for detecting the SNP site rs1531641 in the preparation of a product for screening AMS susceptible populations.
[0012] As a further technical solution, if the genotype of the SNP site rs1531641 is TT, the population is susceptible to AMS.
[0013] As a further technical solution, the product includes a reagent or a kit.
[0014] In a second aspect, the present invention provides a reagent for screening AMS-susceptible populations, comprising primers and / or probes for detecting the SNP site rs1531641.
[0015] As a further technical solution, the nucleic acid sequences of the primers are shown as SEQ ID NO.1 and SEQ ID NO.2.
[0016] As a further technical solution, the nucleic acid sequence of the probe is shown as SEQ ID NO.3 or SEQ ID NO.4.
[0017] As a further technical solution, the 5' end of the probe is connected to a fluorescent reporter group, and the 3' end is connected to a fluorescent quencher group;
[0018] The fluorescent reporter group includes FAM or HEX;
[0019] The fluorescence quenching group includes TAMRA, BHQ1 or BHQ2.
[0020] In a third aspect, the present invention provides a kit for screening AMS-susceptible populations, comprising the above-mentioned reagents.
[0021] As a further technical solution, it also includes nucleic acid extraction reagents.
[0022] In a fourth aspect, the present invention provides a device for screening AMS susceptible populations, comprising a sequencing device, an alignment device, and an analysis device;
[0023] The sequencing device is used for sequencing the sample to be tested including the rs1531641 region;
[0024] The comparison device is used to determine the genotype of rs1531641 according to the results of the sequencing device;
[0025] The analyzing device is used to determine the AMS susceptibility risk based on the results of the comparing device.
[0026] Compared with the prior art, the present invention has the following beneficial effects:
[0027] A whole-genome association study found that the genotype TT of the SNP site rs1531641 at 3q25.1 is a susceptible genotype for AMS. By detecting the SNP site rs1531641, it is possible to effectively implement auxiliary screening of AMS-susceptible populations and carry out scientific intervention to specifically reduce the risk of AMS in these susceptible populations. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0029] Figure 1 : Manhattan and quantile plots for genome-wide association studies in population cohorts. DETAILED DESCRIPTION
[0030] Below in conjunction with embodiment and example, embodiment of the present invention is described in detail, but those skilled in the art will appreciate that the following embodiment and example are only used to illustrate the present invention, and should not be considered as limiting the scope of the present invention. Based on the embodiment in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work premise all fall within the scope of protection of the present invention. Unspecified conditions are carried out according to the conditions of normal conditions or manufacturer's recommendations. Reagents used or instruments not specified by the manufacturer are conventional products that can be purchased commercially.
[0031] In a first aspect, the present invention provides the use of a reagent for detecting the SNP site rs1531641 in the preparation of a product for screening AMS susceptible populations.
[0032] A genome-wide association study found that the genotype TT of the rs1531641 SNP at 3q25.1 is a susceptible genotype for AMS. When an individual's rs1531641 genotype is TT, it indicates that the individual is more likely to develop AMS. In addition, analysis of the expression quantitative trait loci (eQTL) showed that the protective allele C of rs1531641 was significantly associated with low expression of the RNF13 gene in blood neutrophils CD16+ (P = 7.42×10 -8 These results indicate that RNF13 is a major AMS susceptibility candidate gene on chromosome 3q25.1.
[0033] Accordingly, testing the rs1531641 SNP site can effectively screen populations susceptible to AMS. For example, since the present invention confirms the association between the rs1531641 genotype TT and susceptibility to AMS, the prevention and control of AMS requires testing the rs1531641 genotype of the subject being consulted to determine whether they carry the AMS-susceptible genotype rs1531641TT. For individuals with the rs1531641TT genotype, scientific interventions can be implemented, such as recommending early therapeutic prevention, thereby specifically reducing the risk of AMS in these susceptible populations.
[0034] In some optional embodiments, the product comprises a reagent or a kit.
[0035] In a second aspect, the present invention provides a reagent for screening AMS-susceptible populations, comprising primers and / or probes for detecting the SNP site rs1531641.
[0036] By detecting the SNP site rs1531641, this reagent can assist in the early prediction of AMS individuals in a short time, at low cost and with high accuracy, providing a theoretical basis for clinical treatment and prognosis assessment.
[0037] In some optional embodiments, the nucleic acid sequences of the primers are shown in SEQ ID NO.1 and SEQ ID NO.2:
[0038] Upstream primer: CCACAGAACTACCTTGTTGGA (SEQ ID NO. 1);
[0039] Downstream primer: CCAGATCCAGAGTTCTAAACTTTGT (SEQ ID NO. 2).
[0040] In some optional embodiments, the nucleic acid sequence of the probe is shown in SEQ ID NO.3 or SEQ ID NO.4:
[0041] ACAGCATCAGCATAACGTGGGATCT(SEQ ID NO.3);
[0042] ACAGCATCAGCATAATGTGGGATCT (SEQ ID NO. 4).
[0043] In some optional embodiments, the 5' end of the probe is connected to a fluorescent reporter group, and the 3' end is connected to a fluorescent quencher group;
[0044] The fluorescent reporter group includes but is not limited to FAM or HEX;
[0045] The fluorescence quenching group includes but is not limited to TAMRA, BHQ1 or BHQ2.
[0046] In a third aspect, the present invention provides a kit for screening AMS-susceptible populations, comprising the above-mentioned reagents.
[0047] The kit detects the SNP site rs1531641 to screen people susceptible to AMS.
[0048] In some optional embodiments, a nucleic acid extraction reagent is further included to obtain DNA from the sample to be tested.
[0049] In a fourth aspect, the present invention provides a device for screening AMS susceptible populations, comprising a sequencing device, an alignment device, and an analysis device;
[0050] The sequencing device is used for sequencing the sample to be tested including the rs1531641 region;
[0051] The comparison device is used to determine the genotype of rs1531641 according to the results of the sequencing device;
[0052] The analyzing device is used to determine the AMS susceptibility risk based on the results of the comparing device.
[0053] In some optional embodiments, the sequencing device is used to sequence a predetermined region in the whole genome of an individual to obtain a sequencing result, wherein the predetermined region is 1 Kb upstream and downstream of rs1531641. This allows for more efficient sequencing.
[0054] The present invention is further described below by way of specific examples. However, it should be understood that these examples are merely provided for more detailed description and are not to be construed as limiting the present invention in any form.
[0055] Example 1 Genome-wide association study of AMS susceptibility
[0056] 1. Materials and Methods
[0057] 1.1 Research subjects
[0058] Population Cohort 1: Population Cohort 1 traveled from a low altitude area to a high altitude area (4,600 meters above sea level) by train in May 2022, with a total of 226 participants. All participants gave written informed consent after receiving a comprehensive introduction to the details of the study. Socio-demographic information of all participants was collected, and approximately 2 ml of fasting venous blood was drawn from each participant before they ascended the plateau and stored at minus 80 degrees Celsius. On the evening of arrival, each participant filled out the Lake Louise Questionnaire. Participants with headache symptoms and a Lake Louise Score (LLS) ≥ 3 points were classified as case group, while participants without obvious symptoms were classified as control group.
[0059] 1.2 Genotyping, quality control, and imputation analysis
[0060] Peripheral whole blood samples were collected from all participants, and genomic DNA was extracted from 1 mL of blood using the QIAamp DNA Blood Kit (Qiagen, Crawley, UK), following the manufacturer's instructions. DNA quality was assessed by two methods: (1) assessment of DNA degradation and contamination on a 1% agarose gel and (2) measurement of DNA concentration using the Qubit DNA Assay Kit (Qubit 2.0 Fluorometer). Genotyping of samples was performed using the Illumina Infinium Global Screening Array-24 v1.0 BeadChip.
[0061] Subsequently, rigorous quality control was performed on the samples and SNPs to ensure the robustness of the association tests. Samples with low detection rates (<90%), undetermined sex, consanguineous individuals (PI_HAT values greater than 0.2 in PLINK v.1.9), high heterozygosity (greater than 3 standard deviations from the mean), or identified as outliers using principal component analysis were excluded. For SNPs, this study excluded SNPs with genotype detection rates less than 90%, deviations from Hardy-Weinberg equilibrium (HWE deviation P < 1e-6 for controls and P < 1e-10 for cases), minor allele frequencies less than 5%, and those located on chromosomes X and Y.
[0062] To improve genomic region coverage, genotyping data were imputed using SHAPEIT (v.4.1.2) and IMPUTE5 (v.1.1.5) using the human genome hg19 and the 1000 Genomes Project data as a reference. SNPs with an information score lower than 0.6 or a minor allele frequency lower than 0.01 were excluded.
[0063] 1.3 Association studies
[0064] Genome-wide association analysis was performed using a logistic regression model in PLINK v.1.9, with sex, age, and the first 10 principal components as covariates. Quantile-quantile plots (Q-Qplots) were generated in R (4.3.1) to assess the distribution of P values, and the lambda (λ) inflation factor (genomic inflation factor) was evaluated to detect any systematic bias. In this study, SNPs with a P value < 0.05 in cohort 1 were considered significantly associated with AMS susceptibility.
[0065] Subsequently, fine-mapping analysis was performed using CAVIAR (v.2.2) and FINEMAP (v.1.3.1). A set of credible SNPs was determined for each locus, defined as the minimum set of variants that contained all causal variants with a certainty greater than 0.95. Subsequently, we used RegulomeDB (v2) and Haploreg to identify potentially functional SNPs.
[0066] 2. Results
[0067] 2.1 Whole-genome SNP data quality control results
[0068] To identify AMS susceptibility regions in the Chinese population, the inventors genotyped SNPs in Cohort 1. After rigorous quality control (Table 1), Cohort 1 retained 74 cases and 145 controls, with 7,010,527 SNPs.
[0069] Table 1 Quality control process of the population (a) Quality control of population samples:
[0070]
[0071] (b) SNP quality control process:
[0072]
[0073] 2.2 Association analysis results
[0074] The inventors performed association analysis on population cohort 1 and identified a locus 3q25.1 that was significantly associated with AMS (P < 0.05). In population cohort 1, chromosome 3q25.1 (index SNP rs1531641; odds ratio of C allele OR = 0.5264; 95% confidence interval CI = 0.3357-0.8253; P = 5.16×10 -3 The allele frequencies of the above loci were significantly different between the case group and the control group ( Figure 1 , wherein (a) a Manhattan plot is drawn based on the association results of the population cohort 1 according to an embodiment of the present invention, describing the population-wide association statistics of the population cohort 1, which are derived from a logistic regression model that considers gender, age, and the first 10 principal components; (b) a quantile plot is drawn based on the association results of the population cohort 1 according to the present invention; the inflation factor λ is 1.053; the oblique line segment represents the null hypothesis that there is no real association).
[0075] Example 2 Susceptibility gene location analysis
[0076] To identify potential susceptibility genes at SNPs, this study performed eQTL analysis using five publicly available datasets: (1) QTLbase, which collects genome-wide QTL statistical summaries for many human molecular traits in more than 95 tissues / cell types and under multiple biological conditions. The database includes tens of millions of significant genotype-molecular trait associations under different conditions. (2) Genotype-Tissue Expression Database (GTEx, Release 8), which covers 48 tissues (including blood and lung) and uses whole-genome sequencing to detect SNPs and RNA sequencing to measure mRNA expression levels. (3) ImmuNexUT, which covers 9,852 immune cell samples from 416 donors, including 10 different immune-mediated diseases and 28 immune cell types from healthy donors. (4) FIVEx, which includes eQTL and sQTL data from 16 different studies in the EBI eQTL catalog. (5) scQTLbase is a comprehensive portal for human single-cell eQTLs, which includes 304 datasets for 57 cell types and 95 cell states. It includes approximately 16 million SNPs associated with gene expression in specific cells and approximately 690,000 disease-associated sc-eQTLs from 3,333 traits / diseases. This study focused only on protein-coding genes within a 1-Mb region upstream and downstream of the SNP, with P < 0.001 considered statistically significant. The gene RNF13 is located within a 1-Mb region upstream and downstream of the index SNP rs1531641. According to the results of QTLbase2, the protective allele C of rs1531641 was significantly associated with low expression of the RNF13 gene in CD16+ blood neutrophils (P = 7.42×10 -8 These results suggest that RNF13 is a prime candidate gene on chromosome 3q25.1.
[0077] RNF13 encodes an E3 ubiquitin protein ligase that regulates cell proliferation and participates in the regulation of apoptosis. There are currently no reports of its association with AMS. The latest studies have shown that it can inhibit lysosomal maturation and enhance the inflammatory response mediated by TLRs in macrophage endosomal regions. Combined with previous studies, we speculate that under acute hypoxic conditions, the C allele of rs1531641 may reduce inflammation in the same way, thereby reducing the severity of AMS-related symptoms. In summary, the inventors' association studies and functional studies both suggest that the AMS susceptibility genes in the region (3q25.1) where rs1531641 is located include the RNF13 gene. The present invention confirms the association between the genotype TT of rs1531641 and AMS susceptibility. In the prevention and control of AMS populations, the genotype of rs1531641 should be tested for the consultant in order to carry out scientific interventions and specifically reduce the risk of AMS in these susceptible populations.
[0078] Example 3
[0079] In order to verify the accuracy of using rs1531641 genotype TT to predict AMS susceptible population, the inventors conducted verification on population cohort 2.
[0080] Population Cohort 2: Population Cohort 2 took a bus from a low-altitude area to a high-altitude area (4,600 meters above sea level) in May 2023, recruiting a total of 367 participants. All participants gave written informed consent after receiving a comprehensive introduction to the study details. Socio-demographic information of all participants was collected, and approximately 2 ml of fasting venous blood was drawn from each participant before they ascended the plateau and stored at minus 80 degrees Celsius. On the evening of arrival, each participant filled out the Lake Louise Questionnaire. Participants with headache symptoms and a Lake Louise Score (LLS) ≥ 3 points were classified as case group, while participants without obvious symptoms were classified as control group. After strict quality control (refer to 1.2 of Example 1 for quality control methods), Population Cohort 2 retained 84 cases and 176 controls.
[0081] Peripheral whole blood samples were collected from all participants according to the manufacturer's instructions, and the genotypes of the rs1531641 locus were tested. The statistical results are shown in Table 2:
[0082] Table 2
[0083]
[0084]
[0085] According to the results in Table 2, the sensitivity, specificity, and accuracy of rs1531641 genotype TT in predicting AMS-susceptible populations were calculated, and the results were as follows:
[0086] Sensitivity: 0.52, specificity: 0.62, accuracy: 0.59.
[0087] It is proved that the present invention has good diagnostic value and can be used for auxiliary diagnosis of AMS susceptible population.
[0088] Example 4
[0089] Design of primers and probes for the rs1531641 site:
[0090] Upstream primer: CCACAGAACTACCTTGTTGGA (SEQ ID NO. 1);
[0091] Downstream primer: CCAGATCCAGAGTTCTAAACTTTGT (SEQ ID NO. 2);
[0092] Probe 1: (FAM)ACAGCATCAGCATAACGTGGGATCT (BHQ1) (SEQ ID NO. 3);
[0093] Probe 2: (HEX)ACAGCATCAGCATAATGTGGGATCT(BHQ1) (SEQ ID NO. 4).
[0094] DNA was extracted from subjects with CC and TT genotypes at the SNP site rs1531641, respectively. Fluorescence quantitative PCR was then performed using the DNA as a template using an amplification system containing the above-mentioned primers and probes (upstream primer, downstream primer, probe 1, and probe 2). The results showed that only a single fluorescence was detected after amplification of both nucleic acids, indicating that the primers and probes of the present invention can be used for the detection of the rs1531641 site.
[0095] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. Application of a reagent for detecting the SNP site rs1531641 in the preparation of a screening product for populations susceptible to acute mountain sickness.
2. The use according to claim 1, characterized in that If the genotype of SNP site rs1531641 is TT, the population is susceptible to acute mountain sickness.
3. The use according to claim 1, characterized in that The products include kits.