Molecular breeding method, molecular marker and primer for breeding high gibberella-resistant variety

By using molecular marker-assisted breeding of the TaFhb-2DL gene and Fhb1, combined with precise genotype selection and hybridization techniques, the problem of scarce resources for wheat resistance to Fusarium head blight has been solved, and wheat varieties with high resistance to Fusarium head blight and increased yield have been bred.

CN119955964BActive Publication Date: 2025-11-11JIANGSU LIXIAHE REGION AGRI RES INST +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411512442.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-28
Publication Date
2025-11-11
Estimated Expiration
2044-10-28

AI Technical Summary

Technical Problem

The existing wheat breeding system lacks genetic resources for resistance to Fusarium head blight, resulting in unsatisfactory breeding outcomes and making it difficult to achieve precise and efficient breeding for resistance to Fusarium head blight.

Method used

Using the KASP marker of the TaFhb-2DL gene and the linked GSM marker of Fhb1, combined with single-flower drip irrigation and soil-spreading methods, efficient molecular breeding was carried out to screen out varieties carrying the scab resistance loci QFhb-2DL and Fhb1. Through hybridization and genotyping, wheat varieties with high resistance to scab were bred.

Benefits of technology

The breeding method achieved high resistance to Fusarium head blight in wheat varieties, consistently reaching a level higher than that of Sumai 3, with a significant increase in yield. The breeding method is simple, quick, and highly efficient.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119955964B_ABST
    Figure CN119955964B_ABST
Patent Text Reader

Abstract

This invention discloses a molecular breeding method, molecular markers, and primers for selecting varieties highly resistant to Fusarium head blight. The molecular markers include those with flanking sequences as shown in SEQ ID NO.3. TaFhb‑2DL The KASP marker. This invention utilizes fine-mapping populations to narrow down Fusarium head blight resistance sites. QFhb-2DL By analyzing the physical regions of the genome, candidate genes were identified, and the genes most associated with Fusarium head blight resistance were screened using the phenotypes and genotypes of natural populations. A new linkage marker, KASP.TaFhb-2DL, was developed to enable... QFhb-2DL The utilization is made more efficient. This invention utilizes genes carrying resistance to Fusarium head blight. TaFhb‑ 2DL Varieties with disease-resistant genotypes, used as parents, carry... Fhb1 Gene varieties serve as donors, because TaFhb‑2DL It has been effectively utilized in wheat scab resistance breeding in the middle and lower reaches of the Yangtze River, and on this basis, a major scab resistance gene was introduced. Fhb1 It can enhance resistance to Fusarium head blight to "high resistance," surpassing that of Sumai 3. This is achieved through the use of effective molecular markers. TaFhb‑2DL and Fhb1 The aggregation of these technologies can quickly and effectively breed varieties highly resistant to Fusarium head blight.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of wheat molecular breeding technology, specifically to a molecular breeding method, molecular markers, and primers for selecting varieties highly resistant to Fusarium head blight. Background Technology

[0002] Jiangsu Province is a severely affected area of ​​wheat scab in China, and resistance to scab has always been an important goal in wheat breeding. Of the wheat varieties approved nationally between 2009 and 2020, only 28 showed moderate resistance (MR) to scab, 23 of which originated from Jiangsu Province. In terms of wheat scab resistance breeding in China (excluding Jiangsu Province), since 2016, approximately 15 varieties approved in China have shown moderate resistance (MR), and only one variety has shown high resistance (HR), indicating no significant breakthrough in scab resistance breeding. The project applicant previously analyzed 316 scab resistance genes from major wheat varieties bred nationwide before 2018... Fhb1 , Fhb2 , Fhb4 , Fhb5 Identification of the Fusarium head blight phenotype revealed that only 17.72% of the varieties carried the disease. Fhb1 6.01% of the varieties carry Fhb2 11.39% of the varieties carry Fhb4 14.56% of the varieties carry Fhb5 Furthermore, among these main cultivated varieties, only Sumai 3 achieved R-level resistance to Fusarium head blight, indicating that the utilization rate of Fusarium head blight resistance genes in genetic improvement of Fusarium head blight resistance is not high. Since 2018, molecular marker-assisted breeding for Fusarium head blight resistance has made a series of advances. Zhou Miaoping et al. (Creation and Screening of New Fusarium Head Blight-Resistant Wheat Germplasm in the Huang-Huai Wheat Region, Journal of Triticeae Crops, 2018) used Sumai 3 as the resistance source and Jimai 22 as the receptor, combined with... Fhb1 Molecular-assisted selection was used to create 18 wheat materials with moderate to high susceptibility to Fusarium head blight. (Zhang Hongjun et al. utilized...) Fhb1 Gene functional marker selection enhances the resistance of wheat varieties to Fusarium head blight in the Huang-Huai winter wheat region (Acta Agronomica Sinica, 2018). Ningmai 9, Shengxuan 6, Sumai 3, and Ningmai 13 were selected as... Fhb1 Gene donors were crossed and backcrossed with near-isogenic lines of the highly susceptible wheat variety Zhoumai 16 dwarf wheat, and marker-assisted selection was performed to obtain genes carrying the virus. Fhb1 Backcross progeny with disease resistance genes and significantly improved resistance to Fusarium head blight. Professor Ma Zhengqiang's team at Nanjing Agricultural University used the wheat line NMAS022 as the donor parent for Fusarium head blight resistance and the modern wheat cultivar Bainong 4199 as the recipient parent, and bred a gene for enhanced resistance through molecular marker-assisted selection. Fhb1A new wheat variety, Bainong 4299, containing genes for resistance to Fusarium head blight (Zhang et al., Pyramiding of Fusarium head blight resistance quantitative trait loci, Fhb1 , Fhb4 , and Fhb5 In modern Chinese wheat cultivars, Frontiers in Plant Science, 2021; Zhang Yiduo et al., Gene aggregation breeding of new wheat line Bainong 4299 resistant to Fusarium head blight, Acta Agronomica Sinica, 2022). Meanwhile, Professor Ma Zhengqiang's team, in collaboration with the Huai'an Academy of Agricultural Sciences, also bred a gene aggregation... Fhb1 The team led by Professor Yin Guihong of Henan Agricultural University utilized genes that resist Fusarium head blight in Nanhuaimai 191 and Nanhuaimai 193. Fhb1 Genes resisting Fusarium head blight were used to breed wheat varieties such as Yunong 901, Yunong 902, Yunong 903, Yunong 904, and Yunong 910 (Zhang et al., Molecular and phenotypic characterization of Chinese wheat). Triticum aestivum (Cultivars for resistance to Fusarium head blight, Plant Breeding, 2023). However, the level of Fusarium head blight resistance of the above varieties (lines) has not yet reached or approached the level of Sumai 3, and the amount of work required for genotypic and phenotypic consistency selection in the breeding process is still enormous, and the accuracy and efficiency have not yet been significantly improved.

[0003] In summary, the superior germplasm and genetic resources already applied to wheat Fusarium head blight resistance breeding are still scarce, and breeding results are not outstanding. Most breeding practices show that wheat Fusarium head blight resistance is a trait controlled by the aggregation of multiple genes, and precise and efficient breeding cannot be achieved solely through molecular markers or phenotypic selection. Therefore, it is urgent to explore and utilize new, efficiently usable resistance sources and disease-resistant genes, innovate technical routes for Fusarium head blight resistance breeding, and promote the overall level of Fusarium head blight resistance breeding. Summary of the Invention

[0004] In response to the problem that the excellent germplasm resources and gene resources that have been applied to wheat scab resistance breeding are still scarce and the breeding results are not outstanding, this invention provides a molecular breeding method, molecular markers and primers for breeding highly resistant scab varieties. The highly resistant and high-yielding wheat lines bred using the molecular markers of this invention have stable scab resistance reaching the "high resistance" level, exceeding the level of Sumai No. 3.

[0005] To achieve the above objectives, the present invention provides, in one aspect, a molecular marker linked to wheat resistance to Fusarium head blight, comprising a flanking sequence as shown in SEQ ID NO.3. TaFhb-2DL KASP markers for genes.

[0006] Furthermore, the molecular marker also includes Fhb1 The chain GSM mark.

[0007] A second aspect of the present invention provides primers for use with the above-described molecular markers, comprising forward primers as shown in SEQ ID NO.4 and SEQ ID NO.5, and reverse primers as shown in SEQ ID NO.6.

[0008] A third aspect of the present invention provides primers for use with the aforementioned molecular markers. TaFhb-2DL The primers used for KASP markers of genes include the forward primers shown in SEQ ID NO.4 and SEQ ID NO.5, and the reverse primer shown in SEQ ID NO.6; Fhb1 The primers used for the linked GSM markers include the forward primer shown in SEQ ID NO.1 and the reverse primer shown in SEQ ID NO.2.

[0009] A fourth aspect of this invention provides a molecular breeding method for selecting varieties highly resistant to Fusarium head blight, comprising the following steps:

[0010] Step S1: Using single-flower drip irrigation and soil application of diseased wheat grains, selected wheat varieties were assessed for resistance to Fusarium head blight spread, infection, and yield, screening for varieties resistant to Fusarium head blight and with high yield potential. DNA was extracted from seeds or seedling leaves of these varieties and used... TaFhb-2DL The linkage markers of the gene clearly carry the resistance locus to Fusarium head blight. QFhb-2DL Varieties, additional testing Fhb1 Linked markers clearly indicate that they also carry genes for resistance to Fusarium head blight. Fhb1 The varieties were planted in an artificial climate chamber, crossbred, and F0 hybrids were harvested; F0 hybrids were obtained by planting F0 hybrids in an artificial climate chamber, and F1 was obtained by crossing F1 with Yangmai 14 to harvest BC1F0BC1F1 seeds.

[0011] Step S2: Plant BC1F1 seedlings. Once seedlings emerge, extract DNA from leaves for further processing. TaFhb-2DL Linkage marker detection of the gene was performed, and BC1F1 single plants that were homozygous for positive results at all of these loci were selected and BC1F2 plants were harvested.

[0012] Step S3, select BC1F2 in the planting, and use... Fhb1Linkage marker detection was used to select BC1F2 single plants that were positive (heterozygous or homozygous) at all loci for screening of tillering ability, lodging resistance, growth period and disease resistance. BC1F3 seeds were then harvested.

[0013] Step S4: Plant BC1F3 seedlings. During the seedling stage, randomly select leaves from individual plants, mix them, extract DNA, and utilize... Fhb1 Linkage markers were used to detect BC1F3 in row-wide pools. For rows where the pool test results were heterozygous, further individual gene testing was performed to determine the genotype of individual BC1F3 plants, and plants carrying the markers were screened. Fhb1 Homozygous positive and heterozygous positive plant rows; during the flowering period of wheat, BC1F3 was inoculated with Fusarium head blight pathogen by drip inoculation of single flowers. 21 days after inoculation, the disease incidence of the inoculated ears was investigated. Plant rows and individual plants with the identification result of "high resistance" were retained. Then, according to the breeding objectives, the comprehensive agronomic traits and disease resistance of each individual plant in the selected plant rows were comprehensively examined. After harvest, grain weight was identified, and BC1F4 individual plants with a grain weight level higher than the yield control were selected.

[0014] Step S5: Plant BC1F4 to form a line. Continue to use single-flower drip inoculation to identify resistance to Fusarium head blight spread and screen for lines with resistance levels higher than Sumai 3. Comprehensively examine the integrated agronomic traits and disease resistance of the selected lines. Harvest the selected lines together and conduct grain weight and yield identification after harvest. Select lines with yield levels higher than the yield control.

[0015] Step S6: Select BC1F5 as a plot and comprehensively examine the agronomic traits of the varieties in the plot according to the breeding objectives. After harvest, conduct yield identification. If the yield of the selected BC1F5 is more than 5% higher than that of the control variety for two consecutive years, and its resistance to Fusarium head blight exceeds that of the highly resistant Fusarium head blight variety Sumai 3, it can be recommended to enter the multi-point yield identification test.

[0016] in, TaFhb-2DL The linkage markers of genes are those described in the first aspect of this invention. TaFhb-2DL KASP markers of genes, Fhb1 The chain mark is as described in the first aspect of the present invention. Fhb1 The linked GSM markers used are the primer sets described in the third aspect of this invention.

[0017] Specifically, in step S1, the method for identifying resistance to spread is as follows: prepare a 4×10⁻⁶ gibberellic acid spore suspension. 5 ~5×10 5Spores / mL. During the wheat flowering period, the florets in the middle of the single ear of a marked plant were individually inoculated with the pathogen of Fusarium head blight by drip inoculation and marked. After inoculation, water was sprayed on the inoculated ear every 2 hours from 8:30 to 17:30 every day, spraying evenly on the wheat ear for 10 minutes each time. Spraying was stopped immediately 20 days after the wheat flowering. 21 days after inoculation, the disease status of the inoculated ears was investigated. Sumai No. 3 and Anong 8455 were used as highly resistant and highly susceptible controls, respectively.

[0018] The method for identifying resistance to infection is as follows: Prepare a suspension of 2×10⁻⁶ gibberellic acid spores. 5 ~3×10 5 Spray a fixed number of marked individual plants with Fusarium graminearum spores / mL during the wheat flowering period. After 21 days, investigate the disease incidence rate of spikelets and spikelets of the plants that have been sprayed with spores in this area to identify the resistance to Fusarium graminearum infection. Sumai No. 3 and Anong 8455 were used as highly resistant and highly susceptible controls, respectively.

[0019] The yield assessment method is as follows: plant height, growth period, number of ears per plant, number of grains per ear, and thousand-grain weight are mainly assessed. Yangmai 25 is used as a control. After three years of assessment on resistance to Fusarium head blight infection and spread, agronomic traits and yield are assessed to screen out varieties that are resistant to Fusarium head blight and have high yield potential.

[0020] DNA was extracted from seeds or seedling leaves of the above varieties using the CTAB method. TaFhb-2DL The linkage markers of the gene clearly show that the following varieties carry the Fusarium head blight resistance locus: Yangmai 11, Yangmai 14, Yangmai 17, Yangmai 18, Yangmai 39, Ningmai 13, Ningmai 26, Zhenmai 12, Zhenmai 5, Zhenmai 6, and Shengxuan 6. QFhb-2DL Additional testing Fhb1 The linkage markers clearly indicate that Yangmai 18 and Ningmai 13 also carry genes that resist Fusarium head blight. Fhb1 Yangmai 14 and Ningmai 13 were selected as parents and planted in an artificial climate chamber for hybridization. F0 hybrids were harvested to obtain F1. F1 was then hybridized with Yangmai 14 to obtain BC1F1 seeds.

[0021] Specifically, in step S3, the screening methods for tillering, lodging resistance, growth period, and disease resistance of the BC1F2 generation are as follows: for disease resistance, Yangmai 25 is used as the standard, and individual plants with worse disease resistance than Yangmai 25 are eliminated; for tillering and growth period, Yangmai 25 is used as the control, and individual plants with fewer tillers per plant than Yangmai 25 and later growth period than Yangmai 25 are eliminated; for lodging resistance, plant height, stem elasticity, and lodging resistance are examined, and individual plants that are prone to lodging, have poor elasticity, and are taller than 90cm are eliminated.

[0022] Specifically, in steps S4 and S5, the method for inoculating individual flowers per row with the Fusarium head blight pathogen during the flowering period is as follows: prepare a Fusarium head blight spore suspension of 4×10⁻⁶. 5~5×10 5 Spores / mL, in the field, during the wheat flowering period, the single-flower drip inoculation method was used. 20 ears were randomly selected from each row or line, and inoculated at the open florets in the middle of each ear, and marked. After inoculation, water was sprayed on the inoculated ears every 2 hours from 8:30 to 17:30 every day, spraying evenly and thoroughly onto the wheat ears for 10 minutes each time. Watering was stopped immediately 20 days after the wheat flowering. 21 days after inoculation, the disease incidence of the inoculated ears was investigated, counting the number of diseased spikelets per ear and the total number of spikelets. Rows or individual plants with an average diseased spikelet rate ≤25% were retained. Sumai 3 and Anong 8455 were used as highly resistant and highly susceptible controls, respectively, Yangmai 25 as a moderately resistant control, and Yangmai 13 as a moderately susceptible control.

[0023] Specifically, in steps S4, S5, and S6, the method for comprehensively examining the integrated agronomic traits of the selected plants, strains, and varieties is as follows: the standard for excellence is a plant height of less than 90cm, and among the yield factors, the number of spikes per plant is greater than or equal to 9, the number of spikelets is greater than 20, and the number of grains per spike is greater than or equal to 49.

[0024] Preferably, in steps S4, S5 and S6, the yield control is Yangmai 25.

[0025] Through the above technical solution, the present invention achieves the following beneficial effects:

[0026] 1. QFhb-2DL This invention identifies Fusarium head blight resistance loci discovered by the applicant in Yangmai 4, Yangmai 5, Yangmai 12, and Yangmai 16. The invention utilizes fine-mapping populations to further narrow down the physical regions of the target loci, identify candidate genes, and use natural populations to screen for genes most associated with Fusarium head blight resistance, developing a new linkage marker, KASP.TaFhb-2DL. This newly developed molecular marker can accelerate the identification of resistance loci. QFhb-2DL Its application in wheat disease resistance breeding, and it can also be used for TaFhb- 2DL Gene cloning.

[0027] 2. The breeding method of this invention, through genotyping, first selects individuals carrying the major locus of resistance to Fusarium head blight from a natural population. QFhb-2DL Using disease-resistant genotypes as parents, and then selecting those carrying the genotype through genotyping. Fhb1 Gene varieties serve as donors, because QFhb-2DL As a stable disease resistance site, it can be effectively utilized in wheat scab resistance breeding in the middle and lower reaches of the Yangtze River, and further introduction can be based on this. Fhb1 The gene can reduce the average diseased spikelet rate by 2.79% to 87.17%, and the average diseased spikelet rate of Fusarium head blight is 13.80%, which is significantly lower than that of Sumai No. 3 (15.77%), achieving high resistance. This indicates that in QFhb-2DL Import in background Fhb1It can significantly improve resistance to Fusarium head blight, exceeding the level of Sumai 3, and stably reach a "high resistance" level. This is achieved using molecular markers. TaFhb-2DL Genes and Fhb1 The aggregation method is simple, quick, and efficient, and can quickly and effectively breed varieties highly resistant to Fusarium head blight. Attached Figure Description

[0028] Figure 1 In Embodiment 1 of the present invention Fhb1 A schematic diagram of the amplification results of tightly linked molecular markers in parents and offspring, with the arrows pointing to the positive bands of the Fusarium head blight resistance gene;

[0029] Figure 2 According to TaFhb-2DL Genotyping of KASP markers developed from differential SNPs in 243 wheat varieties;

[0030] Figure 3 This is a flowchart of the breeding method in Embodiment 3 of the present invention. Detailed Implementation

[0031] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0032] Example 1: Molecular marker-assisted selection of Fusarium head blight resistance genes Fhb1 Method establishment

[0033] Genomic DNA was extracted from candidate parental materials, single plant leaves, or mixed plant leaves involved in Example 3 using the CTAB method. The DNA was diluted to obtain a template solution with a concentration of approximately 30 ng / μL, and the wheat resistance gene was detected. Fhb1 Linked GSM markers. Molecular marker detection of Fusarium head blight resistance genes. Fhb1 The sequences of the specific primer sets for the linked GSM markers are shown in Table 1:

[0034] Table 1 Genes for resistance to Fusarium head blight Fhb1 Linked marker primer sequence information

[0035]

[0036] The major gene for resistance to Fusarium head blight was detected using PCR amplification. Fhb1The corresponding linkage marker TaHRC-GSM, the PCR amplification method is as follows: the PCR amplification system is 10μL, containing 1.0μL of 30ng / μL wheat genomic DNA, 1.0μL of 10×PCR buffer, 0.2μL of 10Mm dNTP, 1.0μL of 10Mm MgCl2, 0.2μL of 5U Taq polymerase, 0.4μL of 5μM upstream primer, 0.4μL of 5μM downstream primer and 5.8μL of sterile deionized water; the PCR amplification program is as follows: (1) 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 62℃ annealing for 20s, 68℃ extension for 2-3.5min; (2) 94℃ denaturation for 20s, 57℃ annealing for 20s, 72℃ extension for 1min, 32 cycles; (3) 72℃ extension for 5min; 4℃ storage.

[0037] The wheat material involved in Example 3 was detected using TaHRC-GSM primers in 1% agarose electrophoresis solution. The target genotype was the same as Ningmai 13, and it was selected as the material. Figure 1 for Fhb1 A schematic diagram showing the amplification results of tightly linked molecular markers in parents and offspring; the arrows indicate positive bands for Fusarium head blight resistance genes. The results show that some materials in BC1F3 carry... Fhb1 Positive homozygous genotype (red arrow), some materials carry it. Fhb1 Negative homozygous genotype.

[0038] Example 2: Establishing a molecular design breeding method system for wheat with high resistance to Fusarium head blight, while analyzing the results of fixing Fusarium head blight resistance loci. QFhb-2DL Background Fhb1 With and without gene effects on resistance to Fusarium head blight spread

[0039] QFhb-2DL These are Fusarium head blight resistance loci discovered by the applicant from Yangmai 4, Yangmai 5, Yangmai 12, and Yangmai 16, contributing 37.39% to the Fusarium head blight resistance. The applicant utilized... QFhb-2DL The F markings on both sides of Yangmai No. 5 / Yanzhan No. 1 10 Two remaining heterozygous lines, RHL-1 and RHL-2, were found in the RIL population. Fine-tuning was derived from these two RHL lines. QFhb- 2DL The secondary segregating population consisted of 5807 individual plants. Using 30× resequencing of 56 wheat varieties, combined with wheat genome version 2.1v information, in... QFhb-2DLPolymorphic sites were identified within the region, developed into new KASP markers, and six key recombinants were screened in the secondary segregating population. Combined with two years of Fusarium head blight phenotypic identification, the target region was narrowed down to 530.1 kb, with 19 candidate genes. Using 30× resequencing data and BSA-seq and 660 KSNP data from the resistance-susceptibility pool of the Yangmai 5 / Yanzhan 1 RIL population, differences in promoters or within genes were identified in these 19 genes. Three genes showed promoter or coding region differences between Yangmai 5 and Yanzhan 1, namely… TaFhb-2DL.1 , TaFhb-2DL.2 and TaFhb-2DL Then, these three candidate genes were amplified and sequenced 3000 bp prior to the start codon in Yangmai 5 and Yanzhan 1 respectively (Table 2). Based on the sequences near the differential SNPs of these three genes, corresponding KASP markers were developed and validated in 243 wheat varieties from Huainan and Huaibei regions. TaFhb-2DL and TaFhb-2DL.1 , TaFhb-2DL.2 Compared to the genotyping of Fusarium head blight resistance phenotypes, KASP.TaFhb-2DL showed the best genotyping effect (Table 3). Therefore, KASP.TaFhb-2DL was used to detect Fusarium head blight resistance genes. TaFhb-2DL Breeding selection. TaFhb-2DL Its main function is to transport various substrates such as oligopeptides, amino acids, glucosinolates, IAA, GA, and ABA. Its expression is upregulated under nitrogen deficiency, drought, and salt stress conditions, indicating its important role in stress response. However, there are no reports of its effect on resistance to Fusarium head blight. The flanking sequence of KASP.TaFhb-2DL, SEQ ID NO.3, is: TACATGTGGTCGGATAAAAATCGTCACCTCCACTGCACAAC[T / C]ATACCCTTTGCGTCAAATCGCGTCTATAGATTGTAACTCGAGCTGAAGGTAGATG.

[0040] Table 2. Genetic variation of the three candidate genes among the resistant materials.

[0041]

[0042] Table 3. Typing results of Fusarium head blight resistance phenotypes using linkage markers of three genes.

[0043]

[0044] Preparation of KASP-labeled primer working solution: Take 30 μL (100 μM) of upstream primer (nucleotide sequence as shown in SEQ ID NO.4) and 12 μL (100 μM) of downstream primer (nucleotide sequences as shown in SEQ ID NO.5 and SEQ ID NO.6) respectively, add sterile ultrapure water to make up to 100 μL, mix thoroughly, and use as KASP-labeled primer working solution for later use.

[0045] PCR amplification reaction system: 2.2 μL of wheat DNA template to be tested (approximately 30 ng / μL), 0.06 μL of primer working solution, 2.5 μL of KASP Master Mix (LGC Corporation, KBS-1016-002), and added to a final volume of 5 μL with sterile ultrapure water;

[0046] PCR reaction procedure: (1) Pre-denaturation at 95℃ for 10 min; (2) Denaturation at 95℃ for 20 s, followed by 45 s at 61–55℃ (decreasing by 0.6℃ per cycle), for a total of 10 cycles; (3) Denaturation at 95℃ for 20 s, followed by annealing at 55℃ for 45 s, for a total of 34 cycles; store at 20℃. A blank control (NTC) without template DNA was also included in the reaction system. One or more blank controls were set up for each plate.

[0047] Wheat seedlings were collected, and genomic DNA of the wheat was extracted using the CTAB method.

[0048] Using wheat genomic DNA as a template, PCR amplification was performed using the KASP primer set and PCR reagents as described above to obtain PCR amplification products. The PCR reaction was performed on an ABI Veriti 384 PCR instrument (Thermo Fisher), and the fluorescence values ​​of the PCR amplification products were scanned and read using an Omega F SNP genotyping instrument (LGC Genomics Ltd, KBS-0024-002). The excitation wavelength of FAM was 485 nm, and the emission wavelength was 520 nm; the excitation wavelength of VIC was 535 nm, and the emission wavelength was 556 nm; the system reference fluorescence ROX was excited at 575 nm and emitted at 610 nm. Genotyping was performed using Kluster Caller™ (KBioscience), and the genotype of KASP.TaFhb-2DL was determined based on the analysis results.

[0049] 243 wheat varieties from Huainan and Huaibei were amplified using the method described above, and the test results are as follows. Figure 2As shown in the figure. The fluorescence signal data of the amplified products, analyzed using Kluster Caller software, clustered near the X-axis (blue) in the fluorescence signal coordinate system of the genotyping results, which is the same as Yangmai 4 (disease-resistant genotype), proving that the genotype of these wheat varieties at the 42nd base (SNP site) of the flanking nucleotide sequence of the molecular marker KASP.TaFhb-2DL (such as SEQ ID NO.3) is C. Conversely, the fluorescence signal data of the amplified products, analyzed using Kluster Caller software, clustered near the Y-axis (red) in the coordinate system, which is different from the genotype of Yangmai 4 (disease-susceptible genotype), proving that the genotype of these wheat varieties at this SNP site is T. The primer set for KASP.TaFhb-2DL is listed in Table 4. The detection results of KASP.TaFhb-2DL in 243 wheat varieties and the related Fusarium head blight phenotypes are shown in Table 5.

[0050] Table 4 TaFhb-2DL KASP primer sequences

[0051]

[0052] Note: The underlined portion is the adapter sequence. SEQ ID NO.4 and SEQ ID NO.5 are two competing forward primers, and SEQ ID NO.6 is the reverse primer.

[0053] Table 5 TaFhb-2DL Typing results of Fusarium head blight resistance / susceptibility phenotypes

[0054]

[0055] Note: R represents the disease-resistant genotype, and S represents the disease-susceptible genotype.

[0056] DNA was extracted from seeds or seedling leaves using the CTAB method, and loci carrying resistance to Fusarium head blight were selected. QFhb-2DL The parents are Yangmai 17 and Yangmai 18, and Yangmai 18 also carries the gene for resistance to Fusarium head blight. Fhb1 Yangmai 17 and Yangmai 18 were planted in an artificial climate chamber, and after 3 months, they were crossbred to harvest F0 hybrids. The F0 hybrids were then planted in the artificial climate chamber to harvest F2. F2 seedlings were then planted in a greenhouse, tagged, and leaves were taken for DNA extraction. Fhb1 Linkage marker detection was used to select F2 cells that were gene-positive (heterozygous or homozygous), and F3 cells were harvested from crosses; F3 cells were selected in greenhouse cultivation and utilized... Fhb1Linkage marker detection was performed, and F4 cells that were positive for the gene (heterozygous or homozygous) were selected. F4 cells were selected from the harvest; they were then planted in the field in rows. During the seedling stage, leaves from 10 individual plants per row were randomly selected, mixed, and DNA was extracted. Fhb1 Linkage marker detection was performed, and F4 plants with positive genes (heterozygous or homozygous) were selected and tagged. Seeds from F5 plants were harvested; F5 plants were planted in the field, with each plant in 5 rows. During the seedling stage, leaves from 10 plants per row were randomly selected, mixed, and DNA was extracted. Fhb1 Linkage markers were used to detect F5 plant rows in a pooled sample. For rows where the pooled sample showed heterozygous results, further gene testing was performed on individual plants to determine the genotype of the F5 individual plants. A 4×10⁻⁶ gibberellic acid spore suspension was prepared. 5 ~5×10 5 Spores / mL. During the flowering stage of wheat, F5 plants were individually inoculated with Fusarium head blight pathogen via drip inoculation. For plants with homozygous genotypes, 20 ears per row were inoculated; for plants with inconsistent genotypes, 20 ears of each genotype were inoculated. Inoculation was performed at the open florets in the middle of each ear, and the inoculated ears were marked. From 8:30 AM to 5:30 PM daily, the inoculated ears were sprayed with water every 2 hours, evenly covering the wheat ears, for 10 minutes each time. Spraying was stopped immediately 20 days after wheat flowering. Twenty-one days after inoculation, the disease incidence was investigated in the inoculated ears, counting the number of diseased spikelets per ear and the total number of spikelets. The severity of Fusarium head blight was expressed as the average diseased spikelet percentage (PSS), calculated as PSS = number of diseased spikelets / total number of spikelets × 100%. Sumai 3 and Anong 8455 were used as highly resistant and highly susceptible controls, respectively. A comprehensive analysis of the individual plant genotypes and Fusarium head blight resistance spread results of F5 plants was conducted to clarify the effect of gene combinations (Table 6). A total of 176 F5 individual plants were tested, and all 176 F5 individual plants were found to carry [the virus / the virus]. TaFhb-2DL Genes, of which 133 individual plants carried homozygous positive genes. Fhb1 Genotype, 20 heterozygous carriers Fhb1 Genotype: 23 individuals carried homozygous negative genotypes. Fhb1 Genotype. Therefore, research was conducted in... QFhb-2DL Background Fhb1 Effect analysis (Table 7), with Anong 8455 (carrying TaFhb-2DL Genes and Fhb1 The homozygous negative control group served as the susceptible control, while Yangmai 158 (carrying the virus) served as the susceptible control. TaFhb-2DL homozygous positive and Fhb1 The homozygous negative control group (containing antibodies) served as the intermediate antibody control group, while Sumai No. 3 (carrying antibodies) served as the intermediate antibody control group. Fhb1 and TaFhb-2DL (Homozygous positive gene) serves as a high-antibody control.

[0057] Table 6. 176 F5 individual plants Fhb1 Genotype and average disease incidence in spikelets

[0058]

[0059] Table 7 In QFhb-2DL Background Fhb1 Effect analysis

[0060]

[0061] Note: Different capital letters after the average diseased spikelet rate value indicate extremely significant differences. p <0.01)

[0062] As can be seen from Tables 6 and 7, TaFhb-2DL The individual plants with the background showed moderate resistance to Fusarium head blight at a moderately resistant to moderately susceptible level, while the introduced plants... Fhb1 Afterwards, the average diseased spikelet rate decreased by 2.79% to 87.17%, which was highly significant. Fhb1 (Positive) + TaFhb- 2DL The incidence of Fusarium head blight on spikelets in (positive) individual plants was 13.80%, significantly lower than that of Sumai 3, indicating high resistance. Therefore, this suggests that... TaFhb-2DL Import in background Fhb1 It can greatly improve the resistance level to Fusarium head blight, and the resistance level is higher than that of Sumai No. 3.

[0063] Example 3: Molecular breeding method for selecting varieties highly resistant to Fusarium head blight

[0064] according to Figure 3 The process shown includes the following steps:

[0065] 1) Step S1, Parental Lines: 390 wheat varieties from across the country were selected as research subjects. Single-flower drip irrigation and soil application of infected wheat grains were used to identify resistance to Fusarium head blight spread and infection. Resistance to spread identification: A Fusarium head blight spore suspension of 4×10⁻⁶ was prepared. 5 ~5×10 5 Spores / mL. During the wheat flowering period, single-flower inoculation with the Fusarium head blight pathogen was performed on the florets in the middle of marked individual ears. After inoculation, water was sprayed on the inoculated ears every 2 hours from 8:30 to 17:30 daily, evenly spraying the wheat ears for 10 minutes each time. Spraying was stopped immediately 20 days after wheat flowering. 21 days after inoculation, the disease incidence was investigated in the inoculated ears, counting the number of diseased spikelets per ear and the total number of spikelets. The severity of Fusarium head blight was expressed as the average diseased spikelet percentage (PSS), calculated as PSS = number of diseased spikelets / total number of spikelets × 100%. Sumai 3 and Anong 8455 were used as highly resistant and highly susceptible controls, respectively. Resistance identification: A Fusarium head blight spore suspension of 2 × 10⁻⁶ was prepared. 5 ~3×10 5Spores / mL: A fixed number of marked individual plants were sprayed with Fusarium graminearum spore solution during the wheat flowering stage. Twenty-one days later, the incidence of diseased spikelets and spikelets (PIS) of the sprayed plants in this area were investigated to assess Fusarium graminearum resistance. Sumai 3 and Anong 8455 were used as highly resistant and highly susceptible controls, respectively. Simultaneously, yield assessments were conducted on 390 varieties in yield evaluation nurseries in Yangzhou and Nanjing, primarily assessing plant height, growth period, number of spikes per plant, number of grains per spike, and thousand-grain weight, with Yangmai 25 as a control. After three years of assessments on Fusarium graminearum resistance, resistance to spread, agronomic traits, and yield, varieties resistant to Fusarium graminearum and with high yield potential were selected: Yangmai 11, Yangmai 14, Yangmai 17, Yangmai 18, Yangmai 39, Ningmai 13, Ningmai 26, Zhenmai 12, Zhenmai 5, Zhenmai 6, and Shengxuan 6. DNA was extracted from seeds or seedling leaves of the above-mentioned varieties using the CTAB method, confirming that all 11 varieties carried DNA. TaFhb-2DL Genes: Yangmai 18 and Ningmai 13 also carry genes that resist Fusarium head blight. Fhb1 Yangmai 14 and Ningmai 13 were selected as parents and planted in an artificial climate chamber for hybridization to harvest F0 hybrids. The F0 hybrids were then planted in an artificial climate chamber, and the F1 hybrids were harvested and then crossed with Yangmai 14 to harvest BC1F1 seeds.

[0066] 2) Step S2: BC1F1 was planted in an artificial climate chamber in Yangzhou. When seedlings emerged, they were tagged, leaves were taken, and DNA was extracted. To avoid natural cross-pollination of wheat or the very rare natural mutations, DNA was extracted using... TaFhb-2DL Linkage marker detection of the gene was performed, and single plants that were homozygous for positive results at the specified locus were selected and BC1F2 was harvested.

[0067] 3) Step S3: Select BC1F2 in Yangzhou greenhouse cultivation and utilize... Fhb1 Linkage marker detection was performed, and BC1F2 single plants with positive loci (heterozygous or homozygous) were selected. Yangmai 25 was used as the yield control to screen for tillering, lodging resistance, growth period and disease resistance. BC1F3 seeds were selected from the harvest.

[0068] 4) Step S4: Plant BC1F3 in the field in Yangzhou, with each plant planted in 3 rows, each row 2.0m long and 0.23m apart, with 20 seeds per row. During the seedling stage, randomly select 10 leaves from each row, mix them, extract DNA, and use... Fhb1 Linkage markers were used to detect heterozygous BC1F3 in row-by-row samples. For rows where the pool test results were heterozygous, further gene testing was performed on individual plants to determine the genotype of BC1F3 individuals, and 13 individuals carrying the marker were screened. Fhb1 Rows of homozygous positive and one heterozygous positive strain (Table 8). Preparation of *Fusarium* spore suspension 4 × 10⁻⁶ 5 ~5×10 5Spores / mL. During the flowering stage of wheat, BC1F3 plants were individually inoculated with Fusarium head blight pathogen via drip inoculation. For plants with homozygous genotypes, 20 spikelets per row were inoculated; for plants with inconsistent genotypes, 20 spikelets per individual plant were inoculated. Inoculation was performed at the open florets in the middle of each spike, and the inoculated spikelets were marked. From 8:30 AM to 5:30 PM daily, the inoculated spikelets were sprayed with water every 2 hours, evenly covering the wheat spikelet, for 10 minutes each time. Spraying was stopped immediately 20 days after wheat flowering. 21 days after inoculation, the disease incidence was investigated in the inoculated spikelets. The number of diseased spikelets per spikelet and the total number of spikelets were counted, and the average diseased spikelet percentage (PSS) was recorded. PSS = number of diseased spikelets / total number of spikelets × 100%. Sumai 3 and Anong 8455 were used as highly resistant and highly susceptible controls, respectively, while Yangmai 25 was used as a moderately resistant control. Based on the identification results of the plants, 12 plants and 1 plant that were identified as "highly resistant" (average disease spikelet rate ≤25%) were retained. Fhb1 "Highly resistant" individual plants in the heterozygous rows were selected. Then, based on the breeding objectives, the comprehensive agronomic traits and disease resistance of each individual plant in the selected rows were comprehensively examined. The criteria for excellence were plant height less than 90cm, number of spikes per plant greater than or equal to 9, number of spikelets greater than 20, and number of grains per spike greater than or equal to 49. A total of 30 excellent individual plants were selected (Table 1). After harvest, grain weight was identified, and the BC1F4 individual plant with a grain weight level higher than the yield control Yangmai 25 was selected.

[0069] Table 8 BC1F4 carries Fhb1 Results of the selected individual plants from the positive rows

[0070]

[0071] Note: PSS represents the average diseased spikelet rate, and the bolded black text indicates selected individual plants; tiller number refers to the number of tillers per plant.

[0072] 5) Step S5: Plant BC1F4 in the field in Yangzhou to form a plant line. Each plant line is planted in 5 rows with a row length of 2.25m and a row spacing of 0.26m. Each row contains 40 seeds. Single flower drip inoculation is used to identify resistance to Fusarium head blight spread. Sumai 3 and Anong 8455 are used as highly resistant and highly susceptible controls, respectively, and Yangmai 25 is used as a moderately resistant control. Y569-4, Y569-5, Y619-2, Y619-4, Y627-2, Y627-3, Y1001-1, Y1001-3, Y1001-4 and Y1079-4 are selected with resistance levels higher than Sumai 3 (Table 9). The comprehensive agronomic traits and disease resistance of the selected strains were comprehensively examined. After the selected strains were harvested together, grain weight and yield were evaluated. Yangmai 25 was used as a yield control for comparison. In the same year, the grain weight of Yangmai 25 was 49g and the average yield was 569.68kg / mu. The selected strains Y569-4 and Y619-2, which had higher yields than the control Yangmai 25, had average yields of 609.82 kg / mu and 623.52 kg / mu, respectively. The yields were 6.58% and 9.45% higher than Yangmai 25, respectively (Table 9).

[0073] Table 9. Results of variety testing for strains with resistance levels close to Sumai 3.

[0074]

[0075] Note: PSS represents the average percentage of diseased spikelets, and the bolded black ones are selected individual plants.

[0076] 6) In step S6, BC1F5 plots of Y569-4 and Y619-2 were planted in the field as 2-centimeter plots. Based on the breeding objectives, the comprehensive agronomic traits of the varieties in each plot were comprehensively examined. Yield assessment was conducted after harvest, using Yangmai 25 as a yield control. The average yield of Yangmai 25 that year was 579.41 kg / mu, while the average yields of Y569-4 and Y619-2 were 617.91 kg / mu and 619.38 kg / mu, respectively, representing increases of 6.64% and 6.90% compared to Yangmai 25. The results showed that the yields of Y569-4 and Y619-2 were more than 5% higher than the control variety Yangmai 25 in the Yangtze River mid-lower reaches regional trials for two consecutive years. Furthermore, their resistance to Fusarium head blight was significantly higher than that of the Fusarium head blight-resistant variety Sumai 3. Therefore, they can be recommended for multi-point yield assessment trials.

[0077] The high-yielding wheat lines Y569-4 and Y619-2, bred using the method of this invention, are highly resistant to Fusarium head blight and carry Fusarium head blight resistance genes. TaFhb-2DL and Fusarium head blight resistance gene Fhb1 The wheat exhibits stable resistance to Fusarium head blight, reaching a level of "high resistance," which is higher than that of Sumai 3. Its yield is significantly higher than that of the control variety Yangmai 25, contributing to the improvement of wheat quality, yield, efficiency, and green high yield.

[0078] The method described above in this invention first selects individuals carrying the major resistance locus against Fusarium head blight in a natural population through genotyping. QFhb-2DL Using disease-resistant genotypes as parents, and then selecting those carrying the genotype through genotyping. Fhb1 Gene varieties serve as donors, because QFhb-2DL As a stable disease resistance locus, it can be effectively utilized in wheat scab resistance breeding in the middle and lower reaches of the Yangtze River. Further introduction based on this... Fhb1 The gene, as demonstrated in the examples, can significantly improve resistance to Fusarium head blight, even exceeding the level of Sumai 3. Utilizing the Fusarium head blight resistance gene... TaFhb-2DL and Fhb1 By combining gene aggregation with precise identification of Fusarium head blight resistance and agronomic traits, highly resistant Fusarium head blight varieties can be bred rapidly and effectively. The donor gene source used is from common wheat varieties, which are different from resistance sources with poor agronomic traits such as Sumai 3 and Wangshuibai, and can be quickly utilized in breeding. Research has shown that aggregation... TaFhb-2DL and Fhb1 Both resistance genotypes can significantly enhance resistance to Fusarium head blight. Therefore, these two resistance loci can be used to efficiently breed varieties highly resistant to Fusarium head blight.

[0079] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0080] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0081] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A molecular marker linked to wheat resistance to Fusarium head blight, characterized in that, The nucleotide sequence of this molecular marker is shown in SEQ ID NO.3, which has a C / T mutation at base 42.

2. The molecular marker according to claim 1, characterized in that, Also includes Fhb1 The chain GSM mark.

3. The primers used to detect the molecular markers of claim 1, characterized in that, This includes the forward primers shown in SEQ ID NO.4 and SEQ ID NO.5, and the reverse primer shown in SEQ ID NO.

6.

4. The primers used to detect the molecular markers of claim 2, characterized in that, TaFhb-2DL The primers used for KASP markers of genes include the forward primers shown in SEQ ID NO.4 and SEQ ID NO.5, and the reverse primer shown in SEQ ID NO.6; Fhb1 The primers used for the linked GSM markers include the forward primer shown in SEQ ID NO.1 and the reverse primer shown in SEQ ID NO.

2.

5. A molecular breeding method for selecting varieties highly resistant to Fusarium head blight, characterized in that, Includes the following steps: Step S1: Using single-flower drip irrigation and soil application of diseased wheat grains, selected wheat varieties were assessed for resistance to Fusarium head blight spread, infection, and yield, screening for varieties resistant to Fusarium head blight and with high yield potential. DNA was extracted from seeds or seedling leaves of these varieties and used... TaFhb-2DL The linkage markers of the gene clearly carry the resistance locus to Fusarium head blight. QFhb-2DL Varieties, additional testing Fhb1 Linked markers clearly indicate that they also carry genes for resistance to Fusarium head blight. Fhb1 The varieties were planted in an artificial climate chamber, crossbred, and F0 hybrids were harvested; F0 hybrids were obtained by planting F0 hybrids in an artificial climate chamber, and F1 was obtained by crossing F1 with Yangmai 14 to harvest BC1F1 seeds. Step S2: Plant BC1F1 seedlings. Once seedlings emerge, extract DNA from leaves for further processing. TaFhb-2DL Linkage marker detection of the gene was performed, and BC1F1 single plants that were homozygous for positive results at all of these loci were selected and BC1F2 plants were harvested. Step S3, select BC1F2 in the planting, and use... Fhb1 Linkage marker detection was used to select BC1F2 single plants that were positive (heterozygous or homozygous) at all loci for screening of tillering ability, lodging resistance, growth period and disease resistance. BC1F3 seeds were then harvested. Step S4: Plant BC1F3 seedlings. During the seedling stage, randomly select leaves from individual plants, mix them, extract DNA, and utilize... Fhb1 Linkage markers were used to detect BC1F3 in row-wide pools. For rows where the pool test results were heterozygous, further individual gene testing was performed to determine the genotype of individual BC1F3 plants, and plants carrying the markers were screened. Fhb1 Homozygous positive and heterozygous positive plant rows; during the flowering period of wheat, BC1F3 was inoculated with Fusarium head blight pathogen by drip inoculation of single flowers. 21 days after inoculation, the disease incidence of the inoculated ears was investigated. Plant rows and individual plants with the identification result of "high resistance" were retained. Then, according to the breeding objectives, the comprehensive agronomic traits and disease resistance of each individual plant in the selected plant rows were comprehensively examined. After harvest, grain weight was identified, and BC1F4 individual plants with a grain weight level higher than the yield control were selected. Step S5: Plant BC1F4 to form a line. Continue to use single-flower drip inoculation to identify resistance to Fusarium head blight spread and screen for lines with resistance levels higher than Sumai 3. Comprehensively examine the integrated agronomic traits and disease resistance of the selected lines. Harvest the selected lines together and conduct grain weight and yield identification after harvest. Select lines with yield levels higher than the yield control. Step S6: Select BC1F5 as a plot and comprehensively examine the agronomic traits of the varieties in the plot according to the breeding objectives. After harvest, conduct yield identification. If the yield of the selected BC1F5 is more than 5% higher than that of the control variety for two consecutive years, and its resistance to Fusarium head blight exceeds that of the Fusarium head blight resistant variety Sumai 3, it can be recommended to enter the multi-point yield identification test. in, TaFhb-2DL The linkage marker for the gene is as described in claim 1. TaFhb-2DL KASP markers of genes, Fhb1 The chain mark is as described in claim 2. Fhb1 The linked GSM markers used are the primer sets described in claim 4.

6. The breeding method according to claim 5, characterized in that, In step S1, the method for identifying resistance to spread is as follows: prepare a 4×10⁴ gibberellic acid spore suspension. 5 ~5×10 5 Spores / mL. During the wheat flowering period, the florets in the middle of the single ear of a marked plant were individually inoculated with the pathogen of Fusarium head blight by drip inoculation and marked. After inoculation, water was sprayed on the inoculated ear every 2 hours from 8:30 to 17:30 every day, spraying evenly on the wheat ear for 10 minutes each time. Spraying was stopped immediately 20 days after the wheat flowering. 21 days after inoculation, the disease status of the inoculated ears was investigated. Sumai No. 3 and Anong 8455 were used as highly resistant and highly susceptible controls, respectively. The method for identifying resistance to infection is as follows: Prepare a suspension of 2×10⁻⁶ gibberellic acid spores. 5 ~3×10 5 Spray a fixed number of marked individual plants with Fusarium graminearum spores / mL during the wheat flowering period. After 21 days, investigate the disease incidence rate of spikelets and spikelets of the plants that have been sprayed with spores in this area to identify the resistance to Fusarium graminearum infection. Sumai No. 3 and Anong 8455 were used as highly resistant and highly susceptible controls, respectively. The yield assessment method is as follows: plant height, growth period, number of ears per plant, number of grains per ear, and thousand-grain weight are mainly assessed. Yangmai 25 is used as a control. After three years of assessment on resistance to Fusarium head blight infection and spread, agronomic traits and yield are assessed to screen out varieties that are resistant to Fusarium head blight and have high yield potential. DNA was extracted from seeds or seedling leaves of the above varieties using the CTAB method. TaFhb-2DL The linkage markers of the gene clearly show that the following varieties carry the Fusarium head blight resistance locus: Yangmai 11, Yangmai 14, Yangmai 17, Yangmai 18, Yangmai 39, Ningmai 13, Ningmai 26, Zhenmai 12, Zhenmai 5, Zhenmai 6, and Shengxuan 6. QFhb-2DL Additional testing Fhb1 The linkage markers clearly indicate that Yangmai 18 and Ningmai 13 also carry genes that resist Fusarium head blight. Fhb1 Yangmai 14 and Ningmai 13 were selected as parents and planted in an artificial climate chamber for hybridization. F0 hybrids were harvested to obtain F1. F1 was then hybridized with Yangmai 14 to obtain BC1F1 seeds.

7. The breeding method according to claim 5, characterized in that, In step S3, the screening methods for tillering, lodging resistance, growth period, and disease resistance of the BC1F2 generation are as follows: for disease resistance, Yangmai 25 is used as the standard, and individual plants with worse disease resistance than Yangmai 25 are eliminated; for tillering and growth period, Yangmai 25 is used as the control, and individual plants with fewer tillers per plant and later growth period than Yangmai 25 are eliminated; for lodging resistance, plant height, stem elasticity, and lodging resistance are examined, and individual plants that are prone to lodging, have poor elasticity, and are taller than 90cm are eliminated.

8. The breeding method according to claim 5, characterized in that, In steps S4 and S5, the method for inoculating individual flowers with the Fusarium head blight pathogen during the flowering period is as follows: Prepare a Fusarium head blight spore suspension of 4×10⁻⁶ mm². 5 ~5×10 5 Spores / mL, in the field, during the wheat flowering period, the single-flower drip inoculation method was used. 20 ears were randomly selected from each row or line, and inoculated at the open florets in the middle of each ear, and marked. After inoculation, water was sprayed on the inoculated ears every 2 hours from 8:30 to 17:30 every day, spraying evenly and thoroughly onto the wheat ears for 10 minutes each time. Watering was stopped immediately 20 days after the wheat flowering. 21 days after inoculation, the disease incidence of the inoculated ears was investigated, counting the number of diseased spikelets per ear and the total number of spikelets. Rows or individual plants with an average diseased spikelet rate ≤25% were retained. Sumai 3 and Anong 8455 were used as highly resistant and highly susceptible controls, respectively, Yangmai 25 as a moderately resistant control, and Yangmai 13 as a moderately susceptible control.

9. The breeding method according to claim 5, characterized in that, In steps S4, S5, and S6, the method for comprehensively examining the integrated agronomic traits of the selected plants, strains, and varieties is as follows: the standard for excellence is a plant height of less than 90cm, and among the yield factors, the number of panicles per plant is greater than or equal to 9, the number of spikelets is greater than 20, and the number of grains per panicle is greater than or equal to 49.

10. The breeding method according to claim 5, characterized in that, In steps S4, S5 and S6, the yield control is Yangmai 25.

Citation Information

Patent Citations

  • Method for cultivating high-yield wheat capable of resisting gibberellic disease in Huanghuai wheat area based on polygene polymerization

    CN113179884A

  • Molecular marker-assisted breeding method of gibberellic disease-resistant high-yield wheat

    CN113273489A