GPC1 in the prevention and / or treatment of 131 I Use of inhaled internal radiation for thyroid cancer

Abstract

The application provides GPC1 in preventing and / or treating 131 The application of inhaled internal radiation in causing thyroid cancer belongs to the technical field of biological medicine. The application takes GPC1 as 131 A treatment target of inhaled internal radiation in causing thyroid cancer, and finds that high expression of GPC1 can promote the proliferation, migration and invasion of thyroid cancer cells, and low GPC1 inhibits the occurrence and development of thyroid cancer. Therefore, the application provides application of a reagent for inhibiting, knocking down or knocking out GPC1 in preparation of a drug for preventing and / or treating thyroid cancer. The application also provides that deletion of GPC1 can effectively alleviate 131 The phenotypes of thyroid cancer caused by inhaled internal radiation, and GPC1 is an effective target for preventing and treating 131 Thyroid cancer caused by inhaled internal radiation.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the use of GPC1 in prevention and / or treatment. 131 The use of inhaled internal radiation to induce thyroid cancer. Background Technology

[0002] Radionuclides 131 Iodine (I) is a major component of early nuclear fission products after a nuclear explosion. It is highly volatile and easily absorbed into the body through the respiratory tract, causing continuous internal radiation exposure. Approximately 70% of the radioactive iodine entering the bloodstream is found in the plasma, and 30% in the formed elements of the blood. However, it quickly migrates from the blood to various tissues and organs throughout the body, exhibiting a highly uneven distribution. For a long time, it has been generally accepted that exposure to radioactive isotopes... 131 External irradiation with iodine is closely associated with thyroid damage, such as hypothyroidism, thyroid autoimmune diseases, thyroid nodules, and thyroid cancer. However, research on internal irradiation-induced thyroid damage is still very limited. The thyroid gland is a radiation-sensitive organ and the only organ in the human body that both absorbs and binds iodine; therefore, exposure to environmental radiation is a significant risk factor. 131 I poses a significant threat to the human thyroid gland. The surprising aspect is that, according to radioactive isotopes... 131 Calculated by the concentration of iodine, the thyroid gland contains hundreds or even thousands of times more iodine than the blood, while correspondingly only a small amount of radioactive iodine is present in other tissues and organs. Studies have shown that ingesting small amounts of iodine... 131 When the internal radiation dose of I (10⁵ Bq) to the thyroid gland is several Gy, initially increased thyroid function can be observed, followed by progressively developing hypothyroidism in some individuals. A thyroid radiation dose of 30 Gy can cause permanent hypothyroidism; when the dose reaches 100 Gy (equivalent to 4 GBq), the thyroid structure suffers severe damage, including glandular follicular atrophy, interstitial and vascular fibrosis. However, for... 131 There are currently no drugs that can prevent or treat thyroid cancer caused by inhaled internal radiation. Summary of the Invention

[0003] This invention provides GPC1 for prevention and / or treatment 131 The use of inhaled internal radiation to induce thyroid cancer; GPC1 can be used as... 131 I. Targets for the prevention and treatment of thyroid cancer induced by inhaled internal radiation; development of GPC1-targeted prevention and treatment. 131 I. Inhaled internal radiation-induced thyroid cancer drugs, and used for the clinical prevention and treatment of thyroid cancer.

[0004] This invention provides the use of an agent that inhibits, knocks down, or knocks out GPC1 in the preparation of medicaments for the prevention and / or treatment of thyroid cancer.

[0005] In one specific embodiment of the present invention, the thyroid cancer includes 131 I. Inhaled internal radiation can cause thyroid cancer.

[0006] In one specific embodiment of the present invention, the reagent for knocking down GPC1 includes a lentivirus or adeno-associated virus containing shRNA targeting GPC1.

[0007] In one specific embodiment of the present invention, the nucleotide sequence of the shRNA is shown in SEQ ID No. 1.

[0008] The present invention also provides a method for constructing a lentivirus or adeno-associated virus with GPC1 knockdown, comprising the following steps: designing shRNA target sites based on the transcript of the GPC1 gene and synthesizing primers, annealing them into double-stranded oligo sequences, ligating them into a linearized RNA interference vector, replacing the original ccdB virulence gene, and obtaining the lentivirus or adeno-associated virus with GPC1 knockdown.

[0009] The present invention also provides lentiviruses or adeno-associated viruses constructed using the above-described construction method.

[0010] The present invention also provides a medicament for the prevention and / or treatment of thyroid cancer, the medicament comprising the above-mentioned lentivirus or adeno-associated virus, and pharmaceutically acceptable excipients or carriers.

[0011] In one specific embodiment of the present invention, the preventive and / or therapeutic effects of the drug include at least one of the following: inhibiting the proliferation of thyroid cancer cells, inhibiting the invasion of thyroid cancer cells, inhibiting the occurrence of thyroid cancer, inhibiting the development of thyroid cancer, and inhibiting related phenotypes of thyroid cancer.

[0012] In one specific embodiment of the present invention, the thyroid cancer includes 131 I. Inhaled internal radiation can cause thyroid cancer.

[0013] In one specific embodiment of the present invention, the dosage of the lentivirus or adeno-associated virus is 1.5E+07 TU, based on mouse dosage.

[0014] Beneficial effects: This invention screened GPC1 from the TCGA database, which was significantly positively correlated with poor prognosis of thyroid cancer, and then... 131 I-nebulization assays demonstrated significantly high expression of GPC1 in thyroid tissue, suggesting that GPC1 is involved in... 131I. Thyroid Cancer Development Induced by Inhaled Internal Irradiation. In one embodiment of this invention, GPC1 knockdown was performed on TPC-1 cells. After GPC1 knockdown, the migration and invasion abilities of TPC-1 thyroid cancer cells were significantly inhibited. Subsequently, GPC1 was overexpressed in TPC-1 cells, and GPC1 was replenished in the knockdown TPC-1 cells. It was found that GPC1 overexpression enhanced the migration and invasion abilities of TPC-1 cells, and GPC1 replenishment weakened the inhibitory effect of GPC1 knockdown on TPC-1 migration and invasion. This demonstrates that high GPC1 expression can promote the proliferation, migration, and invasion of thyroid cancer cells. Low GPC1 inhibits the development and progression of thyroid cancer. In one embodiment of this invention, a xenograft experiment in nude mice revealed that the volume and mass of xenografts in the GPC1 knockdown group were significantly smaller and lower than those in the NC group. At the gene level, both Ki67 and PCNA were significantly decreased in the GPC1 knockdown group, suggesting that GPC1 knockdown can significantly inhibit the growth of thyroid cancer xenografts. Therefore, this invention confirms that GPC1 is a good target for inhibiting the development and progression of thyroid cancer. Subsequently, this invention further investigated the use of a GPC1 knockdown lentivirus injected via tail vein into rats. 131 I. Nebulized inhalation for 5 months demonstrated that knocking down GPC1 can alleviate the symptoms caused by 131 I inhalation of toxins causes thyroid structural damage, reduces GPC1 expression in thyroid tissue, and alleviates the symptoms caused by... 131 I. Inhalation-induced thyroid dysfunction. In conclusion, GPC1 deficiency can effectively alleviate... 131 Inhaled internal radiation-induced thyroid cancer-related phenotypes, GPC1 is a key factor in prevention and treatment. 131 I. Effective targets for thyroid cancer induced by inhaled internal radiation. Attached Figure Description

[0015] Figure 1 For GPC1 in 131 Figure 1 shows the results of high expression of I in thyroid tissue after inhalation internal irradiation. Figure A: Database search result; B: HE staining result; C: Immunohistochemical staining result. Figure 2 For GPC1 low expression 131 Image of thyroid cancer-related phenotypes induced by inhaled internal irradiation. In the image, A: H&E staining of paraffin sections of thyroid tissue after GPC1 knockdown; B: Expression of GPC1 in thyroid tissue of the group after tail vein injection of GPC1 knockdown lentivirus; C: Serum FT3 level after exposure; D: Serum FT4 level after exposure; E: Serum TSH level after exposure. Figure 3The figure shows the results of GPC1 knockdown inhibiting the proliferation, migration, and invasion of thyroid cancer cells. In the figure, A: the inhibitory effect of GPC1 knockdown on TPC-1 cell proliferation; B: cell scratch assay; C: Transwell assay; D: Matrigel cell invasion assay. Figure 4 Figure 1 shows the results of GPC1 promoting the proliferation, migration, and invasion of thyroid cancer cells. A: GPC1 expression level in TPC1 cells overexpressing GPC1; B: GPC1 expression level in TPC1 cell lines with stable GPC1 knockdown after GPC1 reintroduction; C: Proliferation of TPC-1 cells overexpressing GPC1; D: Proliferation of TPC-1 cells with GPC1 reintroduction; E: Scratch assay of TPC-1 cells overexpressing GPC1; F: Transwell migration assay of TPC-1 cells overexpressing GPC1; G: Matrigel cell invasion assay of TPC-1 cells overexpressing GPC1; H: Scratch assay of TPC-1 cells with GPC1 reintroduction; I: Transwell migration assay of TPC-1 cells with GPC1 reintroduction; J: Matrigel cell invasion assay of TPC-1 cells with GPC1 reintroduction. Figure 5 The figure shows the results of knocking down GPC1 to inhibit the development and progression of thyroid cancer. In the figure, A: experimental mouse photo; B: tumor photo; C: tumor volume statistics; D: tumor weight statistics; E: immunohistochemical staining to verify Ki67 expression; F: immunohistochemical staining to verify PCNA expression. Detailed Implementation

[0016] This invention provides the use of an agent that inhibits, knocks down, or knocks out GPC1 in the preparation of medicaments for the prevention and / or treatment of thyroid cancer.

[0017] In this invention, GPC1 (Glypican-1) is a proteoglycan located on the cell surface, a glycosylphosphatidylinositol-anchored protein composed of four parts: a secretory signal peptide, an N-terminal core protein, a C-terminal HS chain attachment region, and a GPI anchor point attached to the cell membrane. It primarily participates in intercellular signal transduction. GPC1 can act as a co-receptor for multiple signaling molecules, regulating cell growth, motility, and differentiation through its core protein. Studies have found that GPC1 is abnormally expressed in various tumor tissues and participates in tumorigenesis and development. It promotes tumor cell growth and proliferation by influencing tumor cell adhesion and related signaling pathways. This invention discovers that GPC1... 131 GPC1 is highly expressed in thyroid tissue after inhalation and internal irradiation, and it promotes the proliferation, migration, and invasion of thyroid cancer cells. Knockdown of GPC1 can effectively inhibit the proliferation, migration, and invasion of thyroid cancer cells, thus inhibiting the occurrence and development of thyroid cancer. Furthermore, low GPC1 expression can inhibit… 131The thyroid cancer-associated phenotype induced by inhaled internal radiation suggests that GPC1 can act as a... 131 I. Targets for the prevention and treatment of thyroid cancer induced by inhaled internal radiation; development of GPC1-targeted prevention and treatment. 131 Inhaled irradiation-induced thyroid cancer drugs are of great significance for the prevention and treatment of thyroid cancer in clinical practice.

[0018] The thyroid cancer described in this invention includes 131 I. Inhalation internal irradiation to induce thyroid cancer, wherein the GPC1 knockdown agent comprises a lentivirus or adeno-associated virus containing shRNA targeting GPC1. In one embodiment of the invention, the nucleotide sequence of the shRNA is as shown in SEQ ID No. 1: GGACACTGTGCAGTGAGAA.

[0019] This invention also provides a method for constructing a GPC1-knockdown lentivirus or adeno-associated virus, comprising the following steps: designing an shRNA target based on the GPC1 gene transcript and synthesizing primers, annealing them into double-stranded oligo sequences, ligating them into a linearized RNA interference vector, replacing the original ccdB virulence gene, to obtain the GPC1-knockdown lentivirus or adeno-associated virus. After replacing the original virulence gene, this invention further includes colony PCR screening of transformants, and sequencing verification of the screened positive clones. Clones that have been correctly sequenced are then subjected to high-purity plasmid extraction.

[0020] The present invention also provides lentiviruses or adeno-associated viruses constructed using the above-described construction method.

[0021] The present invention also provides a medicament for the prevention and / or treatment of thyroid cancer, the medicament comprising the above-mentioned lentivirus or adeno-associated virus, and pharmaceutically acceptable excipients or carriers.

[0022] The preventive and / or therapeutic effects of the drug described in this invention include at least one of the following: inhibiting the proliferation of thyroid cancer cells, inhibiting the invasion of thyroid cancer cells, inhibiting the occurrence of thyroid cancer, inhibiting the development of thyroid cancer, and inhibiting related phenotypes of thyroid cancer. The thyroid cancer described in this invention includes... 131 I. Inhalation and internal irradiation induce thyroid cancer. Based on mouse dosage, the titer of the lentivirus or adeno-associated virus described in this invention is 3.10 ± 0.8 TU / ml, and the dosage is 1.5 ± 0.7 TU.

[0023] To further illustrate the present invention, the following examples demonstrate the application of GPC1 provided by the present invention in prevention and / or treatment. 131 The use of inhaled internal radiation to induce thyroid cancer is described in detail, but should not be construed as limiting the scope of protection of this invention.

[0024] Unless otherwise specified, the materials used in the embodiments of the present invention are all derived from conventional commercially available products in the art.

[0025] 1. Lentiviral Construction: Based on general principles and experience in shRNA design, shRNA targets were designed, primers were synthesized, and double-stranded fragments with sticky ends were formed by annealing. The expression vector pSLenti-U6-shRNA-CMV-EGFP-F2A-Puro-WPRE (source: Heyuan Biotechnology (Shanghai) Co., Ltd.; vector number: GL427) was digested with restriction endonucleases Age I and BamHI, and the DNA was recovered using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0. The double-stranded fragment with sticky ends was ligated to the linearized vector fragment and transformed into DH5α competent cells. After colony PCR verification, positive clones were selected and sent to a sequencing company for sequencing verification. The sequencing results were compared and analyzed using Vector NTI software. Plasmid mini-prep was then performed on the positive clones that were verified by sequencing.

[0026] Target sequence (SEQ ID No. 2): GGACACTGTGCAGTGAGAA; Primer sequences for shRNA synthesis: Pre-primer (SEQ ID No. 3): CcggGGACACTGTGCAGTGAGAATTCAAGAGATTCTCACTGCACAGTGTCCTTTTTTg; Back primer (SEQ ID No. 4): gatccaaaaaaGGACACTGTGCAGTGAGAATCTCTTGAATTCTCACTGCACAGTGTCC; Primers for colony verification: Pre-primer (SEQ ID No. 5): TACGATACAAGGCTGTTAGAGAG; Back primer (SEQ ID No. 6): TGTACTGGGCATAATGCCAGGC.

[0027] 2. The TPC-1 cell line was purchased from Wuhan Pronosei Co., Ltd. The method for knocking down GPC1 in this TPC1 cell line is as follows: (1) Disinfect the cell operation laminar flow 30 minutes in advance with ultraviolet irradiation, and place the cell culture medium (DMEM, fetal bovine serum, penicillin-streptomycin) at room temperature for 30 minutes. Wear sterile lab coats and clean gloves, and prepare 75% medical alcohol.

[0028] (2) First, perform cell plating, and then seed the infected cells into a 100 mm cell culture dish.

[0029] (3) On the second day, after the cells grew to 60-70%, the cells were washed twice with 1×PBS, and the culture medium was changed for lentiviral infection. The culture medium for infection was as follows: 5 mL complete culture medium + 20 μL shGPC1 virus solution + 5 μL polybrene, and mixed thoroughly. The control group was given 20 μL shNC virus solution.

[0030] (4) The cells were placed in a cell culture incubator at 37°C and 5% CO2 for 24 h.

[0031] (5) Discard the cell culture medium and replace it with a stable knockdown cell line for screening. The culture medium formula for screening is as follows: 4.5 mL basal medium + 10% fetal bovine serum (500 mL) + 2 mg / mL puromycin.

[0032] (6) The cells were placed in a cell culture incubator at 37°C and 5% CO2 for further culture. At this time, the cells that had not been knocked down began to die. After about one week of continuous passage and screening, the cells were basically in a stable state of knocked down GPC1.

[0033] (7) Collect cells and detect the mRNA and protein expression of GPC1 by qRT-PCR and Western blot to determine the knockdown efficiency of GPC1 in TPC-1 cells.

[0034] Method for replenishing GPC1: (1) After passage treatment, cells are grown to about 60% in a 60 mm cell culture dish; (2) Preparation of reagents and consumables before operation (taking GPC1 overexpression plasmid transfection as an example): lipo3000 transfection reagent; GPC1 overexpression (OE-GPC1) plasmid and pcDNA3.1 control plasmid, ready for use at 4℃, can be stored for a long time at -20℃; DMEM; 1.5mL sterile enzyme-free EP tube; (3) Specific transfection operation (the amount of reagents used is taken as an example of transfecting GPC1 overexpression plasmid into TPC-1 cells in a 60 mm cell culture dish): 3 μg of plasmid (5 μg of plasmid for transfection in a 100 mm cell culture dish), 5 μL of lipo3000; take 4 1.5 mL EP tubes, add 500 μL of DMEM to each tube, then add 5 μL of lipo3000 reagent to two of the tubes; add 5 μL of P3000 to each of the other two tubes, then add 3 μg of GPC1 overexpression plasmid to one tube, and add 4 μg of control plasmid to the remaining tube, and incubate at room temperature for 3 minutes. (4) Mix one tube containing lipo3000 with another tube containing plasmid and P3000, and incubate at room temperature for 20 minutes (the entire transfection process should not exceed 40 minutes). (5) During incubation, each 60 mm cell culture dish was washed with 1 mL of 1×PBS and then 1 mL of DMEM medium was added. (6) Add the plasmid-lipo3000-P3000 mix, which has been incubated for 20 minutes, along the wall of the dish to a 60 mm cell culture dish. At this point, the cell culture dish contains 2 mL of culture medium. Place the culture dish in a cell culture incubator at 37°C and 5% CO2 for further incubation. (7) After culturing for 4 h, discard the culture medium containing lipo3000, P3000 and plasmid mix in the culture dish, and replace it with complete culture medium to continue culturing; (8) After 48 h, qRT-PCR was used to detect the expression of GPC1 mRNA in cells to determine the transfection efficiency.

[0035] 3. CCK-8 detection: (1) Transfected TPC-1 cells were seeded at a density of 3000 cells / well in 96-well plates and cultured at 37°C in a 5% CO2 cell culture incubator for 0h, 24h, 48h, 72h and 96h.

[0036] (2) Turn on the SpectraMax i3x multi-functional microplate reader and preheat at 37°C for 30 minutes.

[0037] (3) Prepare the CCK-8 detection working solution by mixing 1 part of CCK-8 stock solution with 8 parts of culture medium.

[0038] (4) Take the 96-well plate out of the incubator, use a pipette to remove the old culture medium, and then add the prepared CCK-8 detection working solution to the test wells of the 96-well plate at a volume of 200 μl per well. Then place it in a multi-functional microplate reader and incubate at 37°C for 2 hours.

[0039] (5) After incubation, the absorbance at 450 nm is measured. The absorbance values ​​need to be measured at 0h, 24h, 48h, 72h and 96h after transfection.

[0040] (6) After the experiment, the raw data were exported and statistical graphing and difference analysis were completed using GraphPad Prism software and IBM SPSS 20.0 software.

[0041] 4. HE staining: (1) Dry rat thyroid tissue at 60℃, embed it in paraffin, and cut it into sections. It takes about 30 minutes.

[0042] (2) Place the sections in xylene, anhydrous ethanol, 90% ethanol, 80% ethanol and 70% ethanol in sequence for dewaxing and hydration for 5 minutes, and rinse the sections with water 3 times (30 seconds each time).

[0043] (3) After removing the oxide film on the liquid surface with hematoxylin, stain with hematoxylin for 5 minutes (freshly prepared hematoxylin can reduce the staining time), and rinse the section with water 5 times.

[0044] (4) Place the section in 1% hydrochloric acid alcohol for 5 seconds (to wash away excess staining), and rinse the section with water 3 times.

[0045] (5) Place the slide in eosin for 1 minute (freshly prepared eosin can reduce the staining time), and rinse the slide with water 3 times.

[0046] (6) After placing the slices in 70% ethanol, 80% ethanol, 90% ethanol and anhydrous ethanol in sequence, dehydrate them in xylene for 2 minutes and air dry at room temperature.

[0047] (7) Neutral resin sealing.

[0048] (8) Use a slide scanner to scan the slides, observe the overall morphology of the thyroid tissue slides and the structure of thyroid follicles, and score the degree of thyroid damage (following the random double-blind principle).

[0049] 5. Immunohistochemical staining: (1) Baking the slide, dewaxing and hydrating it, and then staining with HE.

[0050] (2) Place the slides in pH 8.0 EDTA retrieval solution, microwave on high for 10 minutes to retrieve the antigen, cool the slides at room temperature, and rinse with water 3 times.

[0051] (3) The slices were rinsed three times in 1×PBS buffer (5 minutes each time).

[0052] (4) Place the sections in a humidified chamber, add primary antibody (rabbit anti-GPC1:1:200) to cover the tissue, and incubate overnight at 4°C.

[0053] (5) After warming at 37°C for 30 minutes, the slides were rinsed three times in 1×PBS buffer (5 minutes each time).

[0054] (6) Add secondary antibody (select goat anti-rabbit IgG polymer according to the resistance of primary antibody) to cover tissue and incubate at 37°C for 30 minutes.

[0055] (7) The slices were rinsed three times in 1×PBS buffer (5 minutes each time).

[0056] (8) Using DAB chromogenic solution, observe the color development under a microscope to determine that the color development time for GPC1 in this study is 2 minutes. After rinsing with water to stop the color development, rinse the sections with water 3 times.

[0057] (9) Remove the oxide film on the liquid surface with hematoxylin, stain with hematoxylin for 5 minutes, and rinse the section with water 5 times.

[0058] Place the sections in 1% hydrochloric acid alcohol for 5 seconds to differentiate, and then rinse the sections 3 times with water.

[0059] (10) After placing the slices in 70% ethanol, 80% ethanol, 90% ethanol and anhydrous ethanol in sequence, dehydrate them in xylene for 2 minutes and air dry at room temperature.

[0060] (11) Neutral resin sealing.

[0061] (12) After the slides have dried, scan the slides with a slide scanner and use ImageJ software to quantify protein expression.

[0062] 6. Cell scratch test: (1) Use a marker and a ruler to draw a horizontal line at 1cm intervals on the bottom of the 6-well plate. About 3 lines are sufficient. The intersection of the vertical lines in the horizontal lines is used as the positioning point for taking pictures and marking the positioning.

[0063] (2) Digest the cells and seed them into a 6-well plate. Incubate the plate in a CO2 incubator. When the cell density increases to about 90%, use a 200 μL Tip to make a vertical scratch from top to bottom along the center line of each well, perpendicular to the horizontal line. After scratching, gently wash the cells three times with PBS.

[0064] (3) Discard the PBS and replace each well with a culture medium containing 2% FBS at a volume of 2 ml. Take pictures under a microscope according to the marked positioning points. Take 6-8 pictures for each well and record them as the 0h scratch results.

[0065] (4) After taking photos at 0h, place the cells in a CO2 incubator and continue culturing for 24 hours.

[0066] (5) Remove the cells and wash them gently three times with PBS. Take another photo at the same location as the one taken at 0 hours, and record it as the 24-hour scratch result.

[0067] (6) Use ImageJ software to measure the scratch widths (W1 and W2) at the same location points 0h and 24h, and calculate the cell migration rate according to the formula (W1-W2) / W1. Use GraphPad Prism software and IBM SPSS .20.0 software to complete the statistical plotting and differential analysis.

[0068] 7. Transwell migration experiment: (1) Place the transfected cells in a CO2 incubator and continue culturing for 24 hours.

[0069] (2) Take a Transwell chamber, add 50 μL of serum-free culture medium to it, incubate at 37°C for 30 minutes to hydrate the basement membrane, then take out the chamber and aspirate the excess liquid.

[0070] (3) Remove the cells, wash them twice with PBS to remove the influence of serum, digest them with trypsin, centrifuge them, then resuspend them in 2% fetal bovine serum medium and count them using a bovine cell counting plate.

[0071] (4) Prepare cell suspension and adjust cell density to 50,000 cells / mL. Add 700 μl of culture medium containing 10% fetal bovine serum to the lower chamber of the Transwell chamber and 200 μl of cell suspension to the upper chamber. Spread the cells evenly and let them stand for 10-20 minutes. Then place them stably in a 5% CO2 37℃ incubator and continue culturing for 24 hours.

[0072] (5) Remove the chamber, discard the culture medium, wash the chamber 3 times with PBS, shake dry, fix with 4% paraformaldehyde for 30 minutes, stain with 1% crystal violet staining solution for 20 minutes, wash away the residual crystal violet in the chamber with ddH2O, and carefully wipe the excess cells in the microporous membrane of the upper chamber with a wet cotton swab.

[0073] (6) Add a drop of ddH2O to a glass slide, then place the prepared chamber upright on the droplet and take a picture with an Axiocam 208 color microscope. Take three different fields of view for each group. Use GraphPad Prism software and IBM SPSS .20.0 software to complete the subsequent statistical plotting and difference analysis.

[0074] 8. Matrigel cell invasion experiment: (1) Take Matrigel matrix gel out of the -20℃ freezer in advance and place it in the 4℃ freezer overnight to melt it from solid to liquid.

[0075] (2) Transfect cells and place the transfected cells in a CO2 incubator for 24 hours.

[0076] (3) First, pre-cool the culture medium, pipette tips, Transwell chambers, and centrifuge tubes. Prepare a box of wet ice and place the centrifuge tubes in the wet ice. Dilute the matrix gel with the pre-cooled culture medium at a ratio of 1:8 to prepare the working solution (calculated at 50 μL / chamber in this study).

[0077] (4) Place the pre-cooled chamber stably in the 24-well plate on the wet ice surface, add 50 μL of working fluid to the upper chamber of the chamber, spread it evenly in the wells to prevent air bubbles from forming, and gently shake the 24-well plate to allow the working fluid to completely coat the upper chamber.

[0078] (5) After completing the well laying, place the 24-well plate and chambers in an incubator at 37°C for 2 hours.

[0079] (6) Take out the coated chamber, gently rotate the chamber to observe the state of the working solution, and after it is completely solidified, complete the subsequent basement membrane hydration, cell plating, photography and statistical analysis according to the Transwell cell migration experiment steps 2 to 6.

[0080] 9. Nude mouse xenograft tumor experiment: (1) Four-week-old male BALB / c-nu mice were purchased from Spaford Company, acclimatized for 1 week, and randomly divided into experimental group and knockdown group.

[0081] (2) Take the matrigel matrix gel out of the -20℃ freezer in advance and place it in the 4℃ freezer overnight to melt it from solid to liquid state. At the same time, pre-cool the serum-free DMEM.

[0082] (3) TPC-1 cells with stable GPC1 knockdown were plated and, when the cells reached a density of about 90%, were digested with trypsin, centrifuged, and resuspended in serum-free DMEM. The cells were counted using a bovine cell counter. The cells were then centrifuged again.

[0083] (4) Prepare a wet ice environment. Dilute pre-cooled DMEM and matrix gel at a 1:1 ratio to prepare working solution (calculated based on 200µL volume per nude mouse). Centrifuge the cells again, discard the serum-free culture medium, and resuspend the cell pellet in the working solution to prepare a single-cell suspension (cell concentration approximately 4×10⁻⁶). 7 (single cells / mL) Use a 1mL syringe to draw the prepared single-cell suspension and place it on ice for later use.

[0084] (5) Fix the nude mouse, wipe the injection site with an alcohol swab, select the back of the hind limb for subcutaneous injection, insert the needle and aspirate the syringe until there is no blood flow, slowly and evenly inject 200µL of cell suspension (8×106 cells) into the subcutaneous tissue, rotate the needle out, and press the injection site with an alcohol swab for 10-15 seconds.

[0085] (6) Continuously observe and monitor tumor growth. The day of inoculation is considered day 0 of subcutaneous tumor formation. The longest and shortest diameters of the tumor are measured every 3 days using calipers. Mice are sacrificed after 30 days, and tumor tissue is dissected and removed. The tumor is photographed, and the final longest diameter (L) and shortest diameter (W) are measured using calipers. The tumor volume (V) is calculated using the formula V = (L × W). 2 The tumor mass was calculated as 1 / 2, and the tumor mass was weighed using an electronic balance. Finally, it was fixed with 4% paraformaldehyde, and the sections were embedded in paraffin for subsequent experiments.

[0086] Example 1, GPC1 in 131 High expression of I inhaled internal irradiation in thyroid tissue GPC1 was found to be significantly positively correlated with poor prognosis in the TCGA database (http: / / gepia.cancer-pku.cn / ). Figure 1 (A), and rats were subjected to 9.25 MBq and 18.5 MBq. 131 Five months after nebulized inhalation, H&E staining of paraffin sections of thyroid tissue showed that: thyroid follicular epithelial cells were damaged, with disordered nuclear arrangement, disruption of follicular structural integrity, uneven staining within the follicles, inflammatory cell infiltration, and nodule formation in some areas. Figure 1 (B); Immunohistochemical staining results showed that GPC1 was significantly highly expressed in thyroid tissue (B). Figure 1 (C). This suggests that GPC1 may have been involved. 131 I inhaled internal radiation can lead to the development and progression of thyroid cancer.

[0087] Example 2: Low GPC1 expression can inhibit 131 I inhaled internal radiation-induced thyroid cancer-related phenotypes To study GPC1 in 131 The effect of inhaled internal irradiation on the development and progression of thyroid cancer was investigated by administering a lentivirus with GPC1 knockdown (lentivirus titer: 3.10E+08 TU / ml; dosage: 1.5E+07 TU per rat) via tail vein injection to rats, followed by treatment with 0.925 MBq. 131 Five months after iodine-131 inhalation, H&E staining of paraffin sections of thyroid tissue showed that the thyroid follicular epithelial cells in the toxic group were damaged, with disordered nuclear arrangement, destruction of follicular structural integrity, uneven staining within the follicles, inflammatory cell infiltration, and nodule formation in some cases; while knockdown of GPC1 could alleviate the thyroid structural damage caused by iodine-131 inhalation. Figure 2 (A); Immunohistochemical staining results showed that GPC1 was significantly highly expressed in the thyroid tissue of the virus-treated group, while GPC1 expression in the thyroid tissue decreased after tail vein injection of GPC1 knockdown lentivirus. Figure 2 (B). Furthermore, serological thyroid function tests showed that serum FT3 (B) levels were elevated after exposure to the drug. Figure 2 (C) FT4 Figure 2 The content of D in the middle decreases, and the level of TSH increases. Figure 2 (E); while knocking down GPC1 can alleviate the problem caused by... 131 I. Inhalation-induced thyroid dysfunction. The above results suggest that GPC1 deficiency can effectively alleviate... 131 Inhaled internal radiation-induced thyroid cancer-related phenotypes, GPC1 is a key factor in prevention and treatment. 131 I. Effective targets for thyroid cancer induced by inhaled internal radiation.

[0088] Example 3: Knockdown of GPC1 inhibits the proliferation, migration, and invasion of thyroid cancer cells. To clarify the role and mechanism of GPC1 in the development and progression of thyroid cancer, CCK-8 assay results showed that knockdown of GPC1 significantly inhibited the proliferation of TPC-1 cells. Figure 3 (A). To further investigate the role of GPC1 in the proliferation, migration, and invasion of thyroid cancer cells, cell scratch assays and Transwell assays were used to evaluate its effect on the migration ability of thyroid cancer cells. The results showed that GPC1 knockdown significantly inhibited the migration ability of TPC-1 thyroid cancer cells. Figure 3 (B and C). The Matrigel cell invasion assay was used to assess the effect of GPC1 on the invasive ability of thyroid cancer cells. The results showed that knocking down GPC1 also significantly inhibited the invasion of TPC-1 thyroid cancer cells (B and C). Figure 3 (D).

[0089] Example 4: GPC1 promotes the proliferation, migration, and invasion of thyroid cancer cells. To further investigate the function of GPC1, GPC1 was overexpressed in TPC1 cells and TPC1 cell lines with stable GPC1 knockdown. Figure 4 (A and B), CCK-8 results indicated that overexpression of GPC1 could promote the proliferation of TPC-1 cells ( Figure 4 (C), while GPC1 replenishment can alleviate the inhibitory effect of GPC1 knockdown on TPC-1 cell proliferation ( Figure 4 Both the cell scratch assay and the Transwell migration assay indicated that overexpression of GPC1 enhanced the migration ability of TPC-1 cells. Figure 4 (E and F), while GPC1 reuptake can also weaken the inhibitory effect of GPC1 knockdown on TPC-1 cell migration ( Figure 4 (H and I); Matrigel cell invasion assays also showed that overexpression of GPC1 enhanced the invasive ability of TPC-1 (H and I); Figure 4 (G), while replenishing GPC1 can also weaken the inhibitory effect of knocking down GPC1 on TPC-1 invasion (GPC). Figure 4 (J). The above results indicate that high expression of GPC1 can promote the proliferation, migration, and invasion of thyroid cancer cells.

[0090] Example 5: Knockdown of GPC1 inhibits the development and progression of thyroid cancer To investigate the role of GPC1 in the development of thyroid cancer, a xenograft experiment was conducted in nude mice. The results showed that the xenograft volume in the GPC1 knockdown group was significantly smaller than that in the NC group. Figure 5 (AC), quality significantly reduced ( Figure 5 (D); Simultaneously, immunohistochemical staining was performed on paraffin sections of xenograft tumor samples to further detect the expression levels of tumor proliferation-related genes Ki67 and PCNA in xenograft tumors. The results showed that Ki67 ( Figure 5 China (E) and PCNA ( Figure 5 The levels of α-fructose (F) were significantly decreased in the GPC1 knockdown group, suggesting that GPC1 knockdown can significantly inhibit the growth of thyroid cancer xenografts. These results indicate that GPC1 is a promising target for inhibiting the development and progression of thyroid cancer.

[0091] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The use of an agent that inhibits, knocks down, or knocks out GPC1 in the preparation of medicaments for the prevention and / or treatment of thyroid cancer.

2. The application according to claim 1, characterized in that, The thyroid cancer includes 131 I. Inhaled internal radiation can cause thyroid cancer.

3. The application according to claim 1, characterized in that, The reagents used to knock down GPC1 include lentiviruses or adeno-associated viruses containing shRNA that targets GPC1.

4. The application according to claim 3, characterized in that, The nucleotide sequence of the shRNA is shown in SEQ ID No.

1.

5. A method for constructing a lentivirus or adeno-associated virus with GPC1 knockdown, characterized in that, Includes the following steps: Based on the transcript of the GPC1 gene, shRNA targets were designed and primers were synthesized, annealed into double-stranded oligo sequences, and ligated into a linearized RNA interference vector to replace the original ccdB toxic gene, thus obtaining the lentivirus or adeno-associated virus that knocks down GPC1.

6. Lentiviral virus or adeno-associated virus constructed using the construction method of claim 5.

7. A drug for the prevention and / or treatment of thyroid cancer, characterized in that, The drug comprises the lentivirus or adeno-associated virus of claim 6, and pharmaceutically acceptable excipients or carriers.

8. The drug according to claim 7, characterized in that, The preventive and / or therapeutic effects of the drug include at least one of the following: inhibiting the proliferation of thyroid cancer cells, inhibiting the invasion of thyroid cancer cells, inhibiting the occurrence of thyroid cancer, inhibiting the development of thyroid cancer, and inhibiting related phenotypes of thyroid cancer.

9. The drug according to claim 7, characterized in that, The thyroid cancer includes 131 I. Inhaled internal radiation can cause thyroid cancer.

10. The drug according to claim 9, characterized in that, The dosage of the lentivirus or adeno-associated virus in mice is 1.5E+07 TU.

Images