Application of CCPG1 expression inhibitor in preparation of medicine for treating bladder cancer

Abstract

The invention provides application of an expression inhibitor of CCPG1 in preparation of a medicine for treating bladder cancer. Experiments show that CCPG1 gene expression is related to bladder cancer tumor formation and cis-platinum chemosensitivity, which indicates that the CCPG1 gene can be used as a new bladder cancer treatment target, and a new direction is provided for the development of bladder cancer targeted therapy and chemosensitization drugs. Meanwhile, the invention discloses an expression inhibitor of the CCPG1 gene, which comprises siRNA and / or shRNA, has a good interference effect on the expression of the CCPG1 gene, and has application potential in clinical gene therapy.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the use of an expression inhibitor of CCPG1 in the preparation of a medicine for treating bladder cancer. Background Art

[0002] Bladder cancer is one of the most common tumors of the urinary system in my country, and its incidence rate has been increasing year by year worldwide. Bladder tumors not only cause serious harm to human health, but also affect people's production and life and thus cause a huge economic burden. Bladder cancer is often classified according to its depth of invasion. The subtype with shallow invasion accounts for about 75% to 85%, which is called non-muscle-invasive bladder cancer (NMIBC). This type of tumor uses transurethral bladder tumor resection as its main treatment measure. In order to reduce the risk of tumor recurrence and subsequent progression, it is often combined with bladder instillation therapy to achieve better improvement in prognosis. However, more than half of patients will relapse or further progress to muscle-invasive bladder cancer (MIBC). MIBC is highly invasive, and the chance of subsequent lymph node and distant metastasis is extremely high. The existing radical surgery and radiotherapy and chemotherapy have limited effects. The five-year survival rate after radical resection is also less than 50%, making it difficult to achieve a good treatment effect. Once metastasis occurs, the five-year survival rate drops to 6%. The above factors lead to a long treatment cycle and poor efficacy for bladder cancer patients. MIBC, which is prone to distant metastasis, also requires more monitoring. Therefore, the treatment of bladder cancer for patients often causes greater treatment pressure and economic burden on individuals or families. At present, some new treatment methods such as neoadjuvant chemotherapy have certain limitations in use. Although immunotherapy has achieved good results, it is still limited to use in clinical trial treatment. The advantages and disadvantages of various treatment methods are quite obvious. Cisplatin is a platinum chemotherapy drug commonly used in cancer treatment, especially in the treatment of bladder cancer. Cisplatin is often used in adjuvant chemotherapy or neoadjuvant chemotherapy (preoperative chemotherapy) for bladder cancer to shrink tumors and improve the success rate of surgery. For example, cisplatin is often used in combination with gemcitabine to form the GEM / CIS regimen. Cisplatin also plays an important role in the treatment of locally advanced bladder cancer. It can effectively reduce tumor volume, give patients better surgical conditions, and in some cases reduce the risk of postoperative recurrence. Cisplatin has a good effect on bladder cancer, can effectively reduce tumor volume, improve surgical resection rate, and has a significant therapeutic effect on advanced bladder cancer. Cisplatin also has a certain therapeutic effect on metastatic bladder cancer. However, the side effects of cisplatin may be more serious, including nephrotoxicity, ototoxicity, nausea and vomiting. Some bladder cancer patients may develop resistance to cisplatin, which greatly reduces the effectiveness of treatment. Therefore, it is necessary to find other treatment options or combined treatments to overcome resistance.

[0003] Therefore, there is an urgent need to develop effective therapeutic targets and drugs for the treatment of bladder cancer. Summary of the invention

[0004] The purpose of the present invention is to provide the use of CCPG1 as a target in the preparation of drugs for treating bladder cancer. The present invention has found through experiments that CCPG1 gene expression is related to bladder cancer tumor formation and cisplatin chemotherapy sensitivity, indicating that the CCPG1 gene can be used as a new bladder cancer treatment target, providing a new direction for the development of bladder cancer targeted therapy and chemotherapy sensitization drugs. At the same time, the present invention discloses an expression inhibitor of the CCPG1 gene, including siRNA and / or shRNA, which has a good interference effect on the expression of the CCPG1 gene and has the potential for application in clinical gene therapy.

[0005] In order to achieve the above object, the present invention adopts the following technical solution:

[0006] In a first aspect of the present invention, there is provided the use of CCPG1 as a target in screening drugs for preventing, alleviating and / or treating bladder cancer, wherein the screening method comprises screening substances capable of inhibiting CCPG1 gene expression.

[0007] In the second aspect of the present invention, there is provided the use of an inhibitor of CCPG1 expression in the preparation of a drug for treating bladder cancer.

[0008] Furthermore, the CCPG1 expression inhibitor comprises at least one of the following components:

[0009] CCPG1 inhibitors;

[0010] Knockout or knockdown reagents for CCPG1.

[0011] Furthermore, the CCPG1 knockout reagent includes: siRNA targeting the target gene, and the siRNA nucleotide sequence is shown as SEQ ID NO.1-SEQ ID NO.2.

[0012] Furthermore, the CCPG1 knockout reagent includes: shRNA targeting the target gene, and the shRNA nucleotide sequence is shown in SEQ ID NO.3-SEQ ID NO.4.

[0013] Furthermore, the drug for treating bladder cancer is a drug that inhibits the proliferation ability of tumor cells.

[0014] In the third aspect of the present invention, a drug for treating bladder cancer is provided, the drug comprising at least one of a CCPG1 inhibitor and a knockout or knockdown agent for CCPG1, the knockout or knockdown agent for CCPG1 comprising: siRNA and / or shRNA targeting a target gene, the nucleotide sequence of the siRNA being as shown in SEQ ID NO.1-SEQ ID NO.2. Also comprising: shRNA targeting a target gene, the nucleotide sequence of the shRNA being as shown in SEQ ID NO.3-SEQ ID NO.4.

[0015] The drug also includes pharmaceutically acceptable excipients. The excipients include at least one of a filler, a disintegrant, a binder, an excipient, a diluent, a lubricant, a sweetener or a colorant. The dosage form of the drug includes at least one of granules, tablets, pills, capsules, injections or dispersants.

[0016] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0017] The present invention provides the use of CCPG1 as a target in the preparation of a drug for treating bladder cancer. The present invention has found through research that knocking down CCPG1 significantly inhibits the proliferation of bladder cancer cells and significantly inhibits the development of bladder cancer tumors in a cell line-derived cell transplantation tumor model. These results indicate that CCPG1 is a new target for the treatment of bladder cancer. It indicates that a knockout agent of CCPG1 or / and a CCPG1 inhibitor is a potential new drug for the treatment of bladder cancer.

[0018] The present invention provides an expression inhibitor of CCPG1, a bladder cancer biomarker, which can effectively inhibit the occurrence and development of bladder cancer and has important clinical application value for the development of targeted drugs for bladder cancer. The present application also found that the expression inhibitor of CCPG1 can effectively improve the cisplatin chemotherapy sensitivity of bladder cancer, providing a new direction for the development of combined drugs for bladder cancer chemotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments.

[0020] Figure 1 Schematic diagram of the cancer and adjacent tissue microarray cohort of bladder cancer patients;

[0021] Figure 2 for Figure 1 Analysis of the differential expression of CCPG1 in bladder cancer and adjacent tissues in tissue microarray. The results showed that the expression level of CCPG1 was significantly increased in bladder cancer;

[0022] Figure 3 for Figure 1 In tissue microarray, the results of CCPG1 IHC score analysis in paired bladder cancer and adjacent tissues. The results showed that the expression level of CCPG1 in bladder cancer tissue was higher than that in adjacent tissues of bladder cancer in the same patient;

[0023] Figure 4 It is the forest plot of univariate Cox regression, the red squares are HR, and the blue intervals are the 95% confidence intervals of HR.

[0024] Figure 5 This is the forest plot of multivariate Cox regression. The red squares are HRs and the blue intervals are 95% confidence intervals of HRs.

[0025] Figure 6 The gene transcription expression level of CCPG1 in normal human bladder epithelial cells (SV-HUC-1) and bladder cancer cells (T24, 5637 and UM-UC-3 cells) was detected by qRT-PCR. The results showed that the transcription expression level of CCPG1 in bladder cancer cells was significantly increased compared with that in normal human bladder epithelial cells.

[0026] Figure 7 The protein expression level of CCPG1 in normal human bladder epithelial cells (SV-HUC-1) and bladder cancer cells (T24, 5637 and UM-UC-3 cells) was detected by western blot, and the protein quantification results were obtained. The results showed that the protein expression level of CCPG1 in bladder cancer cells was significantly increased compared with that in normal human bladder epithelial cells.

[0027] Figure 8 The results of immunohistochemical detection of CCPG1 expression in bladder cancer and adjacent tissues, as well as the pathological score statistics of the corresponding groups in the tissue microarray, show that as bladder cancer progresses, the expression level of CCPG1 also increases significantly.

[0028] Fig. 9 This is a statistical analysis of the expression level of CCPG1 protein in different T stages of bladder cancer. The results showed that as the T stage of bladder cancer worsens, the expression level of CCPG1 protein also increases significantly.

[0029] Fig.10 This is a statistical analysis of the expression level of CCPG1 protein in different TNM stages of bladder cancer. The results showed that as the TNM stage of bladder cancer progressed, the expression level of CCPG1 protein also increased significantly.

[0030] Fig.11The relationship between the expression level of CCPG1 in bladder cancer patients and the main pathological stage of bladder cancer patients was analyzed for the TCGA database. The results showed that the expression level of CCPG1 increased with the increase of bladder cancer pathological stage, and P = 0.00235, which was significant.

[0031] Fig.12 For CCPG1 antibody and Figure 1 Correlation analysis of the prognosis of bladder cancer patients included in the tissue chip: This analysis used Kaplan-Meier survival analysis and log-rank statistical test for univariate analysis of survival, and P value <0.05 was statistically significant. Note: p is statistically significant, low expression and high expression in the figure represent low expression and high expression respectively; the high expression curve is at the bottom, indicating that the high expression of the gene has a poor prognosis.

[0032] Fig.13 The relationship between CCPG1 expression level and patient prognosis in bladder cancer patients was analyzed for the TCGA database. The results showed that CCPG1 expression in bladder cancer patients was negatively correlated with prognosis.

[0033] Fig.14 for Figure 1 Receiver operating characteristic (ROC) curve of CCPG1 expression level in tissue microarray in the BLCA prognostic model

[0034] Fig.15 CCPG1 knockdown efficiency was detected by immunoblotting experiments.

[0035] Fig.16 Proliferation analysis of bladder cancer cells after knockdown of CCPG1.

[0036] Fig.17 Apoptosis analysis of bladder cancer cells after knockdown of CCPG1.

[0037] Fig.18 The effect of knockdown of CCPG1 on the chemosensitivity of bladder cancer cells to cisplatin (cell proliferation).

[0038] Fig.19 The effect of knockdown of CCPG1 on the chemosensitivity of bladder cancer cells to cisplatin (cell apoptosis).

[0039] Fig. 20 Schematic diagram of tumor formation and cisplatin administration in nude mice with bladder cancer cell line T24.

[0040] Fig.21 This is a picture of the tumor from the nude mouse tumor formation experiment.

[0041] Fig. 22This is the trend of tumor cell inoculation time and tumor volume in the nude mouse tumor formation experiment. Cis is the abbreviation of cisplatin.

[0042] Fig.23 The tumor weights of different treatment groups in the nude mouse tumor formation experiment.

[0043] Fig.24 The time of tumor cell inoculation and the changes in mouse body weight in the nude mouse tumor formation experiment.

[0044] Fig.25 Immunoblotting was used to detect the expression levels of CCPG1 in different groups in the nude mouse tumor formation experiment.

[0045] Fig.26 The immunohistochemical results of CCPG1 in different groups in the nude mouse tumor formation experiment were detected by Western blotting. DETAILED DESCRIPTION

[0046] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0047] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0048] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.

[0049] The technical solution of the embodiment of the present application is to solve the above technical problems, and the overall idea is as follows:

[0050] Through experiments, the present invention discovered for the first time that the CCPG1 gene is significantly overexpressed in bladder cancer and can be used for the early diagnosis of bladder cancer; the overexpressed CCPG1 gene is closely related to the poor prognosis of bladder cancer, suggesting that the CCPG1 gene can be used as a prognostic marker to provide effective information for the early diagnosis, prognosis evaluation, and treatment effect monitoring of bladder cancer.

[0051] The present invention uses CCPG1 as a molecular marker for diagnosing or prognosing bladder cancer, and the detection reagent of CCPG1 detects the expression level of CCPG1, thereby making the diagnosis or prognosis of bladder cancer more convenient and easy.

[0052] The present invention further found through research that knocking down CCPG1 significantly inhibited the proliferation of bladder cancer cells and significantly inhibited the occurrence and development of bladder cancer tumors in a cell line-derived cell transplantation tumor model. These results indicate that CCPG1 is a new target for the treatment of bladder cancer. It indicates that the CCPG1 knockout agent or / and the CCPG1 knockdown agent or / and the CCPG1 inhibitor is a potential new drug for the treatment of bladder cancer.

[0053] The application of CCPG1 as a target in the preparation of drugs for treating bladder cancer will be described in detail below in combination with examples and experimental data.

[0054] Example 1: CCPG1 as a marker for bladder cancer diagnosis: Abnormally elevated CCPG1 expression levels in bladder cancer patient tissues

[0055] 1. Experimental Subjects

[0056] We collected 68 bladder cancer tissue specimens and 40 paired adjacent tissue specimens and clinical information from the Shanghai Xinchao Biobank. All patients were diagnosed based on their pathology reports, and tumor staging was based on the seventh edition of the American Joint Committee on Cancer (AJCC) Cancer Staging Manual.

[0057] 2. Experimental Methods

[0058] Immunohistochemistry experiments were performed on the cancer and adjacent tissue chips of bladder cancer patients, and correlation analysis was performed in combination with the patient's clinical information and survival prognosis. The test method for differential expression analysis of genes in cancer and adjacent tissues was Wilcoxon, and p<0.05 was statistically significant. If the expression P=xe-n was encountered, x represented a significant number, and en represented 10 to the negative power of n, it meant that the p value was very small, much less than 0.05.

[0059] The correlation analysis between antibodies and clinical indicators was analyzed using the Fisher test, and the P value <0.05 was statistically significant. In the Cox multivariate regression analysis, the variables with statistical significance in the univariate analysis were included in the Cox multivariate survival regression analysis, and the P value <0.05 was statistically significant. For the differential expression analysis of clinical information, the expression grouping differences corresponding to each clinical information were calculated according to the grouping of each clinical information, and the difference significance level between the two groups was calculated by the Wilcoxon rank sum test, and the P value <0.05 was statistically significant.

[0060] 3. Experimental Results

[0061] Schematic diagram of the cancer and adjacent tissue microarray cohort of bladder cancer patients Figure 1 Table 1 is Figure 1 Correlation analysis between CCPG1 expression level and clinical indicators of patients included in tissue microarray:

[0062] Fisher's test was used for analysis, and P value < 0.05 was considered statistically significant.

[0063] Table 1

[0064]

[0065] Note: The analysis method is Fisher test, the p value is statistically significant, and the r value is the correlation coefficient.

[0066] Table 2

[0067]

[0068]

[0069] Note: p is statistically significant. After the variables with P values ​​less than 0.05 in Cox univariate analysis are included in Cox multivariate analysis, if the Cox multivariate analysis

[0070] Figure 1 Analysis of differential expression of CCPG1 in bladder cancer and adjacent adjacent tissues in tissue microarray Figure 2 The expression level of CCPG1 in tumor tissues of bladder cancer patients was significantly higher than that in adjacent adjacent tissues (P<0.0001).

[0071] Figure 1 Results of CCPG1 IHC score analysis in paired tumor and adjacent adjacent tissue microarrays of bladder cancer patients Figure 3 The results showed that in the same patient, the expression level of CCPG1 in bladder cancer tissue was higher than that in adjacent bladder cancer tissue (P<0.0001).

[0072] Table 2 Figure 1 Cox multivariate regression analysis of patients included in the tissue chip: The variables with statistical significance in the univariate analysis were included in the Cox multivariate survival regression analysis. If the p value of the univariate analysis was less than 0.05, the variable could be used as an independent factor affecting prognosis.

[0073] Figure 1 The forest plot of the patients included in the tissue chip is as follows Figure 4-Figure 5As shown. The classic forest plot of binary variables uses the hazard ratio (HR) as an indicator of the effect size of clinical factors. In the forest plot, the effect size point estimate = 1 is used as the invalid line. It is assumed that the left side of the invalid line is factor A (as a reference) and the right side of the invalid line is factor B. When the 95% CI of the effect size contains 1, that is, the horizontal line segment in the forest plot intersects with the invalid line, it indicates that the difference in the incidence of outcome events between the two groups is not statistically significant, and it cannot be considered that factors A and B have different effects on the risk of outcome events. When the 95% CI of the effect size is greater than 1, that is, the horizontal line segment in the forest plot does not intersect with the invalid line, and is on the right side of the invalid line, it can be considered that the incidence of outcome events in the factor B group is greater than that in the factor A group. In general, if the outcome event is an adverse event such as morbidity or death, it indicates that factor B can increase the incidence of outcome events compared with factor A and is a risk factor. On the contrary, when the 95% CI of the effect size is less than 1, that is, the horizontal line segment in the forest plot does not intersect with the ineffective line and is on the left side of the ineffective line, it can be considered that the incidence of the outcome event in the factor B group is lower than that in the factor A group. In general, if the outcome event is an adverse event such as morbidity or death, it indicates that compared with factor A, factor B can reduce the incidence of the event and is a protective factor.

[0074] In conclusion, compared with healthy controls, the expression level of CCPG1 in bladder cancer tissues was increased (P<0.0001), which was statistically significant.

[0075] Example 2: qRT-PCR detection of gene transcription expression level of CCPG1

[0076] 1. Methods

[0077] The qRT-PCR method was used to detect the expression level of CCPG1 in SV-HUC-1, T24, 5637, and UM-UC-3 cell lines.

[0078] The detection kit is an RNA extraction reagent, a reverse transcription kit, and a real-time fluorescence quantitative PCR kit, including the detection primers, and also includes: an internal reference primer for homogenization, a positive control template, a negative control template, and conventional reagents for qPCR reaction. The specific primer sequences are shown in the following table.

[0079] Table 3 Primers for qRT-PCR analysis

[0080]

[0081] The method for detecting the above molecular markers using a real-time fluorescence quantitative PCR kit comprises the following steps:

[0082] The cDNA obtained by reverse transcription was used as a template, and the real-time fluorescence quantitative PCR kit was used to prepare an amplification reaction system for real-time fluorescence PCR amplification to obtain an amplification curve; the amplification reaction system included: SYBR-Green I Premix ExTaq 10 μL, CCPG1 (SEQ ID NO. 5 and 6) primers (2 μM) 0.8 μL as shown in Table 3, RNase-free water 6.4 μL, cDNA 2 μL. The amplification program was: 95°C 5 min, 95°C 30 sec, 61.6°C 30 sec, 72°C 30 sec, except for the first step, the rest of the total 40 cycles to obtain Ct CCPG1;

[0083] At the same time, GAPDH was used as a normalized reference primer to perform qPCR amplification on the cDNA of the sample to be tested synthesized by reverse transcription to obtain Ct GAPDH;

[0084] The Ct value refers to the number of cycles experienced when the fluorescent signal in the reaction tube reaches the set threshold, which reflects the starting copy number contained in the sample. The smaller the starting copy number, the larger the Ct, and vice versa. By calculating Ct CCPG1-Ct GAPDH, ΔCt is obtained.

[0085] The analysis and judgment principles for ΔCt are:

[0086] The ΔCt values ​​of the tested samples were compared with those of the healthy control samples, and statistical analysis was performed to obtain the P value, with P < 0.05 considered statistically significant.

[0087] If P < 0.05, the diagnosis or prognosis of the sample to be tested is bladder cancer;

[0088] If P ≥ 0.05, the sample to be tested is not diagnosed or prognosed as bladder cancer;

[0089] 2. The results are as follows Figure 6 As shown, the transcriptional expression level of CCPG1 in bladder cancer cell lines was significantly increased compared with that in normal human bladder epithelial cells.

[0090] Example 3: Protein expression level of CCPG1 detected by Western blotting

[0091] 1. Methods

[0092] (1) Obtaining cells

[0093] Rinse with PBS, centrifuge to remove the supernatant, add RIPA protein lysis buffer containing protease inhibitors, and place on ice for 30 minutes to fully lyse. Use BCA protein quantification kit to determine protein concentration, add 5×SDS Loading Buffer to the total cell protein after quantification, vortex mix, and place in 95℃ metal bath for denaturation for 5 minutes. Separate the protein by SDS-PAGE, and transfer the protein blot to a polyvinylidene fluoride (PVDF) membrane activated by methanol by semi-dry transfer. After rinsing the PVDF membrane twice with TBST, block it with 5% skim milk. After rinsing with TBST again, incubate the PVDF membrane with the corresponding primary antibody at 4℃ overnight. The next day, incubate the PVDF membrane after rinsing twice with TBST with the secondary antibody at room temperature. After rinsing the PVDF membrane twice, react with ECL chemical developer, detect it with chemiluminescence imager, and analyze the results with ImageJ software.

[0094] (2) Preparation of protein samples

[0095] (1) 100 μL RIPA lysis buffer (brand: Beyotime, catalog number: P0013K) was added with a final concentration of 1× protease inhibitor cocktail (brand: Roche, catalog number: 11836145001), the tissue was lysed, ground on ice, sonicated after grinding, lysed on a shaker at 4°C for 60 min, and then centrifuged at 12,000 g for 10 min at 4°C to collect the supernatant.

[0096] (2) The protein concentration was determined by BCA method (Brand: Zomanbio, Catalog No.: ZD301).

[0097] (3) Add 5× SDS-PAGE protein loading buffer (brand: Abclonal, catalog number: RM00001), mix, boil in water for 10-15 min, and then cool on ice.

[0098] 3. Protein immunoblotting

[0099] (1) Install the gel casting apparatus according to the instruction manual and prepare 5% stacking gel and 10% separation gel respectively.

[0100] (2) Loading: The protein loading amount is 10-100 ng.

[0101] (3) Electrophoresis: After loading, connect the electrophoresis instrument to the power supply, pay attention to the correct connection of the positive and negative electrodes, set appropriate electrophoresis parameters, and the concentration gel electrophoresis parameter is a constant voltage of 60V. When the sample enters the separation gel, the electrophoresis voltage can be adjusted to 120V. When bromophenol blue electrophoresis reaches the bottom of the gel, stop the electrophoresis and turn off the power supply of the electrophoresis instrument.

[0102] (4) Transfer: Take out the gel from the glass plate, and place a porous pad, a filter paper, the gel, a PVDF membrane, three filter papers, and a porous pad (a "sandwich" structure) on the clamp in sequence. Place the transferred membrane in the transfer tank and transfer the membrane at a constant current of 250 mA on ice for 90 minutes.

[0103] (5) Blocking: Remove the membrane from the "sandwich" structure, place it in a suitable antibody incubation tank, add 5% skim milk / TBST Buffer (mass / volume) and block at room temperature for 1 h.

[0104] (6) Primary antibody incubation: rabbit anti-human CCPG1 polyclonal antibody (Proteintech, catalog number: 13861-1-ap) was prepared in the laboratory and diluted with 3% bovine serum albumin (BSA) / TBST Buffer (mass / volume) at a dilution ratio of 1:100-1:200; GAPDH mouse monoclonal antibody (brand: proteintech, catalog number: 60004-1-Ig) was diluted at a ratio of 1:50000. Primary antibody incubation was performed at 4°C overnight.

[0105] (7) Washing: After the primary antibody incubation, add TBST buffer and wash 4 times, 5 min each time.

[0106] (8) Secondary antibody incubation: Secondary antibody HRP-conjugated Affinipure Goat Anti-Rabbit IgG (H+L) (Brand: Proteintech, Catalog No.: SA00001-2) or HRP–conjugated Affinipure Goat Anti-Mouse IgG (H+L) (Brand: Proteintech, Catalog No.: SA00001-1) was diluted 1:5000 in TBST Buffer. Incubate at room temperature for 1 h.

[0107] (9) Washing: After the secondary antibody incubation, add TBST buffer and wash 4 times, 5 min each time.

[0108] (10) Development: ECL developer (brand: Thermo Fisher Scientific, catalog number: 1863094), mix solution A and solution B in a dark place and then drop them onto the PVDF membrane for digital development.

[0109] 4. Data calculation

[0110] By using the BCA method to quantify protein, GAPDH (the content in different cells does not change much and is not affected by the change of the target protein) can be used as the internal reference protein to perform relative quantification of CCPG1 protein (taking the ratio of CCPG1 protein to the internal reference protein as the measurement value), and the control protein. The development images of different samples were gray-processed and the gray value or gray area was calculated.

[0111] 5. Results Analysis

[0112] The results are as follows Figure 7 As shown, it was shown that the protein expression level of CCPG1 in bladder cancer cells was significantly increased compared with that in normal human bladder epithelial cells.

[0113] Example 4: CCPG1 can be used as a molecular marker to distinguish different stages of bladder cancer.

[0114] The present invention uses immunohistochemistry to detect the expression of CCPG1 in bladder cancer and adjacent tissues

[0115] Immunohistochemistry: Formalin-fixed samples were embedded in paraffin and sliced. After paraffin sections were placed in a 60°C oven for dewaxing, they were immersed in xylene, anhydrous ethanol, 90% ethanol, 80% ethanol, and 70% ethanol in turn for hydration. The above sections were immersed in citric acid and placed in a microwave oven. High heat for 3 minutes, medium heat for 7 minutes, and low heat for 3 minutes were selected in turn, and then naturally cooled to room temperature for antigen repair. Endogenous peroxidase was blocked with 3% H2O2 and incubated at room temperature in the dark. Normal goat serum for blocking was added to the tissue of the section and incubated at room temperature. The primary antibody was incubated at 4°C for 16-18 hours. After rewarming at room temperature, the secondary antibody was incubated at room temperature for 30 minutes. The horseradish peroxidase-labeled streptavidin working solution was incubated at room temperature for 15 minutes. The DAB working solution was kept away from light for 5 minutes and left for 3-10 minutes depending on the staining effect. Hematoxylin was counterstained until the cell nucleus was stained blue. Immerse the paraffin sections in 70% ethanol, 80% ethanol, 90% ethanol, anhydrous ethanol, and xylene for dehydration. After drying, seal the sections with neutral resin. Observe and take photos, select representative IHC images, and quantify the staining results using ImageJ software.

[0116] Immunohistochemical detection of CCPG1 expression in bladder cancer and adjacent tissues and pathological scoring statistics of the corresponding groups in tissue microarray are shown in the figure. Figure 8 As shown, the results showed that as bladder cancer progressed, the expression level of CCPG1 also increased significantly.

[0117] The statistical analysis results of CCPG1 protein expression levels in different T stages of bladder cancer are as follows Fig. 9The results showed that as the T stage of bladder cancer progressed, the expression level of CCPG1 protein also increased significantly (P<0.0001). The statistical analysis of the expression level of CCPG1 protein in different TNM stages of bladder cancer was as follows: Fig.10 The results showed that as the TNM stage of bladder cancer progressed, the expression level of CCPG1 protein also increased significantly. The TCGA database analyzed the relationship between the expression level of CCPG1 in bladder cancer patients and the main pathological stages of bladder cancer patients. Fig.11 The results showed that the expression level of CCPG1 increased with the increase of bladder cancer pathological stage, and P = 0.00235, which was significant.

[0118] Therefore, CCPG1 can be used as a molecular marker to distinguish different processes of bladder cancer.

[0119] Example 5: CCPG1 as a prognostic marker for bladder cancer patients

[0120] 1. Correlation analysis between CCPG1 antibody and prognosis of bladder cancer patients

[0121] 1. Methods

[0122] Kaplan-Meier survival analysis and log-rank statistical test were used for univariate analysis of survival, and P value < 0.05 was considered statistically significant.

[0123] 2. Results

[0124] CCPG1 Antibody and Figure 1 The results of the correlation analysis of the prognosis of bladder cancer patients included in the tissue chip are as follows Fig.12 As shown:

[0125] This analysis used the Kaplan-Meier survival analysis method and log-rank statistical test for univariate analysis of survival, and a P value of < 0.05 was considered statistically significant. Fig.12 It can be seen that CCPG1 can be used as a prognostic marker for bladder cancer patients.

[0126] 2. TCGA database analysis

[0127] The TCGA database was used to analyze the relationship between CCPG1 expression levels and prognosis in bladder cancer patients. The operation steps were as follows: TCGABLCA patient database was selected from the Gepia website to analyze the overall survival (OS) and disease-free survival (DFS) of patients with high CCPG1 expression (top 80%, n=281) and low CCPG1 expression (bottom 20%, n=280).

[0128] The results are as follows Fig.13 The results showed that CCPG1 can be used as a prognostic marker for bladder cancer patients, with P < 0.05 indicating statistical significance.

[0129] Example 6, sensitivity and specificity determination

[0130] The receiver operating characteristic (ROC) curve was used to evaluate the diagnostic or prognostic value of CCPG1 in bladder cancer. All statistical analyses were performed using GraphPad Prism 8.0 and IBM SPSS Statistics 26.0. P < 0.05 was considered statistically significant.

[0131] like Fig.14 As shown, the results of ROC curve analysis showed that the level of CCPG1 can be used to distinguish bladder cancer patients from normal controls (AUC=0.7206, P<0.0001), with a sensitivity of 57.6% and a specificity of 82.8%.

[0132] In summary, the present invention has proved through experiments that CCPG1 can be used as an effective molecular marker for the diagnosis or prognosis of bladder cancer. At the same time, the present invention uses a detection reagent to detect the expression level of CCPG1, thereby making the diagnosis or prognosis of bladder cancer more convenient, with high sensitivity and specificity.

[0133] Example 7: Knockdown of CCPG1 inhibits tumor cell proliferation

[0134] 1. Use siRNA to effectively silence or inhibit the expression of CCPG1.

[0135] (1) Vector construction

[0136] Primer sequences

[0137] ①NC siRNA (as a negative control group for interference)

[0138] Justice Chain:

[0139] UUCUUCGAACGUGUCACGUTT;

[0140] Antisense strand:

[0141] ACGUGACACGUUCGGAGAATT;

[0142] ②CCPG1 siRNA

[0143] Justice Chain:

[0144] GGAUAGUAGUACCACUGAGTT(SEQ ID NO.1);

[0145] Antisense strand:

[0146] CUCAGUGGUACUACUAUCCTT(SEQ ID NO.2);

[0147] (2) siRNA transfection

[0148] The bladder cancer cells were transfected when their confluence reached about 70%. The siRNA-liposome complex was prepared by using the synthesized siRNA and Lipofectamine 3000. The DNA-liposome complex was added into the cells.

[0149] 2. Overexpression of CCPG1-WT

[0150] The cDNA sequence of CCPG1 was cloned from HEK293T and constructed into the BamH1 / Not1 restriction site of the pCDH-CMV-MCS-EF1-Hygro vector (purchased from Miaoling Biotechnology Co., Ltd., catalog number P1935) and the BamH1 / Not1 restriction site of the pLV3-CMV-EGFP-MCS-EF1a-Puro vector (purchased from Miaoling Biotechnology Co., Ltd., catalog number P43895), respectively.

[0151] 3. shRNA vector construction

[0152] (1) shRNA knockdown of CCPG1

[0153] ① Primer sequence

[0154] 1) Scramble shRNA (as a negative control group for interference) positive chain:

[0155] CCGGGCGCGATAGCGCTAATAATTTCTCGAGAAATTATTAGCGCTATCGCGCTTTTTG; Antisense strand:

[0156] AATTCAAAAAGCGCGATAGCGCTAATAATTTCTCGAGAAATTATTAGCGCTATCGCGC;

[0157] 2) CCPG1-shRNA

[0158] Justice Chain:

[0159] CCGGCCACCTAAGTTAGAAGAAATTCTCGAGAATTTCTTCTAACTTAGGTGGTTTTTG(SEQ IDNO.3);

[0160] Antisense strand:

[0161] AATTCAAAAACCACCTAAGTTAGAAGAAATTCTCGAGAATTTCTTCTAACTTAGGTGG(SEQ IDNO.4);

[0162] ② The sense strand and antisense strand of each shRNA were annealed separately, and the 58bp oligonucleotide double-stranded strand obtained after annealing was inserted into the pLKO.1 vector (the pLKO.1 vector was linearized by double digestion with EcoR1 and Age1 endonucleases, and then enzyme ligated) to obtain the CCPG1 shRNA knockdown plasmid, which contained the GFP or mCherry gene sequence.

[0163] 4. Lentiviral packaging and cell transduction

[0164] Plasmids were extracted using the DP118 (Tiangen Biotech) kit. Lentivirus packaging was performed using HEK293T cells. The specific method is as follows:

[0165] ① Plate HEK293T cells in a 10 cm culture plate and culture them with DMEM complete medium to ensure that the cells reach 80%-90% confluence when transfected the next day;

[0166] ② Mix the packaging plasmid pMD2.G (0.5 μg) / psPAX2 (0.75 μg) and the target plasmid (1 μg, the CCPG1 shRNA knockdown plasmid obtained in the above step) with 100 μL of Opti-MEM serum-free medium to prepare Mix 1; mix 3 μL of Lip2000 transfection reagent with 100 μL of Opti-MEM serum-free medium to prepare Mix 2, and then let it stand for 5 minutes; mix Mix 1 and Mix 2 to prepare Mix 3, and let it stand at room temperature for 20 minutes;

[0167] ③ Transfection of HEK293T cells: Evenly drop the plasmid into the HEK293T culture medium, remove the culture medium after 6-8 hours, add 10mL of fresh DMEM complete culture medium, and continue to culture until 48 hours after transfection, collect the cell supernatant. After centrifugation at 4000rpm for 10 minutes, filter the supernatant with a 0.45μm filter membrane to obtain the lentiviral solution.

[0168] ④ Lentivirus infection of tumor cells: For the infection of cell lines, the cells were plated in 6-well plates and cultured for 24 hours. After the cells adhered to the wall, the culture medium was aspirated and replaced with lentivirus solution. After 24 hours, the culture medium was replaced with fresh culture medium for another 24 hours. The cell fluorescence was observed under a fluorescence microscope, and the positive cells were sorted out by flow cytometry to establish a line amplification for subsequent experiments. For the infection of primary cells of patients, primary tumor single cells were isolated from the patient's tissues, the cells were plated in 6-well plates or culture dishes, and lentivirus solution was added. After suspension infection for 24 hours, the cells were collected by centrifugation, and the positive cells were sorted out by flow cytometry for nude mouse tumor construction to obtain a cell line stably expressing shCCPG1. At the same time, Scramble shRNA was transfected to obtain a cell line stably expressing shNC as a control.

[0169] 4. The knockdown efficiency was verified by RT-qPCR

[0170] Methods: Bladder cancer cell lines infected with lentivirus were collected, lysed with Trizol, and total RNA of cells was extracted. RNA was reverse transcribed into cDNA using a reverse transcription kit, and then the expression level of CCPG1 in cells was detected by real-time fluorescence quantitative PCR. The primers used for real-time fluorescence quantitative PCR are as follows: sense chain: GTTACCCTTGAGCCACCTAAGT; antisense chain: GATTCATCGTCACTAGGCTGAG.

[0171] The results are as follows Fig.15 As shown, both lentiviral vector pLKO.1-shRNA and siRNA transfection can effectively reduce the expression level of CCPG1 in bladder cancer cell lines.

[0172] 5. Culture tumor cells with CCPG1 knockdown in 2D in vitro and detect the effect of CCPG1 knockdown on cell proliferation.

[0173] The results are as follows Fig.16 As shown, compared with the control cell line, siRNA knockdown of CCPG1 inhibited the proliferation of tumor cells.

[0174] 6. To determine how siRNA knockdown of CCPG1 inhibits cell proliferation, we first used annexin V to detect cell apoptosis. Fig.17 As shown, compared with the control group, the proportion of apoptotic cells increased significantly after knocking down CCPG1.

[0175] Example 8: Response of bladder cancer cells to cisplatin chemotherapy after CCPG1 intervention

[0176] 1. Methods

[0177] CCK-8 experiment: 100ul of the CCPG1 siRNA transfected HEK293T cell suspension obtained in Example 7 was placed in a 96-well plate (100ul of 3000 cells were added to each well). Incubate in an incubator for 24h. 10ul of CCK-8 solution was added to each well. Incubate in the cell incubator for another 4h. The absorbance at 450nm was measured using an ELISA reader.

[0178] Cell apoptosis experiment: Culture cells in 6-well plates and induce treatment, collect cells, centrifuge at 300g for 5 minutes, discard supernatant, and collect cells. Resuspend cells with PBS, centrifuge at 300g for 5 minutes, and discard supernatant. Add 200ul 1×Binding Buffer, add 2ul Annexin V-FITC, and then add 4ul Propidium Iodiade, vortex to mix. React at room temperature in the dark for 15-20 minutes. Immediately detect using flow cytometer (Beckman Cytoflex) after reaction.

[0179] 2. Results

[0180] The results of CCK-8 detection on the sensitivity of bladder cancer cells T24 and 5637 to cisplatin chemotherapy after CCPG1 intervention are as follows Fig.18 As shown in the figure, it is shown that siRNA intervention in CCPG1 can significantly increase the inhibitory effect of cisplatin on the proliferation of T24 and 5637. The results of flow cytometry detection of the response of bladder cancer cells to cisplatin chemotherapy after siRNA intervention in CCPG1 are shown in the figure. Fig.19 As shown, it was shown that intervention of CCPG1 could significantly promote the promoting effect of cisplatin on T24 and 5637 apoptosis.

[0181] Example 9: Effect of knockdown of CCPG1 by shCCPG1 on the tumorigenicity of cell lines in vivo

[0182] 1. A cell line stably expressing shCCPG1 was obtained by lentiviral packaging and cell transduction in Example 7.

[0183] 2. Construction of mouse model

[0184] Methods: T24 cell lines stably expressing shNC, shCCPG1, and CCPG1-WT were screened using Hygro.

[0185] 5-week-old Balb / C mice purchased from Vital River were placed in the experimental environment for one week to adapt. 6 T24 cell lines stably expressing different vectors were resuspended in 200 μL of normal saline and injected subcutaneously into the left dorsal flank of mice (n=5).

[0186] Two weeks later, the shCCPG1 group and the CCPG1-WT group were injected with cisplatin Cis, and 200 μL of 2.5 mg / kg cisplatin was intraperitoneally injected once every 2 days. Fig. 20 As shown. On the 55th day, the mice were killed and the tumors were collected. Fig.21 shown.

[0187] 4. Tail vein injection and in vivo metastasis monitoring

[0188] Resuspend the infected bladder cancer cells in PBS and adjust the cell concentration to 5×10 7 Cells / mL. The mice were irradiated with an electric heating lamp for 2-3 minutes until the two veins on the tail vein turned red. The mice were taken out and fixed in a mold. 100 μL of cell suspension was injected into the veins. Gauze was used to stop bleeding for 1 minute before the mice were returned to the cage. The mice were weighed regularly and the metastasis of tumor cells in the mice was detected using a small animal in vivo imaging device.

[0189] 5. Experimental results

[0190] The trend of tumor volume changes in the time of tumor cell inoculation in nude mice tumor formation experiment is as follows Fig. 22 As shown in the figure, the tumor weights of different treatment groups in the nude mouse tumor formation experiment are as follows Fig.23 As shown in Figure 2, the time of tumor cell inoculation and the weight changes of mice in the nude mouse tumor formation experiment are as follows: Fig.24 As shown, we then used immunoblotting and immunohistochemistry to detect the expression levels of CCPG1 in different groups in the nude mouse tumor formation experiment. The experimental methods are as follows.

[0191] ① Western blotting

[0192] The cells were collected, rinsed with PBS, centrifuged to remove the supernatant, and then RIPA protein lysis buffer containing protease inhibitors was added, and the cells were fully lysed on ice for 30 minutes. The protein concentration was determined using the BCA protein quantification kit, and 5×SDS Loading Buffer was added to the total cell protein after quantification, vortexed and placed in a 95°C metal bath for denaturation for 5 minutes. The proteins were separated by SDS-PAGE, and the protein blots were transferred to a polyvinylidene fluoride (PVDF) membrane activated by methanol by semi-dry transfer. After rinsing the PVDF membrane twice with TBST, it was blocked with 5% skim milk. After rinsing with TBST again, the PVDF membrane was incubated with the corresponding primary antibody at 4°C overnight. The next day, the PVDF membrane, which had been rinsed twice with TBST, was incubated with the secondary antibody at room temperature. After rinsing the PVDF membrane twice, it was reacted with ECL chemical developer, detected by chemiluminescence imager, and the results were analyzed by ImageJ software.

[0193] ②Immunohistochemistry

[0194] The samples fixed in formalin were embedded in paraffin and sliced. After the paraffin sections were dewaxed in a 60°C oven, they were immersed in xylene, anhydrous ethanol, 90% ethanol, 80% ethanol, and 70% ethanol in turn, and hydrated. The above sections were immersed in citric acid and placed in a microwave oven. High heat for 3 minutes, medium heat for 7 minutes, and low heat for 3 minutes were selected in turn, and then naturally cooled to room temperature for antigen repair. Endogenous peroxidase was blocked with 3% H2O2 and incubated at room temperature in the dark. Normal goat serum for blocking was added to the tissue of the section and incubated at room temperature. The primary antibody was incubated at 4°C for 16-18 hours. After rewarming at room temperature, the secondary antibody was incubated at room temperature for 30 minutes. The horseradish peroxidase-labeled streptavidin working solution was incubated at room temperature for 15 minutes. The DAB working solution was kept away from light for 5 minutes and left for 3-10 minutes depending on the staining effect. Hematoxylin was counterstained until the cell nucleus was stained blue. Immerse the paraffin sections in 70% ethanol, 80% ethanol, 90% ethanol, anhydrous ethanol, and xylene for dehydration. After drying, seal the sections with neutral resin. Observe and take photos, select representative IHC images, and quantify the staining results using ImageJ software.

[0195] The results are as follows Fig.25 and Fig.26 As shown, it is shown that the expression inhibitor (shRNA or siRNA) of CCPG1 can effectively inhibit the growth and development of bladder cancer, and at the same time improve the sensitivity of bladder cancer to cisplatin chemotherapy.

[0196] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0197] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0198] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. The use of CCPG1 as a target in screening drugs for preventing, alleviating and / or treating bladder cancer, characterized in that: The screening method includes screening substances that can inhibit CCPG1 gene expression.

2. Application of CCPG1 expression inhibitor in the preparation of drugs for treating bladder cancer.

3. The use according to claim 2, characterized in that: The CCPG1 expression inhibitor comprises at least one of the following components: CCPG1 inhibitors; Knockout or knockdown reagents for CCPG1.

4. The use according to claim 3, characterized in that: The CCPG1 knockout or knockdown reagent includes: siRNA targeting the target gene, and the siRNA nucleotide sequence is shown as SEQ ID NO.1-SEQ ID NO.

2.

5. The use according to claim 3, characterized in that: The CCPG1 knockout or knockdown reagent includes: shRNA targeting the target gene, and the shRNA nucleotide sequence is shown in SEQ ID NO.3-SEQ ID NO.

4.

6. The use according to claim 2, characterized in that: The drug for treating bladder cancer is a drug that inhibits the proliferation ability of tumor cells.

7. A drug for treating bladder cancer, characterized in that: The drug includes at least one of a CCPG1 inhibitor and a CCPG1 knockout agent.

8. The drug according to claim 7, characterized in that The drug also includes pharmaceutically acceptable excipients.

9. The drug according to claim 8, characterized in that The auxiliary materials include at least one of a filler, a disintegrant, a binder, a lubricant, a sweetener or a colorant.

10. The drug according to claim 7, characterized in that The dosage form of the drug includes at least one of granules, tablets, pills, capsules and injections.

Images