SNP site related to pollen collecting ability of honeybee and application thereof
By identifying the SNP site at position 7704262 on chromosome 5 of honeybees and combining KASP primers, the problem of honeybee pollen collection ability was solved, enabling the selection of superior traits and improvement of production performance in honeybee populations.
Patent Information
- Application Number
- CN202411955185.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-27
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2044-12-27
AI Technical Summary
Existing technologies make it difficult to effectively utilize molecular markers to select for superior pollen-collecting traits in bees, thus affecting the productivity of bee populations.
This invention provides an SNP locus located at position 7704262 on chromosome 5 of honeybees, along with its associated KASP primer combination and kit, for identifying the tarsal width trait in honeybees. Polymorphism is detected by PCR amplification and gene sequencing, and honeybee individuals with longer tarsal widths are screened out.
By screening and identifying bee individuals with longer tarsal widths, we can improve the pollen collection efficiency and ecological adaptability of bees, thereby enhancing pollen production efficiency in beekeeping.
Smart Images

Figure CN119955943B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of animal breeding technology, and in particular to a SNP locus related to the pollen-collecting ability of bees and its application. Background Technology
[0002] Chinese honeybee ( Apis cerana Honeybees (also known as Apis cerana) have developed rich local resource types (ecotypes) in diverse geographical environments, exhibiting different morphological characteristics, biological properties, and production performance. Honeybee production performance is related to many factors, such as environmental conditions, nectar source plant types, husbandry management, diseases and natural enemies, and genetic factors. Various genetic characteristics of a bee colony affect its production performance, including honey yield, disease resistance, and foraging ability; superior bee colonies often have higher productivity.
[0003] Molecular markers are an effective tool for bee population improvement, helping to select for desirable traits. Tarsus width is an important morphological trait in bees, a key indicator of their hind legs, and it influences their crawling ability and pollen-collecting capacity. Developing molecular markers related to tarsus width is beneficial for breeding high-quality bee species. Summary of the Invention
[0004] To address the problems existing in the prior art, this invention provides a SNP locus related to the pollen-collecting ability of bees and its application.
[0005] In a first aspect, the present invention provides a SNP site based on genome version PRJNA738447, wherein the SNP site is located at position 7704262 on chromosome 5 of honeybee and has a polymorphism of A / G.
[0006] Furthermore, the SNP site includes the nucleotide sequence shown in SEQ ID NO.1, with a polymorphism at position 173, which is A / G.
[0007] The nucleotide sequence shown in SEQ ID NO.1 is as follows:
[0008] AGGTGCGAAGGAAAATATGCATCATTCGCTGAAAATTCTATTATTTAAAAACTTTAATCCGAACAACTGTTTAACTTGATCCTTGATCCTTTGCAGTTATAATTGGATATAATCTTACGTATCATCAACGACACGCGAACCATAAAAGTAATTATGATTAATTAAAATC GTTACACGATGGATTCGAAATCGGTATAATCGATATTCCGGTCAGGTTAAATGATCCGCGACAATCCGAATCATTCAACTAGGGAACCTTTTCACGTGAGATATCAAGTCCAATCAATTTTATTATATCGGCCAGTTGTAAAATTTAATTCCTAACCGAATTCCAGCCG.
[0009] Secondly, the present invention provides a KASP primer combination for amplifying the aforementioned SNP sites; the KASP primer combination comprises:
[0010] F1: AGTAATTATGATTAATTAAAATCGTTA,
[0011] F2: AGTAATTATGATTAATTAAAACGTTG,
[0012] R:ACCGATTTCGAATCCATCGT.
[0013] The sequences of the primers above are from 5' to 3'.
[0014] Furthermore, F1 and F2 each carry different fluorescent markers, which include one or more of the following: FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC, or Texas Red.
[0015] For example, F1 connects to GAAGGTGACCAAGTTCATGCT (FAM) at 5', and F2 connects to GAAGGTCGGAGTCAACGGATT (HEX) at 5'.
[0016] Thirdly, the present invention provides a kit comprising the aforementioned SNP sites or the aforementioned KASP primer combination.
[0017] Fourthly, the present invention provides the application of the aforementioned SNP sites, or the aforementioned KASP primer combinations, or the aforementioned kits in identifying the tarsal width trait of bees.
[0018] The present invention further provides the application of the aforementioned SNP sites, or the aforementioned KASP primer combinations, or the aforementioned kits in any of the following:
[0019] i) Breed bees with high crawling efficiency or pollen-collecting ability;
[0020] ii) Improvement of the crawling efficiency or pollen-collecting ability of bee germplasm resources;
[0021] iii) Molecular marker-assisted breeding of bees.
[0022] Furthermore, the bee is an Oriental honeybee, preferably a Chinese honeybee.
[0023] Fourthly, the present invention provides a method for identifying the tarsal width of bees, comprising:
[0024] For the test bees, the polymorphism of the aforementioned SNP sites is detected, and the tarsal width trait of the test bees is determined based on the detection results.
[0025] Furthermore, PCR amplification was performed using the aforementioned KASP primer combination, and gene sequencing was used to detect polymorphisms at the aforementioned SNP sites.
[0026] Furthermore, the determination of the tarsal width trait of the bee under test based on the test results includes:
[0027] For the bees to be tested, those with a polymorphism detection result of A / A at the aforementioned SNP sites have a longer tarsal width compared to those with a detection result of A / G.
[0028] Technicians know that a wider tarsus means that bees can form a larger pollen basket structure on the tarsus, allowing them to carry a larger amount of pollen in a single collection, thus improving the bees' pollen collection efficiency, enhancing their ecological adaptability, and increasing pollen production efficiency in beekeeping.
[0029] Further, with a total volume of 25 μL, the PCR amplification system includes:
[0030] Template DNA 1-2 μL, upstream primer 1-2 μL, downstream primer 1-2 μL, Dntp mix 1-2 μL, 10×Taq Buffer 2-4 μL, Taq enzyme 0.2-0.4 μL, the remainder is water.
[0031] The PCR amplification procedure includes:
[0032] Pre-denaturation at 95℃ for 5-10 minutes;
[0033] The process involves denaturation at 92-96℃ for 30-60 seconds, annealing at 62-65℃ for 30-60 seconds, and extension at 70-74℃ for 30-60 seconds, repeated 10-15 times, with the annealing temperature decreasing by 0.4-0.6℃ each time.
[0034] Denaturation at 93~96℃ for 30~60s, annealing at 56~60℃ for 30~60s, extension at 70~74℃ for 30~60s, cycle 25~35 times;
[0035] Repair and extend the treatment at 70~74℃ for 10~15 minutes.
[0036] The present invention has the following beneficial effects:
[0037] This invention identifies a SNP locus associated with tarsal width in honeybees. Experimental results show that honeybees with the A / A polymorphism at this SNP locus have a longer tarsal width compared to those with the A / G polymorphism. Therefore, this SNP locus can be used to breed honeybees with superior traits, such as those with high crawling ability or pollen-collecting ability, and has significant application value. Attached Figure Description
[0038] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0039] Figure 1 This is the statistical and genotyping result of tarsal width traits of 107 honeybee samples provided in Embodiment 2 of the present invention.
[0040] Figure 2 The amplification results are those of the primer pair provided in Example 3 of this invention; the left band is the marker, and the three right bands are the amplification products. Detailed Implementation
[0041] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.
[0042] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.
[0043] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.
[0044] Example 1
[0045] This invention obtains a SNP locus associated with tarsal width through bee trait and genome association analysis, specifically including the following process:
[0046] 1. This invention is based on a sample of 110 colonies of Chinese honeybees, measuring the tarsal width. Genomic DNA was extracted from the thoracic tissue of worker bees after dissection, and then library construction was performed using the Trussq Nano DNA HT kit (Illumina, USA). The DNA was randomly fragmented into 350bp fragments, and after end repair, addition of polyA tails, addition of sequencing adapters, amplification, and purification, a DNA library was obtained. The insert size of the library was quality checked using an Agilent 2100, and the effective concentration of the library was accurately quantified using qPCR. Once the quality met the standards, the DNA library construction was complete.
[0047] 2. Genome Sequencing, Alignment, and SNP Identification: After successful library construction, genome sequencing was performed on the Illumina Hiseq PE150 platform (Illumina, USA). Low-quality reads were removed during sequencing to ensure result quality (quality control standards: reads containing more than 10% unknown nucleotides, reads containing adapter sequences, and reads with low-quality (phred quality < 5) bases exceeding 50% of their length were removed). Finally, each bee sample generated over 4.5G of high-quality, clean reads with paired ends, with Q20 and Q30 values exceeding 90% and 85%, respectively.
[0048] 3. The high-quality paired-end clean reads obtained were aligned to the reference genome using BWA 0.7.8 software. Apis cerana (Genbank accession number: PRJNA738447). The alignment results were deduplicated using SAMTOOLS 1.15 software, and the average alignment rate of the population samples was guaranteed to be above 95%, with an average sequencing depth of over 20X for the genome.
[0049] 4. SNPs were detected using a Bayesian model in SAMTOOLS 1.15 software. High-quality SNPs were selected based on quality control criteria (deleting SNPs with a sequencing error rate >1% (Q20 quality control), deleting SNPs with a gap of <5 bases between adjacent SNP sites, and deleting SNPs with a coverage depth exceeding 1 / 3 to 5 times the average depth). The detected SNPs were annotated using ANNOVAR 20130520 software, identifying exon regions, intron regions, alternative splicing sites, upstream and downstream gene regions, and intergenic regions, and distinguishing between synonymous and non-synonymous SNPs.
[0050] 5. Genome-wide association studies (GWAS): Genome-wide association studies (GWAS) were conducted using mrMLM 1.3 software to clarify the association between the tarsal width trait and SNP loci. The quality control standard for SNPs was based on MAF > 5%, and a multi-locus randomized mixed linear model was selected.
[0051] Table 1. Association between the tarsus width phenotype in honeybees and SNPs.
[0052]
[0053] Based on the above steps, the present invention screened and obtained SNP sites (as shown in Table 1). These SNP sites are related to the physicochemical traits (tarsal width) of bees. After experimental verification, one of them is closely related to the tarsal width trait of bees. This SNP site (Chr5_7704262) is located at position 7704262 on chromosome 5 of bees, and the polymorphism is A / G.
[0054] Example 2
[0055] This invention selected 107 samples of Chinese honeybees for verification work, verifying the association between SNP sites and tarsal width traits involved in Example 1. The tarsal width of 107 worker honeybees was measured using a microscopic measurement system, and the whole genome of these 107 Chinese honeybees was sequenced, obtaining tarsal width data and SNP data of 107 honeybees.
[0056] The data obtained above were grouped according to the genotype at the SNP loci. SPSS 16.0 software was used to perform a significance analysis on the tarsal width data of different groups to compare whether there are differences in tarsal width among different genotypes.
[0057] The results showed that among the 107 bees, 47 exhibited the A / A genotype, 49 exhibited the A / G genotype, and 11 exhibited the G / G genotype. LSD data analysis yielded the following table and... Figure 1 The results shown are as follows:
[0058] from Figure 1 It can be seen that there is a significant difference between the A / A genotype and the A / G genotype (P<0.05), with the tarsal width of bees in the A / A genotype being significantly longer than that in the A / G genotype.
[0059] As can also be seen from Table 2, genotype 1 (A / A) exhibits a longer tarsal width compared to genotype 2 (A / G), with a significant p < 0.05.
[0060] Table 2. Comparison of tarsal width among individuals with different genotypes at the Chr5_7704262 locus in Apis cerana.
[0061]
[0062] * express P <0.05, the difference is significant.
[0063] Example 3
[0064] This invention further verifies the effect of the SNP sites involved in Example 1 on three samples of honeybees, specifically including:
[0065] 1. Primer pairs are as follows:
[0066] Upstream primer: 5'-AGGTGCGAAGGAAAATATGC-3',
[0067] Downstream primer: 5'-CGGCTGGAATTCGGTTAG-3'.
[0068] 2. The PCR system is as follows:
[0069] Table 3 PCR System
[0070]
[0071] The PCR procedure is as follows:
[0072] Table 4 PCR Procedure
[0073]
[0074] 3. Test Results
[0075] The results are as follows Figure 2 As shown in the results, the electrophoretic bands of the amplified DNA fragments are clear and bright, without any impurities, indicating that the primers, amplification system, and program are highly specific.
[0076] Based on this amplified product, the polymorphism of its nucleotide sequence at position 173 can be detected using gene sequencing. If the result is A / G, it indicates that it possesses a shorter tarsal width trait, shorter than that of the Chinese honeybee with a result of A / A. Based on this method, the present invention can be used to breed honeybees with a longer tarsal width trait, for example, by performing genotyping during breeding and retaining bee colonies with a result of A / G at the Chr5_7704262 locus.
[0077] 4. The present invention further provides a KASP primer combination for amplifying the above-mentioned SNP sites, comprising:
[0078] F1: GAAGGTGACCAAGTTCATGCTagtaattatgattaattaaaatcgttA,
[0079] F2:GAAGGTCGGAGTCAACGGATTagtaattatgattaattaaaatcgttG,
[0080] R: accgatttcgaatccatcgt.
[0081] F1 carries FAM and F2 carries HEX. In practice, this KASP primer combination can be used to detect the sample to be tested. At the same time, it can be detected by existing fluorescence equipment. The genotype of the sample to be tested can be determined by the detection results of the FAM and HEX fluorescence channels: G / G (HEX fluorescence signal exceeds the threshold), A / G (both FAM and HEX fluorescence signals exceed the threshold), or A / A (FAM fluorescence signal exceeds the threshold).
[0082] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. Application of SNP sites, KASP primer combinations, or kits in identifying the tarsal width trait of the Chinese honeybee; The SNP site is the nucleotide sequence shown in SEQ ID NO.1, wherein there is a polymorphism at position 173 of the sequence, and the polymorphism is A / G; The KASP primer combination includes: F1: AGTAATTATGATTAATTAAAATCGTTA, F2: AGTAATTATGATTAATTAAAACGTTG, R: ACCGATTTCGAATCCATCGT; The kit includes the aforementioned KASP primer combination.
2. The application of SNP sites, KASP primer combinations, or kits in any of the following: i) Breeding Chinese honeybees with high crawling efficiency or pollen-collecting ability; ii) Improvement of the crawling efficiency or pollen-collecting ability of Chinese honeybee germplasm resources; iii) Molecular marker-assisted breeding of the tarsal width trait in the Chinese honeybee; The SNP site is the nucleotide sequence shown in SEQ ID NO.1, wherein there is a polymorphism at position 173 of the sequence, and the polymorphism is A / G; The KASP primer combination includes: F1: AGTAATTATGATTAATTAAAATCGTTA, F2: AGTAATTATGATTAATTAAAACGTTG, R: ACCGATTTCGAATCCATCGT; The kit includes the aforementioned KASP primer combination.
3. A method for identifying the tarsal width of the Chinese honeybee, characterized in that, include: The polymorphism of the SNP site described in claim 1 or 2 is detected in the bee under test, and the tarsal width trait of the bee under test is determined based on the detection results.
4. The method according to claim 3, characterized in that, PCR amplification was performed using the KASP primer combination described in claim 1 or 2, followed by gene sequencing to detect the polymorphism of the SNP sites described in claim 1 or 2.
5. The method according to claim 3 or 4, characterized in that, The determination of the tarsal width trait of the bee under test based on the test results includes: For the bees to be tested, those with a polymorphism detection result of A / A at the SNP site described in claim 1 or 2 have a longer tarsal width than those with a detection result of A / G.
Citation Information
Patent Citations
Method for identifying cysticercosis resistance character of bee colony by utilizing SNP marker KZ288474.1_322717
CN112430675A
SNP marker for identifying variety of Chinese bees in Changbai Mountain and identification
CN113186297A