KASP molecular markers for screening heat-tolerant wheat and their applications

By developing KASP molecular markers DQK015 and DQK016, single nucleotide polymorphism detection of TaCOBL6A2 gene has been solved in the existing technology to screen high-temperature-resistant wheat varieties, achieving efficient screening and heat resistance improvement, and enhancing the growth ability of wheat at high temperatures.

CN119955980BActive Publication Date: 2025-07-08CROP INST SICHUAN PROVINCE ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510441409.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-09
Publication Date
2025-07-08
Estimated Expiration
2045-04-09

AI Technical Summary

Technical Problem

The prior art lacks molecular markers for fast and accurate screening of high-temperature-resistant wheat varieties, which affect wheat yield and quality, and wheat heat tolerance is a complex quantitative trait controlled by multiple genes.

Method used

KASP molecular markers DQK015 and DQK016 were developed. By detecting the single nucleotide polymorphism of the TaCOBL6A2 gene, PCR amplification and fluorescence detection were performed using a combination of specific fluorescence sequences and primers to screen out high-temperature-resistant wheat varieties.

Benefits of technology

It has achieved efficient and reliable screening of high-temperature-resistant wheat varieties, improved the heat resistance of wheat, enhanced antioxidant enzyme activity, and improved the growth performance of wheat under high temperature conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119955980B_ABST
    Figure CN119955980B_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of molecular breeding, and discloses a KASP molecular marker for screening heat-tolerant wheat and its application. This molecular marker can be used in products for detecting the heat tolerance of wheat. The products for detecting the heat tolerance of wheat include: (1) The primer combination of the KASP molecular marker DQK015 includes. The present invention provides molecular markers DQK015 and DQK016 for screening heat-tolerant wheat varieties. The nucleotide sequence of the natural variation site detected by DQK015 is shown in SEQ ID NO.1, and the nucleotide sequence of the natural variation site detected by DQK016 is shown in SEQ ID NO.2. By detecting the single nucleotide polymorphisms of the TaCOBL6A2 (also known as TaCOBL-A12) gene in different wheat varieties, the present invention identifies excellent haplotypes of TaCOBL6A2 and develops related molecular markers DQK015 and DQK016. The KASP molecular markers DQK015 and DQK016 provided by the present invention can accurately identify heat-tolerant wheat haplotypes, and have the advantages of rapidity, convenience, low cost and high throughput, which are convenient for screening heat-tolerant wheat germplasm and breeding utilization.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular breeding, and specifically provides a KASP molecular marker for screening heat-tolerant wheat and its application. Background Art

[0002] As one of the three major staple food crops in China, the yield stability of wheat is directly related to China's food security strategy. As a cool-season crop originating from the Fertile Crescent in West Asia, wheat has poor adaptability to high-temperature conditions. With the intensification of global warming, frequent extreme high-temperature events have posed a major threat to wheat production. It is estimated that for every 1 °C increase in global temperature, the wheat yield may decrease by 6%. When the temperature of wheat is above 32 °C, the chlorophyll content decreases sharply, and 34 °C is the critical temperature for severe heat stress. After wheat flowering, it often encounters temperatures above 32 °C. Heat stress causes the photosynthetic efficiency of wheat leaves to decrease, the aging of plants to intensify, the grain filling time to shorten, the grain weight to decrease, and the wheat to mature prematurely, directly affecting the yield and quality of wheat. In the main wheat-producing areas, dry hot winds formed by high temperature accompanied by drought frequently appear during the grain filling period of wheat, resulting in a 10-20% reduction in wheat yield, warning that heat-tolerant wheat breeding is urgent. Molecular marker-assisted selection is one of the important means of crop molecular breeding, and is currently mostly used for screening genes related to important traits such as disease resistance, stress tolerance, yield, and quality. Wheat heat tolerance is a complex quantitative trait controlled by multiple genes, but there is currently a lack of efficient molecular marker development related to wheat heat tolerance. Therefore, there is an urgent need for a molecular marker that can quickly and accurately screen heat-tolerant wheat varieties. Summary of the Invention

[0003] The purpose of the present invention is to provide a functional marker and a marker detection method for the wheat heat-tolerance gene TaCOBL6A2 (gene ID: TraesCS6A03G0962500) to solve the deficiencies of the prior art.

[0004] The present invention provides the following technical solutions: The present invention provides KASP markers DQK015 and DQK016 for screening heat-tolerant wheat varieties. The physical position of the natural variation site s6A_603206452 detected by DQK015 is chr6A:603206452, and the nucleotide sequence SEQ ID NO.1 flanking the variation site is: CACCCCCACCGGACGGACGGAAGTCACGG[T / C]GCGCCTCCGTGTCTCGTCGCAGCCCACCACCTGC. The physical position of the natural variation site s6A_603206559 detected by DQK016 is chr6A:603206559, and the nucleotide sequence SEQ ID NO.2 flanking the variation site is: TCCCCCCACCTCCGTCCGCTCCGACTGGAGCAG[T / C]GGCCTGTGGAGCAGAGAGAGTGTGGGCGGGGCAC.

[0005] The primer composition of DQK015 includes Forward primer F:

[0006] 5’-GCTGTGGCGAGGGTGTGC-3’

[0007] Reverse primer R1:

[0008] 5’-GAAGGTGACCAAGTTCATGCTGACGAGACACGGAGGCGCA-3’;

[0009] Reverse primer R2:

[0010] 5’-GAAGGTCGGAGTCAACGGATTGACGAGACACGGAGGCGCG-3’;

[0011] The primer composition of DQK016 includes Forward primer F:

[0012] 5’-CCCGCCCCAGATCTCCAC;

[0013] Reverse primer R1:

[0014] 5’-GAAGGTGACCAAGTTCATGCTGACGTCTCTGCTCCACAGGCCA-3’;

[0015] Reverse primer R2:

[0016] 5’-GAAGGTCGGAGTCAACGGATTGACGTCTCTGCTCCACAGGCCG-3’;

[0017] The specific fluorescent sequence FAM is 5’-GAAGGTGACCAAGTTCATGCT-3’;

[0018] The specific fluorescent sequence HEX is 5’-GAAGGTCGGAGTCAACGGATT-3’.

[0019] The present invention provides a KASP molecular application for screening heat-tolerant wheat. The primers of the above KASP markers are used to detect the DNA of the wheat to be tested. The method includes the following steps: (1) Using the genomic DNA of the wheat to be tested as an amplification template, and performing PCR amplification with the above primers; (2) Performing fluorescence detection and analysis on the PCR products; (3) Based on the obtained fluorescence signals, determining the genotype of the wheat to be tested.

[0020] In step (1), the PCR reaction system is 10 μl, including 2 μL of DNA dilution solution (20 - 100 ng / μL), 1.4 μL of mixed primers (the volume ratio of the two competitive primers to the common primer is 1:1:2.5), 1.6 μL of double-distilled water, and 5 μL of 2×KASP reaction mixture. The 2×KASP reaction mixture (Beijing Jiacheng Biotechnology Co., Ltd.) includes dual-color fluorescent probes, high-fidelity enzymes, PCR buffer, dNTP, and Mg2+.

[0021] In step (2), a common gene amplifier is used, such as ABI Veriti™ 96, and the Touch down PCR amplification program is used. The specific steps are as follows: pre-denaturation at 95 °C for 10 min; denaturation at 95 °C for 20 s; annealing / extension at 61 °C - 55 °C for 40 s, for 10 cycles, with a decrease of 0.6 °C in each cycle; denaturation at 95 °C for 20 s; annealing / extension at 55 °C for 40 s, for 33 cycles; the PCR products need to be stored in the dark at 4 °C.

[0022] In step (3), the PCR amplification product is detected for fluorescence on a common fluorescence quantitative instrument, such as ABI QuantStudioTM 6Flex, by running at 35 °C for 30 s, and the genotype is determined based on the fluorescence signal. If the fluorescence of the PCR amplification product of DQK015 shows red, it represents that the detected genotype is AA; if the fluorescence of the PCR amplification product of DQK015 shows blue, it represents that the detected genotype is GG; if the fluorescence of the PCR amplification product of DQK016 shows red, it represents that the detected genotype is AA; if the fluorescence of the PCR amplification product of DQK016 shows blue, it represents that the detected genotype is GG; if the genotype obtained by DQK015 / DQK016 amplification is AA / AA, then this wheat material is an excellent haplotype Hap1 material with high temperature tolerance; if the genotype obtained by DQK015 / DQK016 amplification is GG / GG, then this wheat material is a haplotype Hap2 material with low high temperature tolerance; if the genotype obtained by DQK015 / DQK016 amplification is GG / AA, then this wheat material is a haplotype Hap3 material with low high temperature tolerance.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] For the KASP molecular marker for screening high-temperature-tolerant wheat and its application, the present invention provides KASP markers DQK015 and DQK016 for screening high-temperature-tolerant wheat varieties. By detecting the single nucleotide polymorphisms of the TaCOBL6A2 gene in different wheat varieties, the present invention identifies excellent haplotypes of the TaCOBL6A2 gene and develops related molecular markers DQK015 and DQK016; the KASP molecular markers DQK015 and DQK016 provided by the present invention do not require electrophoresis detection, and high-temperature-tolerant wheat varieties can be efficiently and reliably screened using this characteristic. Description of the Drawings

[0025] Figure 1 It is a schematic diagram of the haplotype analysis map of the TaCOBL6A2 gene of the present invention;

[0026] Figure 2 It is a schematic diagram of the homozygous allele typing of the KASP markers DQK015 (A) and DQK016 (B) of the present invention;

[0027] Figure 3 It is a schematic diagram of the amplification situation of the KASP markers DQK015 and DQK016 in varieties (lines) of the present invention;

[0028] Figure 4 It is a schematic diagram of the plants of different haplotype varieties (lines) after being treated under 40 °C high temperature stress for 1 week;

[0029] Figure 5Schematic diagram of the determination of the activity of the oxidation system enzymes after 1 week of treatment of different haplotype varieties (lines) under 40 °C high temperature stress;

[0030] Figure 6 Identification table of TaCOBL6A2 haplotypes in 175 wheat varieties (lines);

[0031] Figure 7 This invention Figure 6 Continued Table 1;

[0032] Figure 8 This invention Figure 6 Continued Table 2. Specific implementation manners

[0033] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0034] Please refer to Figures 1 - 5 , A KASP molecular marker and application for screening heat-tolerant wheat

[0035] Example 1: Natural variation identification and haplotype analysis of TaCOBL6A2 gene

[0036] (1)Natural variation search: Referring to 274 sequenced wheat varieties in the public database (Reference: Li A, Hao C, Wang Z, et al., Wheat breeding history reveals synergistic selection of pleiotropic genomic sites for plant architecture and grain yield. Mol. Plant 2022, 15(3): 504-519), variations located in the coding regions, introns, and untranslated regions (UTRs) of transcripts were selected. For intron variations, only those that may affect alternative splicing were retained, and functionally neutral variations were filtered out. Finally, 5 natural variation sites of the TaCOBL6A2 gene were obtained, namely Var.1 located in the 5'UTR (chromosomal position: chr6A:603206452, flanking sequence: CACCCCCACCGGACGGACGGAAGTCACGG[T / C]GCGCCTCCGTGTCTCGTCGCAGCCCACCACCTGC) and Var.2 (chromosomal position: chr6A:603206559, flanking sequence: TCCCCCCACCTCCGTCCGCTCCGACTGGAGCAG[T / C]GGCCTGTGGAGCAGAGAGAGTGTGGGCGGGGCAC), Var.3 located in exon 3 (chromosomal position: chr6A:603207820, flanking sequence: AACCCTCCCCATTGCTGCAAGAGAGATCCCACC[A / G]TCATCGATCTTCTCCCGGGGACGCCGTACAAAGA), Var.4 located in exon 6 (chromosomal position: chr6A:603209376, flanking sequence: GTCATGCCGCCTCCCGACGCCTATCC[A / G]TGGCTGCCTAACGCGAGCCCTCCGATGAAGCAACC), and Var.5 located in the 3'UTR (chromosomal position: chr6A:603209497, flanking sequence: CCTACTATGTCTGATGAGCGGTGTCGGCGAGCTTC[T / C]GTCGGGTTCCACGAGGTGCGCGGCGA), which defined 3 different haplotypes: Hap1, Hap2, Hap3 ( Figure 1 ).

[0037] (2)Haplotype analysis: KASP markers DQK015 and DQK016 were designed using the flanking sequences of natural variation site Var.1 and natural variation site Var.2, respectively. First, the DNA of sequenced varieties was used as a template to detect whether the KASP markers DQK015 and DQK016 could be correctly genotyped. The KASP reaction system was 10 μl, including 2 μL DNA dilution (20 - 100 ng / μL), 1.4 μL mixed primers, 1.6 μL double-distilled water, and 5 μL 2×KASP reaction mixture (Beijing Jiacheng Biotechnology Co., Ltd.). An ABI Veriti™ 96 gene amplifier was used, and the Touch down PCR amplification program was used for amplification. The specific steps were as follows: pre-denaturation at 95 °C for 10 min; denaturation at 95 °C for 20 s; annealing / extension at 61 °C - 55 °C for 40 s, for 10 cycles, with a decrease of 0.6 °C in each cycle; denaturation at 95 °C for 20 s; annealing / extension at 55 °C for 40 s, for 33 cycles. The PCR amplification products were detected by fluorescence using an ABI QuantStudioTM 6 Flex fluorescence quantitative instrument at 35 °C for 30 s, and the genotypes were judged according to the fluorescence signals. Comparing the genotypes of the sequenced varieties with the genotyping results of the KASP markers DQK015 and DQK016, both pairs of KASP markers could be correctly genotyped ( Figure 2 ). The amplification results AA / AA were haplotype Hap1, GG / GG were haplotype Hap2, and GG / AA were haplotype Hap3. Then, using the DNA of 184 wheat bred varieties and advanced generation lines as templates, the markers DQK015 and DQK016 were amplified for haplotype analysis. After KASP reaction amplification, fluorescence detection, and genotyping, the haplotypes were detected in 184 wheat varieties (lines) respectively. Except for 8 heterozygous genotypes, 116 Hap1, 44 Hap2, and 15 Hap3 varieties were detected in 175 varieties (lines) ( Figure 3 , Figure 6 , Figure 7 and Figure 8 ).

[0038] Example 2: Heat stress treatment and identification of excellent haplotypes

[0039] (1) Heat stress treatment: In the plant growth chamber, the light, temperature and humidity were controlled at 20 °C with 14 h of light, 18 °C in the dark for 12 h, and a relative humidity of 60%. Three representative varieties (lines) were selected for each haplotype, namely Hap1 (21Pin1-1, 21Pin2-1, Chuanmai 42), Hap2 (21PL4939, 21PL5110, Chuanmai 83), and Hap3 (H2017, 203137, 21230), a total of 9 wheat varieties (lines), which were cultured in the plant growth chamber for 14 days until the two-leaf stage. For the heat stress treatment, the seedlings of the 9 representative varieties (lines) were transferred to a constant temperature of 40 °C, with the light and humidity remaining unchanged, and the heat stress treatment was carried out for one week. The control seedlings continued to grow under the original normal conditions for one week. Compared with the control group, the growth of the seedlings after one week of heat stress treatment was significantly inhibited. However, among the heat stress treatment groups, the Hap1 seedlings showed significantly enhanced heat tolerance, while the Hap2 and Hap3 seedlings wilted and showed poor heat adaptability ( Figure 4 ).

[0040] (2)Determination of antioxidant enzyme activity: For the leaves of seedlings treated with control and heat stress, accurately weigh about 0.5 g, and grind them into fine powder using liquid nitrogen. Place the powder in 5 mL of pre-cooled extraction buffer (50 mM HEPES-NaOH buffer, pH 7.4, containing 20% (v / v) glycerol, 1 mM ethylenediaminetetraacetic acid (EDTA), 1 mM ascorbic acid (AsA), 1 mM glutathione (GSH), 5 mM magnesium chloride (MgCl2), and 1 mM dithiothreitol (DTT)) for homogenization. Homogenate the mixture at 4°C with a centrifugal force of 10,000×g for 30 min, and collect the supernatant as the enzyme extract for subsequent enzyme activity determination experiments.The activity of superoxide dismutase (SOD) was determined by the nitroblue tetrazolium (NBT) photoreduction method (Reference: Tan W, Liu J, Dai T, et al. Alterations in photosynthesis and antioxidant enzyme activity in winter wheat subjected to post-anthesis water-logging. Photosynthetica 2008, 46:21-27); the activity of catalase (CAT) was measured by the ultraviolet absorption method (Reference: Patra HK, M Kar, D Mishra. Catalase activity in leaves and cotyledons during plant development and senescence 1)1) Part X of the series "Studies on Leaf Senescence". Supported in part by a Grant from the Council of Scientific and Industrial Research, Government of India to D.M. Biochemie und Physiologie der Pflanzen 1978, 172(4):385-390); the activity of ascorbate peroxidase (APX) was evaluated by the ascorbic acid redox method (Reference: Nakano Y and K Asada, Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant and Cell Physiol. 1981, 22(5):867-880); the activity of peroxidase (POD) was quantitatively determined by the guaiacol method (Reference: Maehly AC and B Chance, The assay of catalases and peroxidases. Methods Biochem. Anal. 1954(1): 357-424). The differences in antioxidant enzyme activities between the control and heat stress-treated seedlings revealed haplotype-specific responses ( Figure 5): The activities of CAT and APX were significantly increased in the Hap1 lines (P < 0.05). The POD activity increased only in the Hap1 lines, and the POD activity of 21Pin1-1 was significantly enhanced. The SOD activity increased in all haplotypes, but the highest levels were observed in the two Hap1 lines. These findings together demonstrate that Hap1 is an elite haplotype of TaCOBL6A2, conferring enhanced heat tolerance by improving antioxidant capacity.

[0041] See Figure 1 , where the gray box, black box, and gray line represent the UTR region, exon, and intron, respectively.

[0042] See Figure 2 , the blue dots represent the homozygous allele A / A, and the red dots represent the homozygous allele G / G. The black square indicates the no-template control.

[0043] See Figure 3 , Figure 3 Genotyping of KASP markers DQK015 (A) and DQK016 (B), where the blue dots represent the homozygous allele A / A, the red dots represent the homozygous allele G / G, the green dots represent the heterozygous allele A / G, and the black square indicates the no-template control.

[0044] See Figure 4 , CM42, DF134, and DF27 are the representative varieties (lines) of haplotypes Hap1 - Hap3, respectively.

[0045] See Figure 5 , A - D are the assays of the activities of antioxidant system enzymes catalase (CAT), ascorbate peroxidase (APX), peroxidase (POD), and superoxide dismutase (SOD), respectively. Hap1 varieties (lines): 21Pin1-1, 21Pin2-1, and CM42; Hap2 varieties (lines): DF115, DF134, and CM83; Hap3 varieties (lines): DF23, DF27, and DF34, *, ** indicate significant differences at the p < 0.05 and p < 0.01 levels, respectively.

[0046] It should be noted that in this text, relational terms such as first and second are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the terms "comprising", "including" or any other variant thereof are intended to cover non-exclusive inclusion, such that a process, method, article or device comprising a series of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article or device.

[0047] Although the embodiments of the present invention have been shown and described, those of ordinary skill in the art can understand that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A KASP molecular marker for screening high-temperature resistant wheat, characterized in that, Including KASP molecular marker DQK015 and KASP molecular marker DQK016: (1) The primer combination of KASP molecular marker DQK015 includes: DQK015-F: 5’-GCTGTGGCGAGGGTGTGC-3’ DQK015-R1: 5’-GAAGGTGACCAAGTTCATGCTGACGAGACACGGAGGCGCA-3’ DQK015-R2: 5’-GAAGGTCGGAGTCAACGGATTGACGAGACACGGAGGCGCG-3’ 5’-GAAGGTGACCAAGTTCATGCT-3’ is the FAM specific fluorescence sequence; 5’-GAAGGTCGGAGTCAACGGATT-3’ is the HEX specific fluorescence sequence; (2) The primer combination of KASP molecular marker DQK016 includes: DQK016-F: 5’-CCCGCCCCAGATCTCCAC DQK016-R1: 5’-GAAGGTGACCAAGTTCATGCTGACGTCTCTGCTCCACAGGCCA-3’ DQK016-R2: 5’-GAAGGTCGGAGTCAACGGATTGACGTCTCTGCTCCACAGGCCG-3’ 5’-GAAGGTGACCAAGTTCATGCT-3’ is the FAM specific fluorescence sequence; 5’-GAAGGTCGGAGTCAACGGATT-3’ is the HEX specific fluorescence sequence.

2. A reagent, characterized in that, Containing the primer combination of KASP molecular marker DQK015 and the primer combination of KASP molecular marker DQK016 described in claim 1.

3. The application of the primer combination of the molecular marker described in claim 1 in the detection of high temperature tolerance in wheat, wherein the primer combination of the molecular marker includes the primer combination of KASP molecular marker DQK015 and the primer combination of KASP molecular marker DQK016.

4. The application according to claim 3, characterized in that The primer combination of KASP molecular marker DQK015 and the primer combination of KASP molecular marker DQK016 are used to detect the natural variation sites and their flanking sequences of the high temperature tolerance gene TaCOBL6A2 in wheat: Var.1: Chromosome position: chr6A:603206452, flanking sequence: CACCCCCACCGGACGGACGGAAGTCACGG[T / C]GCGCCTCCGTGTCTCGTCGCAGCCCACCACCTGC; Var.2: Chromosome position: chr6A:603206559, flanking sequence: TCCCCCCACCTCCGTCCGCTCCGACTGGAGCAG[T / C]GGCCTGTGGAGCAGAGAGAGTGTGGGCGGGGCAC.

5. The application according to claim 3, characterized in that: When used for the detection of high temperature tolerance in wheat, it includes the following steps: Step 1: Extract wheat genomic DNA, perform PCR amplification on the genomic DNA of wheat materials using the primer combinations of KASP molecular marker DQK015 and the primer combinations of KASP molecular marker DQK016, and determine the high-temperature tolerance of wheat based on the fluorescence signals of the amplification products. Step 2: If the genotype obtained by amplifying with the primer combinations of KASP molecular marker DQK015 is AA and the genotype obtained by amplifying with the primer combinations of KASP molecular marker DQK016 is AA, it is classified as the excellent haplotype Hap1 material with high-temperature tolerance; if the genotype obtained by amplifying with the primer combinations of KASP molecular marker DQK015 is GG and the genotype obtained by amplifying with the primer combinations of KASP molecular marker DQK016 is GG, it is classified as the haplotype Hap2 material with low high-temperature tolerance; if the genotype obtained by amplifying with the primer combinations of KASP molecular marker DQK015 is GG and the genotype obtained by amplifying with the primer combinations of KASP molecular marker DQK016 is AA, it is classified as the haplotype Hap3 material with low high-temperature tolerance.