A kit and method for rapid detection of silkworms based on RPA-CRISPR / Cas

Abstract

The present invention discloses a kit and method for rapid detection of silkworm flowers based on RPA-CRISPR / Cas, wherein the Cas protein is Cas12, and the kit includes an RPA primer combination F2 / R3 and sgRNA3. The detection method of the present invention utilizes the kit for detection, comprising the steps of: S1. extracting the DNA of the sample to be tested; S2. RPA amplification: preparing an RPA reaction system, amplifying the DNA of the sample to be tested obtained by the above extraction by the RPA method to obtain an amplified product; S3. CRISPR / Cas system reaction detection: taking the above amplified product, adding a fluorescent reporter probe, Cas12 protein and sgRNA, performing CRISPR reaction detection, and reading the detection signal. The method of the present invention can realize the rapid on-site distinction between silkworm flowers and closely related cross species, and effectively identify adulterated raw materials or mixed counterfeit ingredients in sea buckthorn plant products.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular detection and identification, and particularly to a kit and method for rapid detection of silkworms based on RPA-CRISPR / Cas. Background Art

[0002] Rosa roxburghii (Rosa roxburghii Tratt.), also known as the prickly pear, is a perennial deciduous shrub of the genus Rosa in the Rosaceae family. It is primarily distributed in Yunnan, Guizhou, Sichuan, and Hunan. Guizhou is the most abundant and produces the highest annual yield of roxburghii, making it a key economic crop for both medicinal and edible uses in Guizhou Province. Its fruit is rich in a variety of nutrients and bioactive components, including vitamins, amino acids, phenols, and flavonoids. Its vitamin C, vitamin P, and superoxide dismutase levels are particularly high among fruits and vegetables, earning it the nickname "King of Vitamin C" or "Three Kings Fruit." With the continuous advancement of research into the botanical properties and bioactive components of roxburghii, numerous products using roxburghii as raw material have been developed. As a dual-use medicinal and edible plant, it has been included in the "Guizhou Province Quality Standards for Traditional Chinese and Ethnic Medicinal Materials" (2003 edition) and the Ministry of Health's New Food Resource Variety (Announcement No. 17, 2004). Currently, it is undergoing extensive research and development as a key dual-use medicinal and edible plant resource. With increasing demand, the supply-demand imbalance in the market is becoming increasingly severe.

[0003] In recent years, identification techniques for plant-derived ingredients have mostly been limited to laboratory procedures, relying on expensive equipment or requiring complex analysis by specialized personnel, failing to meet the demand for accurate and rapid identification of plant-derived ingredients. The CRISPR system, a novel gene-editing technology, has been adapted into an ultrasensitive nucleic acid detection tool due to its trans-cleavage and highly specific sequence recognition capabilities. Currently, the CRISPR system has been applied to viral and bacterial diagnosis and the identification of porcine-derived ingredients, but research on the identification of plant-derived ingredients is rare.

[0004] The combined use of RPA and CRISPR for dual-specific recognition of target genes can significantly improve detection specificity. Both the RPA and CRISPR cleavage systems are performed at 37°C. Human body temperature, USB-powered incubators, constant-temperature heaters, and other devices can provide the required temperature, eliminating the need for complex temperature control equipment. Currently, there are few reports on the combined use of RPA and CRISPR for the identification of silkworms. Summary of the Invention

[0005] The purpose of the present invention is to address the above-mentioned problems and provide a kit and method for rapid detection of silkworms based on RPA-CRISPR / Cas.

[0006] In order to achieve its purpose, the present invention adopts the following technical solutions:

[0007] The first aspect of the present invention provides a kit for rapid detection of silkworms based on RPA-CRISPR / Cas, wherein the Cas protein is Cas12, and the kit includes RPA primers and sgRNA, wherein the RPA primers are primer combination F2 / R3, and the sequence is as follows:

[0008] F2: 5'-GCCACGACAATCGGTGGTTGTCAAACCTCG-3',

[0009] R3: 5'-GAAAGCATCGACGGATCGACACGTATTAT-3',

[0010] The sgRNA is sgRNA3, and its sequence is:

[0011] GUCUAAAGGACAGAUUUUCACGGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAA AGCCCGUUGAACUUCAAGCGAAGUGGCACCUGUCGUGCGAUCGUGUUGA.

[0012] Preferably, the kit further comprises a fluorescent reporter probe, and preferably the sequence of the fluorescent reporter probe is: 5'-FAM-TTTTTTT-BHQ1-3'.

[0013] Preferably, the kit further comprises an RPA amplification reagent, and the RPA amplification reagent comprises: RPA enzyme and magnesium acetate.

[0014] Preferably, the kit further comprises a CRISPR / Cas detection reagent, wherein the CRISPR / Cas detection reagent comprises: a Cas12b protein, wherein the Cas12b protein is selected from AaCas12b, AacCas12b, and BrCas12b.

[0015] The second aspect of the present invention provides use of any of the above-mentioned kits in detecting silk flowers.

[0016] A third aspect of the present invention provides a method for rapid detection of silkworms based on RPA-CRISPR / Cas, which is performed using any of the above-mentioned kits, comprising the following steps:

[0017] S1. Extract DNA from the sample to be tested;

[0018] S2.RPA amplification: Prepare an RPA reaction system and amplify the DNA of the sample to be tested obtained by the above extraction method to obtain an amplified product;

[0019] S3. CRISPR / Cas system reaction detection: Take the above amplified product, add fluorescent reporter probe, Cas12 protein and sgRNA, perform CRISPR reaction detection, and read the detection signal.

[0020] Preferably, in the detection method, the RPA amplification reaction system comprises a buffer, ddH2O, upstream and downstream primers, RPA enzyme lyophilized powder, template DNA, and magnesium acetate; the RPA amplification reaction conditions are: 37-45°C for 10-30 minutes;

[0021] The reaction system of the CRISPR / Cas system reaction includes: 10×AaCas12b Buffer, AaCas12b, template, fluorescent reporter probe and sgRNA; the reaction conditions of the CRISPR / Cas system are: 37-45° C. for 5-30 minutes.

[0022] Preferably, the components of the RPA amplification reaction system are prepared in the following proportions: 30-36 μL of buffer, 3-5 μL of 350 mM magnesium acetate, 3-5 μL of 10 μM upstream primer, 3-5 μL of 10 μM downstream primer, 3-7 μL of DNA template, and RPA enzyme lyophilized powder;

[0023] The ratio of each component of the reaction system of the CRISPR / Cas system reaction is prepared according to the following proportions: RPA reaction product 0.8-1.2 μL, 10×AaCas12b Buffer 2-3 μL, 2.5 μM AaCas12b 1.5-2.5 μL, ssDNA fluorescent reporter probe 0.4-0.6 μL and 100 ng / μL sgRNA 0.8-1.2 μL, and ddH2O is supplemented to 25 μL.

[0024] Further preferably, in the detection method, the components of the RPA amplification reaction system are prepared in the following proportions: 33 μL of buffer, 4 μL of 350 mM magnesium acetate, 4 μL of 10 μM upstream primer, 4 μL of 10 μM downstream primer, 5 μL of DNA template, and RPA enzyme lyophilized powder; the reaction conditions are incubation at 39° C. for 20 min;

[0025] The components of the reaction system of the CRISPR / Cas system reaction were prepared in the following proportions: 1 μL of RPA reaction product, 2.5 μL of 10×AaCas12b Buffer, 2 μL of 2.5 μM AaCas12b, 0.5 μL of ssDNA fluorescent reporter probe, and 1 μL of 100 ng / μL sgRNA, and ddH2O was added to 25 μL. The reaction conditions were set to 43°C for 30 min in a qPCR instrument, and the FAM channel fluorescence signal was collected once every minute.

[0026] Preferably, the detection signal is read by using a real-time quantitative PCR instrument to read the fluorescence signal.

[0027] The beneficial effects of the present invention are:

[0028] The present invention targets the silkworm orchid and develops a silkworm orchid rapid detection kit and detection method based on recombinase polymerase amplification (RPA) technology combined with clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated enzyme systems (Cas proteins) - CRISPR / Cas12. By designing the sgRNA (single-stranded guide RNA) sequence, the bound Cas12 is guided to cut specific gene sites, thereby further increasing the specificity and sensitivity of the detection on the basis of RPA. The kit has extremely high detection sensitivity, can react under constant temperature conditions, and does not require complex instruments and equipment.

[0029] The RPA-CRISPR combined method for the specific detection of rosa centifolia species established in this paper can rapidly distinguish rosa centifolia from closely related species on-site. This method provides a theoretical basis and technical support for the effective identification of adulterated raw materials or counterfeit ingredients in rosa centifolia plant products, as well as for the quality testing and evaluation of rosa centifolia products. This method further enhances the comprehensive inspection and testing capabilities of rosa centifolia products, better serves industry supervision, and ensures the quality and safety of rosa centifolia products. It is of great significance for maintaining normal market production and operation order and protecting consumer rights. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The SNP site analysis and sgRNA primer design position are shown, where the black box is the SNP site and the green box is the sgRNA3 design position.

[0031] Figure 2 Results of sgRNA1 specificity detection: A. Fluorescence growth curve, B. Fluorescence growth rate.

[0032] Figure 3 Results of sgRNA2 specificity detection: A. Fluorescence growth curve, B. Fluorescence growth rate.

[0033] Figure 4 Results of sgRNA3 specificity detection: A. Fluorescence growth curve, B. Fluorescence growth rate.

[0034] Figure 5 is the fluorescence amplification curve of the RPA primer set (NTC is the negative control).

[0035] Figure 6 This is the specificity verification result of the RPA-CRISPR system of silk flower. In the figure, Sample 1, 2, and 3 are samples S1-3 in Table 1, and Sample 4-12 are samples S4-12 in Table 1 respectively.

[0036] Figure 7 The sensitivity test results of the RPA-CRISPR system of silkworm are shown in the figure. In the figure, 1E1 ng / μL, 1E0 ng / μL, 1E-1ng / μL, 1E-2ng / μL, 1E-3ng / μL, 1E-4ng / μL, and 1E-5ng / μL represent 10 1 , 10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 ng / μL of sample. DETAILED DESCRIPTION

[0037] The present invention will be further described below with reference to the embodiments, but the present invention is not limited thereto.

[0038] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0039] Example 1

[0040] 1. Experimental Materials and Main Reagents

[0041] 1. Experimental Materials

[0042] Table 1 lists the samples of the silkworm flowers used in the experiment, along with their closely related and easily confused species. All samples were collected by our laboratory. All samples were identified using morphological and molecular methods before testing.

[0043] Table 1 Experimental materials

[0044] Sample number Chinese name Latin name source S1 Silk Flower Rosaroxburghii Zhejiang S2 Silk Flower Rosaroxburghii Zhejiang S3 Silk Flower Rosaroxburghii Guizhou S4 Rosa laevigata Rosalaevigata Sichuan S5 Rosa laevigata Rosalaevigata Guangxi S6 Rosa laevigata Rosalaevigata Jiangxi S7 Rosa laevigata Rosalaevigata Hunan S8 Wild Rose Rosamultiflora Beijing S9 Wild Rose Rosamultiflora Zhejiang S10 Emei rose Rosaomeiensis Gansu S11 Emei rose Rosaomeiensis Shaanxi S12 Umbrella rose Rosamaximowicziana Jiangxi

[0045] 2. Main reagents

[0046] The primers used for RPA amplification were synthesized by Sangon Biotech (Shanghai) Co., Ltd.;

[0047] All sgRNAs and CRISPR detection probes were synthesized by Beijing Xunshi Technology Co., Ltd.;

[0048] RPA amplification kit: SynSor DNA / RNA constant temperature rapid amplification reagent kit (catalog number: XS-R-101) from Beijing Xunshi Biotechnology Co., Ltd. (China) was used;

[0049] The CRISPR / Cas12b detection system used SynSorAaCas 12b (C2c1) (Cat. No.: XS-R-002) nuclease and supporting reagents from Beijing Xunshi Biotechnology Co., Ltd. (China).

[0050] 2. SNP site analysis and sgRNA primer design

[0051] 1. DNA extraction

[0052] To extract DNA from the experimental materials listed in Table 1, 100 mg of silica gel-dried plant leaves were placed in a 2 ml Eppendorf tube pre-filled with 4 mm steel beads. The tubes were quickly frozen in liquid nitrogen for 30 minutes. The tubes were then placed in a Geno / Grinder 2000 (SPEX SamplePrep) high-throughput grinder and ground for 3 minutes at 1000 rpm / min. Total DNA from the leaves was extracted using the Qiagen DNA extraction kit.

[0053] 2. Nucleic acid sequence preparation

[0054] ITS2 sequences were obtained by amplifying DNA from the silkworms and their closely related and easily confused species listed in Table 1. The amplification primer sequences were ITS2F (SEQ ID NO. 1): 5'-ATGCGATACTTGGTGTGAAT-3'; ITS2R (SEQ ID NO. 2): 5'-GACGCTTCTCCAGACTACAAT-3'.

[0055] The partial sequence of the ITS2 of the chloroplast of the silkworm obtained by amplification and sequencing (SEQ ID NO. 3) is as follows (the underlined bold bases in the sequence are SNP sites between the silkworm and other species):

[0056]

[0057] The partial sequence of chloroplast ITS2 (SEQ ID NO. 4) obtained by amplification and sequencing of samples S4-S7 of Rosa laevigata in Table 1 is as follows:

[0058] CACGTCGTTGCCCCCCCCAACCCCCTCGGGAGTTGGATGGGACGGATGATGGCCTCCCGTGTGCTCAGTCACGCGGTTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTTCCTGTCGTGCGCGTGTTGATCGAGTGCTTTCTTAAATAATGCGTGTCGATCCGTCGATGCTTTCAACG.

[0059] The partial sequence of chloroplast ITS2 (SEQ ID NO. 5) obtained by amplification and sequencing of sample S8-S9 wild rose in Table 1 is as follows:

[0060] CACGTCGTTGCCCCCCCCAACCCCCTCGGGAGTTGGGATGGACGGATGATGGCCTCCCGTGTGCTCAGTCACGCGGTTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTTCCTGTCGTGCGCGTCTGTTGATCGAGTGCTTTCTTAAACAATGCGTGTCGATCCGTCGATGCTTTCAACG.

[0061] The partial sequence of chloroplast ITS2 obtained by amplification and sequencing of sample S10-S11 Emei rose in Table 1 (SEQ ID NO. 6) is as follows:

[0062] CACGTCGTTGCCCCCCCCAATCCCCTCGGGAGTTGGATGGGACGGATGATGGCCTCCCGTGTGCTCAGTCACGCGGTTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTTCCTGTCGTGCGCGTGTTGATCGAGTGCTTTCTTAAACAATGCGTGTCGATCCGTCGATGCTTTCAACG.

[0063] The partial sequence of chloroplast ITS2 (SEQ ID NO. 7) obtained by amplification and sequencing of sample S12 Rosa umbellata in Table 1 is as follows:

[0064] CACGTCGTTGCCCCCCCCAACCCCCTCGGGAGTTGGATGGGACGGATGATGGCCTCCCGTGTGCTCAGTCACGCGGTTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTTCCTGTCGTGCGCGTCTGTTGATCGAGTGCTTTCTTAAACAATGCGTGTCGATCCGTCGATGCTTTCAACG.

[0065] 3. SNP site analysis and sgRNA primer design

[0066] The ITS2 sequences amplified from each species were compared and analyzed using BioEdit software. At the same time, the sequences of Rosa roxburghii (Genbank numbers FJ358704.1 and MH711604.1) were downloaded from Genbank and compared together to find sequence sites with stable differences, such as Figure 1 As shown, the ITS2 sequence of Rosa roxburghii (Genbank No. MH711604.1) has a T at position 634 while other species have a G, and an A at position 664 while other species have a G.

[0067] Targeting sequences containing the CRISPR-Cas12b recognition sequence (PAM) TTN were identified. Based on the PAM location, sgRNA primers were designed within the SNP differential loci using CRISPR software (http: / / crispor.tefor.net / ) and Bioedit (Table 2). The designed sgRNA spacer sequences were analyzed for coverage and specificity using NCBI BLAST. The alignment results showed that the designed sgRNA spacer sequences achieved 100% coverage across the tested species, demonstrating good specificity.

[0068] Table 2 sgRNA sequence information

[0069]

[0070]

[0071] *Note: The underlined part of the sequence in Table 2 is the spacer region of sgRNA

[0072] 4. sgRNA specificity screening

[0073] (1) Template preparation

[0074] Using the diluted sample DNA from Table 1 as a template, PCR amplification was performed using the PCR primers ITS2F / ITS2R according to the recommended system in the Qingke reagent manual to obtain a high-concentration PCR product. The specific amplification system is shown in Table 3, and the corresponding PCR reaction procedure is shown in Table 4:

[0075] Table 3 PCR system

[0076] Components volume Final concentration 1.1×Gold Medal Mix (Green) 44μL 1× 10 μM upstream primer 2μL 0.4μM 10 μM downstream primer 2μL 0.4μM Template DNA (1 ng / μL) 2μL 2ng Total volume 50uL /

[0077] Table 4 PCR reaction program

[0078]

[0079] (2) sgRNA screening

[0080] Use the PCR product prepared in (1) as a template for sgRNA screening. Use the system in Table 5 to configure the CRISPR reaction system.

[0081] Table 5 CRISPR system

[0082]

[0083]

[0084] The sequence of the ssDNA fluorescent reporter probe is: 5'-FAM-TTTTTTT-BHQ1-3'.

[0085] Set the qPCR instrument to 43°C for 30 minutes, collecting the FAM channel fluorescence signal every minute. Perform preliminary verification of sgRNA specificity based on the fluorescence signal curve.

[0086] The results showed that neither sgRNA1 nor sgRNA2 could achieve specific differentiation between Rosa roxburghii samples and closely related cross species ( Figure 2 , 3); while the specificity of sgRNA3 target was good, and only 3 samples of Rosa roxburghii had amplification curves ( Figure 4 ), no detection phenomenon was found in other species, and sgRNA3 will be used to screen RPA primers in the future.

[0087] 3. RPA Primer Design

[0088] RPA primers were designed on either side of the selected, highly effective sgRNA3. A total of three upstream primers and three downstream primers were designed. The primer sequences are shown in Table 6. Different combinations of RPA primers were screened. A two-step CRISPR inverse reaction was used. The first step was an RPA amplification reaction. The reaction system was based on the kit instructions. The specific ratios were: 33 μL of buffer, 4 μL of 350 mM magnesium acetate, 4 μL of 10 μM upstream primer, 4 μL of 10 μM downstream primer, 5 μL of DNA template, and lyophilized RPA enzyme powder. The reaction was incubated at 39°C for 20 min.

[0089] In the second step, the RPA amplified product was used as a template and mixed with the CRISPR reaction solution to perform the CRISPR reaction. The reaction system is shown in Table 5.

[0090] Table 6 RPA primer design

[0091] Primers Primer sequence (5'-3') SEQ ID NO RPA-F1 GTCACGCGGTTGGCATAAATACCAAGTC SEQ ID NO.11 RPA-F2 GCCACGACAATCGGTGGTTGTCAAACCTCG SEQ ID NO.12 RPA-F3 CCTCGGCGACCAACGCCACGACAATCGG SEQ ID NO.13 RPA-R1 CGACGGATCGACACGTATTATTTAAGAAAGCACTC SEQ ID NO.14 RPA-R2 CGACGGATCGACACGTATTATTTAAGAAA SEQ ID NO.15 RPA-R3 GAAAGCATCGACGGATCGACACGTATTAT SEQ ID NO.16

[0092] The results of primer screening were as follows Figure 5 As shown, among all RPA primer combinations F1 / R1, F1 / R2, F1 / R3, F2 / R1, F2 / R2, F2 / R3, F3 / R1, F3 / R2, and F3 / R3, the fluorescence signal of F2 / R3 RPA primer increased the fastest. Finally, RPA-F2 and RPA-R3 were selected as upstream and downstream primers for subsequent experiments.

[0093] 4. Specificity detection of the RPA-CRISPR system for silkworms

[0094] Using the 12 sample DNAs listed in Table 1 as templates, perform RPA amplification using the screened RPA primers F2 / R3. The RPA reaction system and conditions are the same as those described in "III. RPA Primer Design." Take the RPA reaction product, select sgRNA3 as the sgRNA, and prepare the CRISPR system shown in Table 5. Place the product in a qPCR instrument and set the PCR cycle to 43°C for 30 minutes, collecting the FAM channel fluorescence signal every minute.

[0095] result( Figure 6 ) showed that only three samples of Rosa roxburghii had fluorescence, while the other samples did not. This indicates that the detection method established in this experiment has good specificity and can effectively distinguish the target species.

[0096] 5. Sensitivity Detection of the Silk Flower RPA-CRISPR System

[0097] The extracted DNA of sample S1 was diluted to a concentration of 10 ng / uL, and then a 10-fold proportional gradient dilution was performed. 1 , 10 0 , 10-1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 A total of 6 concentrations were used, and the experiment was conducted according to the reaction system and method described in the previous section "IV. Specificity detection of the RPA-CRISPR system of silk flower".

[0098] The results are as follows Figure 7 As shown: The detection sensitivity of the silk flower RPA-CRISPR system of the present invention is 1×10 -5 ng / μL (10fg / μL).

Claims

1. A kit for rapid detection of silkworms based on RPA-CRISPR / Cas, characterized by: The Cas protein is Cas12b, and the kit includes RPA primers and sgRNA. The RPA primers are primer combination F2 / R3, and the sequence is as follows: F2: 5'-GCCACGACAATCGGTGGTTGTCAAACCTCG-3', R3: 5'-GAAAGCATCGACGGATCGACACGTATTAT-3', The sgRNA is sgRNA3, and its sequence is: GUCUAAAGGACAGAUUUUCACGGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAACUUCAAGCGAAGUGGCACCUGUCGUGCGAUCGUGUUGA.

2. The kit according to claim 1, wherein: The kit also includes a fluorescent reporter probe.

3. The kit according to claim 1, wherein: The kit further comprises an RPA amplification reagent, which comprises: RPA enzyme and magnesium acetate.

4. The kit according to claim 1, wherein: The Cas12b protein is selected from AaCas12b, AacCas12b or BrCas12b.

5. Use of the kit according to any one of claims 1 to 4 in detecting silk reeling flowers.

6. A method for rapid detection of silkworms based on RPA-CRISPR / Cas, characterized in that: Detection using the kit according to any one of claims 1 to 4 comprises the following steps: S1. Extract DNA from the sample to be tested; S2.RPA amplification: Prepare an RPA reaction system and amplify the DNA of the sample to be tested obtained by the above extraction method to obtain an amplified product; S3. CRISPR / Cas system reaction detection: Take the above amplified product, add fluorescent reporter probe, Cas12b protein and sgRNA, perform CRISPR reaction detection, and read the detection signal.

7. The detection method according to claim 6, characterized in that: The RPA amplification reaction system includes a buffer, ddH2O, upstream and downstream primers, RPA enzyme lyophilized powder, template DNA and magnesium acetate; the RPA amplification reaction conditions are: 37-45°C for 10-30 min; The reaction system of the CRISPR / Cas system reaction includes: 10×AaCas12b Buffer, AaCas12b, template, fluorescent reporter probe and sgRNA; the reaction conditions of the CRISPR / Cas system are: 37~45°C for 5~30 min.

8. The detection method according to claim 7, wherein: The components of the RPA amplification reaction system are: 30-36 μL of buffer, 3-5 μL of 350 mM magnesium acetate, 3-5 μL of 10 μM upstream primer, 3-5 μL of 10 μM downstream primer, 3-7 μL of DNA template and RPA enzyme lyophilized powder; The reaction system components of the CRISPR / Cas system reaction are: RPA reaction product 0.8-1.2 μL, 10×AaCas12b Buffer 2-3 μL, 2.5 μM AaCas12b 1.5-2.5 μL, ssDNA fluorescent reporter probe 0.4-0.6 μL and 100 ng / μL sgRNA 0.8-1.2 μL, and ddH2O is added to 25 μL.

9. The detection method according to claim 8, wherein: The components of the RPA amplification reaction system are: 33 μL of buffer, 4 μL of 350 mM magnesium acetate, 4 μL of 10 μM upstream primer, 4 μL of 10 μM downstream primer, 5 μL of DNA template and RPA enzyme lyophilized powder; the reaction conditions are incubation at 39°C for 20 min; The reaction system components of the CRISPR / Cas system reaction were: 1 μL of RPA reaction product, 2.5 μL of 10×AaCas12b Buffer, 2 μL of 2.5 μM AaCas12b, 0.5 μL of ssDNA fluorescent reporter probe, and 1 μL of 100 ng / μL sgRNA, supplemented with ddH2O to 25 μL; the reaction conditions were set at 43°C for 30 min on a qPCR instrument, and the FAM channel fluorescence signal was collected once per minute.

10. The detection method according to claim 6 or 7, characterized in that: The detection signal is read by using a real-time quantitative PCR instrument to read the fluorescence signal.

Images