Molecular marker combination for identifying foot-and-mouth disease virus persistently infected cattle and application of molecular marker combination

Abstract

The invention discloses a molecular marker combination for identifying foot-and-mouth disease virus persistently infected cattle and application of the molecular marker combination. The molecular marker combination is composed of an IL-10 gene, an IL-1beta gene and a CXCL8 gene. In foot-and-mouth disease virus persistently infected cattle, the expression levels of IL-10, IL-1beta and CXCL8 genes are obviously lower than those of rehabilitation cattle 7 days after challenge, and are obviously higher than those of rehabilitation cattle 14 days after challenge. The three genes are subjected to sensitivity and specificity analysis of diagnosis. The result shows that at 7dpc, the AUC is 1.000 (95% confidence interval, 0.872-1.000), and the sensitivity and specificity of diagnosis both reach 100%. And the AUC is 1.000 (95% confidence interval, 0.872-1.000) at 14dpc, and the sensitivity and the specificity of diagnosis also reach 100%. The result shows that IL-10, IL-1beta and CXCL8 can be used as a molecular marker combination, and the molecular marker combination can be used in the early stage of foot-and-mouth disease virus infection; 14dpc) can be used for screening the potential FMDV persistently infected cattle, so that the transmission of diseases can be controlled earlier and faster.

Description

Technical Field

[0001] The present invention relates to a molecular marker combination for identifying foot-and-mouth disease virus persistently infecting cattle and its application. The present invention belongs to the field of biotechnology. Background Art

[0002] Foot-and-mouth disease (FMD) is an acute, highly contagious vesicular disease caused by foot-and-mouth disease virus (FMDV), which primarily affects even-toed ungulate mammals. In areas where FMD is endemic, there is a huge economic burden each year on FMD vaccination and veterinary measures, as well as revenue losses from the implementation of trade restrictions. Countries that are currently free of FMD invest significant resources in preparing for a global FMD situation, as an invasion of the disease would have a devastating impact on animal product production and trade. In addition, the prevention and control of FMD is also affected by subclinical persistent infection, which occurs after acute infection in ruminants. Persistent FMDV infection is often referred to as the "FMDV carrier state", and the World Organization for Animal Health (WOAH) defines FMDV carriers as animals in which infectious virus is still detected for more than 28 days after infection. Clinical studies have found that the rate of persistent infection with FMDV exceeds 50%, even in cattle herds that are fully protected by vaccination. The presence of FMDV carriers not only poses a risk of spreading the disease, but also seriously impedes FMD eradication and official recognition of FMD-free status by the World Organisation for Animal Health.

[0003] At present, most of the studies on FMDV persistent infection in animals focus on the law of virus excretion, animal tissue localization, the law of antibody and immune cell growth and decline, and the molecular characteristics of the persistent infection. It is proposed that the determinants of the establishment of persistent infection are mainly factors related to the host immune response, but its specific molecular mechanism has not yet been elucidated. Although the bovine nasopharyngeal mucosal epithelium has been identified as the replication site of persistent foot-and-mouth disease virus infection, peripheral blood mononuclear cells (PBMCs) have the advantages of being easy to obtain, easy to prepare, able to represent the body's immune status and able to achieve continuous dynamic monitoring, which can provide new insights for screening molecular biomarkers that quickly distinguish persistently infected cattle from recovered cattle. Therefore, by continuously monitoring the dynamic molecular characteristics of PBMCs through high-throughput RNA-seq, the key molecules that determine FMDV persistent infection and distinguish FMDV persistently infected animals can be quickly identified. Summary of the invention

[0004] The purpose of the present invention is to provide a molecular marker combination for identifying cattle persistently infected with foot-and-mouth disease virus and its application.

[0005] In order to achieve the above object, the present invention adopts the following technical means:

[0006] The present invention discloses a molecular marker combination for identifying cattle persistently infected with foot-and-mouth disease virus, wherein the molecular marker combination consists of IL-10, IL-1β and CXCL8 genes.

[0007] Among them, preferably, in cattle persistently infected with foot-and-mouth disease virus, the expression levels of IL-10, IL-1β and CXCL8 genes were significantly lower than those in recovered cattle 7 days after infection, and significantly higher than those in recovered cattle 14 days after infection.

[0008] Furthermore, the present invention also proposes the use of the molecular marker combination in the preparation of a reagent for identifying cattle persistently infected with foot-and-mouth disease virus.

[0009] Furthermore, the present invention also proposes a primer combination for identifying persistent infection of cattle with foot-and-mouth disease virus, wherein the primer combination consists of primers for amplifying IL-10, IL-1β and CXCL8 gene transcripts respectively.

[0010] Wherein, preferably, the primer sequence used to amplify the IL-10 gene transcript is:

[0011] Upstream primer: GCGAGGCGAAGACTTTCTTT;

[0012] Downstream primer: GCAACCCAGGTAA-CCCTTAAAGT;

[0013] The primer sequences used to amplify IL-1β gene transcripts are:

[0014] Upstream primer: AAAATCCCCTGGTGCTGGCT;

[0015] Downstream primer: ATGCAG-AACACCACTTCTCGG;

[0016] The primer sequences used to amplify the CXCL8 gene transcripts are:

[0017] Upstream primer: CCAATGGAAACGAGGTCTGC;

[0018] Downstream primer: TTGCTTCTCAGCTCTCTTCAC.

[0019] Furthermore, the present invention also proposes the use of the primer combination in the preparation of a reagent for identifying persistent infection of cattle by foot-and-mouth disease virus.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention provides a molecular marker combination for identifying cattle with persistent foot-and-mouth disease virus infection, and the molecular marker combination is composed of IL-10, IL-1β and CXCL8 genes. ROC analysis was performed on these three genes, and the area under the curve (AUC) and its 95% confidence interval (95% CI), as well as the sensitivity and specificity of diagnosis were calculated. The results show that the ROC curve of the three gene combinations shows higher diagnostic accuracy. At 7dpc, the AUC is 1.000 (95% confidence interval, 0.872-1.000), and the sensitivity and specificity of diagnosis both reach 100%. At 14dpc, the AUC is 1.000 (95% confidence interval, 0.872-1.000), and the sensitivity and specificity of diagnosis also reach 100%. The results show that IL-10, IL-1β, and CXCL8 can be used as a molecular marker combination to screen potential FMDV persistently infected cattle in the early stage of foot-and-mouth disease virus infection (<14dpc), so as to control the spread of the disease earlier and faster. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 For PLS-DA analysis;

[0023] Figure 2 GO functional annotation analysis of genes with VIP scores greater than 1.0;

[0024] Figure 3 It is the PPI interaction network of genes involved in immune response with VIP scores greater than 1.0;

[0025] Figure 4 are the results of RNA-seq and qRT-PCR;

[0026] Among them, A is the RNA-seq result; B is the qRT-PCR result; * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, **** indicates p<0.0001;

[0027] Figure 5 The difference in expression levels of the three genes at 7dpc and 14dpc;

[0028] Among them, * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001, and **** indicates p < 0.0001;

[0029] Figure 6 Figure 2 shows the ROC curves of the three genes at 7dpc and 14dpc, and the area under the curve (AUC) represents the diagnostic performance. DETAILED DESCRIPTION

[0030] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0031] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0032] Example 1 Screening and identification of molecular markers for persistent infection of cattle with foot-and-mouth disease virus

[0033] 1. Methods

[0034] 1.1 PBMCs isolation: Fresh blood samples from the FMDV persistent infection group and the recovery group collected before, 7, 14, 21, and 28 days after the virus attack were diluted with an equal volume of 1×PBS (pH7.4), and the same volume of diluted whole blood was gently layered on top of the Ficoll Plus 1.083 solution to ensure that the two layers did not mix, and centrifuged at 800×g for 30 minutes at room temperature. Then, the cells at the interface were carefully aspirated and transferred to a new 15ml centrifuge tube, washed twice with 1×PBS (pH 7.4) containing 2% fetal bovine serum, and centrifuged at 300×g for 10 minutes at room temperature to collect the cells, and then the PBMCs were resuspended in RIPM-1640 containing 10% FBS and 1% double antibody, and the cell number and viability of the cells were detected using the Countess II automatic cell counter. The cells were diluted to 1.0×10 6 The cells were collected by centrifugation at 300 × g at room temperature and lysed with 1 mL of RNAiso Plus reagent and stored in liquid nitrogen for later use.

[0035] 1.2 RNA sample preparation: Total RNA was extracted using the extraction method. In short, 1 / 5 volume of chloroform was added to each centrifuge tube, and the mixture was shaken vigorously for 15 seconds and then allowed to stand at room temperature for 15 minutes, and then centrifuged at 12000rpm for 15 minutes at 4°C; the top aqueous phase was taken to another new 1.5mL RNase-free centrifuge tube, and an equal volume of pre-cooled isopropanol was added, and the mixture was gently inverted and mixed, and allowed to stand at room temperature for 15 minutes, and then centrifuged at 12000rpm for 15 minutes at 4°C, and a white precipitate visible to the naked eye appeared at the bottom of the tube; the supernatant was discarded, and 1mL of 75% ethanol diluted with pre-cooled DEPC water was added, and the bottom of the tube was gently tapped to resuspend the precipitate, and the centrifuge tube was gently shaken upside down 5-0 times, and centrifuged at 12000rpm for 10 minutes at 4°C, and the precipitate was re-aggregated at the bottom of the tube; the supernatant was discarded, and the tube cover was opened and placed in a fume hood to dry for 2-5 minutes, and 20-50μL DEPC water was added and gently blown to dissolve the precipitate, and the centrifuge tube was placed on ice. The concentration and purity were assessed using Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent).

[0036] 1.3 RNA-seq selected high-quality RNA samples with RIN values ​​> 7.0 and followed the Illumina mRNA Sequencing Protocol ( The sequencing library was constructed using RNA Seq library Prep Kit v2. The library was sequenced on the NovaSeq 6000 platform (paired-end, 2×150 bp).

[0037] 1.4 Bioinformatics: Sequencing data were first filtered by Cutadapt (https: / / cutadapt.readthedocs.io / en / stable / , version: cutadapt-1.9). In this step, clean reads were obtained by removing reads containing sequencing adapters, poly(A) and poly(G) tails, more than 5% unknown nucleotides, and more than 20% low-quality (q-value ≤ 20) bases. The obtained clean reads were aligned with the bovine reference genome ARS-USD1.2 using HISAT2 (https: / / daehwankimlab.github.io / hisat2 / , version: hisat2-2.0.4). The mapped reads of each sample were assembled using StringTie (http: / / ccb.jhu.edu / software / stringtie / , version: StringTie-1.3.44d) with default parameters. Subsequently, all transcriptomes from different samples were merged using gffcompare software (http: / / ccb.jhu.edu / software / stringtie / gffcompare.shtml, version: gffcompare-0.9.8) to reconstruct a comprehensive transcriptome. After generating the final transcriptome, the expression levels of all transcripts were estimated using StringTie and ballgown (http: / / www.bioconductor.org / packages / release / bioc / html / ballgown.html), and the FPKM value was calculated to determine the expression abundance of mRNA. The differentially expressed genes with FPKM values ​​≥10 (in either sample) between the two groups were identified using DESeq2 software, and the differentially expressed genes with FPKM values ​​≥10 (in either sample) between the two samples were identified using edgeR software. Genes with a false discovery rate (FDR) lower than 0.05 and an absolute fold change ≥2 were considered as differentially expressed genes, and weighted gene correlation network analysis, GO term and KEGG pathway enrichment analysis were performed on them. The STRING database was used to analyze the PPI network among differentially expressed genes, and the Cytoscape software was used to visualize the network map of the selected differentially expressed genes and screen out hub-genes.

[0038] 1.5 Real-time quantitative PCR (RT-qPCR) and statistical analysis: Total RNA was extracted from PBMCs samples of the two groups of cattle at different time points and reverse transcribed into cDNA. The transcription levels of IL-10, IL-1β and CXCL8 were TMQuantification was performed using SYBR Premix ExTaqII (Tli RNaseH Plus) on a Real-Time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA). The primer sequences used to amplify IL-10 gene transcripts were:

[0039] Upstream primer: GCGAGGCGAAGACTTTCTTT (SEQ ID NO. 1);

[0040] Downstream primer: GCAACCCAGGTAA-CCCTTAAAGT (SEQ ID NO. 2);

[0041] The primer sequences used to amplify IL-1β gene transcripts are:

[0042] Upstream primer: AAAATCCCCTGGTGCTGGCT (SEQ ID NO. 3);

[0043] Downstream primer: ATGCAG-AACACCACTTCTCGG (SEQ ID NO. 4);

[0044] The primer sequences used to amplify the CXCL8 gene transcripts are:

[0045] Upstream primer: CCAATGGAAACGAGGTCTGC (SEQ ID NO. 5);

[0046] Downstream primer: TTGCTTCTCAGCTCTCTTCAC (SEQ ID NO. 6);

[0047] The primer sequences used to amplify the internal reference gene GAPDH are:

[0048] Upstream primer: CCGTTCGACAGATAGCCGTA (SEQ ID NO. 7);

[0049] Downstream primer: ATGCGGCCGAATCCGTT (SEQ ID NO. 8).

[0050] The relative transcription levels of IL-10, IL-1β, and CXCL8 in each sample were then calculated at 7, 14, 21, and 28 days after the challenge, and the ROC curve was generated using MedCalc software to calculate the area under the curve (AUC) and its 95% confidence interval (95% CI), and the sensitivity and specificity of the diagnosis were calculated. Genes with an AUC greater than 0.9 were identified as potential diagnostic biomarkers.

[0051] 2. Results

[0052] 2.1 Transcriptome feature analysis

[0053] First, we used the PLS-DA model to compare the gene expression profiles of 30 PBMCs samples generated by post-sequencing analysis from three FMDV persistently infected cattle (CRs) and three recovered cattle (NCRs) before and at five time points, 7, 14, 21, and 28 days after the virus challenge. The results showed that before the virus challenge, there was no obvious separation between the two groups of vaccinated animals, while FMDV infection caused obvious fluctuations in the transcriptomes of infected and uninfected animals, and there was also a relatively obvious separation between the samples of CRs and NCRs at each time point ( Figure 1 ), indicating that the transcriptional signatures of CRs and NCRs were different at each time point.

[0054] 2.2 Gene ontology (GO) enrichment analysis

[0055] Through PLS-DA model analysis, we identified key genes that reflect differences between samples and groups (projected important variables—VIP scores greater than 1.0, with higher VIP scores indicating greater importance). We then performed GO functional annotation analysis on these genes with VIP scores greater than 1.0 and found that the biological functions of most genes were mainly related to immune response ( Figure 2 ).

[0056] 2.3 Hub-gene screening

[0057] Using the STRING database and Cytoscape software, the PPI network was constructed and Hub genes were screened for the genes involved in immune response that reflected the differences between samples and groups calculated by the PLS-DA model. In the PPI network, the redder the color, the more important the gene. The top five Hub genes are IL-10, IL-6, IL-1β, CXCL10, and CXCL8 ( Figure 3 We selected three genes with high sequencing abundance (IL-10, IL-1β, and CXCL8) for qRT-PCR validation.

[0058] 2.4 Hub-gene verification

[0059] RNA-seq results showed that the levels of IL-10, IL-1β, and CXCL8 in the FMDV persistent infection group were significantly lower than those in the recovery group 7 days after infection, and significantly higher than those in the recovery group 14 days after infection ( Figure 4 A), RT-qPCR detection revealed that the expression levels of these three genes in the persistent infection group and the recovery group were consistent with the change trend in RNA-seq ( Figure 4 B).

[0060] Next, we compared the differences in the expression levels of IL-10, IL-1β, and CXCL8 in the FMDV persistent infection group and the recovery group at 7 and 14 days after the challenge. The results showed that in the FMDV persistent infection group, the expression levels of these three genes were significantly lower than those in the recovery group at 7 days after the challenge, and significantly higher than those in the recovery group at 14 days after the challenge ( Figure 5 ), indicating that in the early stages of infection (7-14 days after infection), persistently infected cattle exhibit an immunosuppressive state, allowing the virus to persist.

[0061] 2.5 Evaluation of diagnostic performance of candidate genes

[0062] Subsequently, ROC analysis was performed on these three genes, and the area under the curve (AUC) and its 95% confidence interval (95% CI), as well as the sensitivity and specificity of diagnosis were calculated. The results showed that the ROC curve of the three gene combination showed higher diagnostic accuracy. At 7dpc, the AUC was 1.000 (95% confidence interval, 0.872-1.000), and the sensitivity and specificity of diagnosis reached 100%. At 14dpc, the AUC was 1.000 (95% confidence interval, 0.872-1.000), and the sensitivity and specificity of diagnosis also reached 100%. The results show that IL-10, IL-1β, and CXCL8 can be used as a molecular marker combination to screen potential FMDV persistently infected cattle in the early stage of foot-and-mouth disease virus infection (<14dpc), so as to control the spread of the disease earlier and faster.

Claims

1. A molecular marker combination for identifying persistent infection of cattle with foot-and-mouth disease virus, characterized in that: The molecular marker combination consists of IL-10, IL-1β and CXCL8 genes.

2. The molecular marker combination according to claim 1, characterized in that: In cattle persistently infected with foot-and-mouth disease virus, the expression levels of IL-10, IL-1β and CXCL8 genes were significantly lower than those in recovered cattle 7 days after infection, and significantly higher than those in recovered cattle 14 days after infection.

3. Use of the molecular marker combination according to claim 1 or 2 in the preparation of a reagent for identifying cattle persistently infected with foot-and-mouth disease virus.

4. A primer composition for identifying persistent infection of cattle by foot-and-mouth disease virus, characterized in that: The primer combination consists of primers used for amplifying IL-10, IL-1β and CXCL8 gene transcripts respectively.

5. The primer composition according to claim 4, characterized in that The primer sequences used to amplify IL-10 gene transcripts are: Upstream primer: GCGAGGCGAAGACTTTCTTT; Downstream primer: GCAACCCAGGTAACCCTTAAAGT; The primer sequences used to amplify IL-1β gene transcripts are: Upstream primer: AAAATCCCCTGGTGCTGGCT; Downstream primer: ATGCAGAACACCACTTCTCGG; The primer sequences used to amplify the CXCL8 gene transcripts are: Upstream primer: CCAATGGAAACGAGGTCTGC; Downstream primer: TTGCTTCTCAGCTCTCTTCAC.

6. Use of the primer combination according to claim 4 or 5 in preparing a reagent for identifying persistent infection of cattle by foot-and-mouth disease virus.

Images