A colorimetric-SERS nanozyme sensor and its application in the preparation of an LPS detection kit

Abstract

The present invention discloses a colorimetric-SERS nanozyme sensor and its application in the preparation of an LPS detection kit, belonging to the technical field of inspection and analysis. A colorimetric-SERS nanozyme sensor disclosed by the present invention synthesizes a nanozyme probe Au@AgPt@ZIF-8 NPs with peroxidase activity and SERS enhancement performance in a core-shell structure, and realizes highly specific, accurate and sensitive colorimetric and SERS dual-mode detection of lipopolysaccharide (LPS) in bacterial secretions based on an aptamer competition-triggered nucleic acid amplification strategy. The present invention is expected to guide the development of more nanozyme probes and provide new ideas for fields such as biomedicine and disease diagnosis.

Description

Technical Field

[0001] The present invention relates to the technical field of inspection and analysis, and more particularly to a colorimetric-SERS nanozyme sensor and its application in the preparation of an LPS detection kit. Background Art

[0002] Bacterial endotoxin produced during the bacterial metabolic process, as a highly toxic and easily diffusible secretion, can induce a series of immune responses in the body. Even a very small amount can cause adverse reactions such as fever, and in excessive amounts, it can cause symptoms such as asthma and shock, and even lead to death. Therefore, it poses a serious threat to human life and health. So far, bacterial endotoxin is one of the key quality inspection items for injectables. If an injectable contains a certain amount of endotoxin, it can cause discomfort reactions such as fever at the mildest, and endanger life safety at the severest. The main chemical component of bacterial endotoxin is lipopolysaccharide (LPS). Therefore, specific, sensitive, and reliable analysis and detection of LPS in injectables are directly related to the life safety of drug users. The limulus test is the gold standard for detecting LPS in many countries such as China and the United States. Although the limulus test can achieve rapid and sensitive detection of endotoxin and has been used for more than thirty years, the limulus reagent used in this method is prepared by taking the blood of limulus. Due to the destruction of the living environment of limulus and the inability to artificially breed limulus, with the increasing demand for LPS detection, the application prospect of this method is limited to a certain extent.

[0003] Meanwhile, it is difficult to extract bacterial intracellular metabolites, which are diverse in types and mostly have low concentrations. Traditional analysis and detection methods such as animal test methods, instrument detection methods, immunological methods, gene probe methods, etc. all have certain limitations. For example, although the animal experiment method can directly draw conclusions by observation, it has disadvantages such as large individual differences among animals, time-consuming and laborious experiments, and high costs; the immunoassay method based on the specific binding of antigen and antibody has strong specificity, but the preparation process of antibodies is relatively cumbersome, and the performance of antibodies prepared in different batches may vary, thus having a greater interference on the accuracy of experimental results. Therefore, developing a simple, rapid, sensitive, accurate, and low-cost analysis and detection method for bacterial secretions is of great significance for the early diagnosis of diseases and the diagnosis of bacterial infections.

[0004] Surface-enhanced Raman scattering (SERS) can significantly enhance the detection signal of substance molecules and has characteristics such as ultrasensitivity and fingerprint spectra. It has been applied to the analysis and detection of markers such as bacteria, cells, proteins, and nucleic acids. Although noble metals such as Au and Ag commonly used to construct SERS substrates can amplify signals through electromagnetic field enhancement (EM) via plasmon resonance, there are still disadvantages such as poor stability and uniformity, low selectivity, weak enhancement effect, and easy oxidation and denaturation, which hinder their development and application. The nanoscale metal-organic framework MOF material ZIF-8 can produce chemical enhancement (CM) with molecules, not only significantly enhancing the SERS effect, but also preventing the oxidation and denaturation of noble metals Au and Ag due to the encapsulation of ZIF-8, playing a role in stabilizing the SERS substrate.

[0005] In addition, MOF is an important material for constructing nanozymes. Nanozymes are artificial enzymes that have both the characteristics of nanomaterials and catalytic functions, and can achieve specific catalytic reactions to generate corresponding signals, such as chemical, optical, and electrical signals. So far, a large number of reports have shown that many nanomaterials have activities such as catalase and peroxidase-like activities, and the most representative ones are noble metal materials such as Pd, Pt, and Au.

[0006] However, when many biosensor technologies analyze and detect low-concentration target substances in vivo, due to the limited response signal of the sensor to the target substance, the linear range and detection limit of the detected target substance are restricted. Based on this problem, some researchers have introduced nucleic acid signal amplification technologies, such as enzyme-free nucleic acid signal amplification technologies CHA and HCR, etc., during the construction of biosensors, further improving the detection sensitivity of biosensors.

[0007] Therefore, providing a colorimetric-SERS nanozyme sensor and its application in the preparation of an LPS detection kit is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0008] In view of this, the present invention provides a colorimetric-SERS nanozyme sensor and its application in the preparation of an LPS detection kit. By developing the Au@AgPt@ZIF-8 nanozyme structure and based on the nucleic acid signal amplification strategy, colorimetric and SERS dual-mode detection of LPS is carried out to achieve rapid, sensitive, accurate, and highly specific analysis and detection of LPS, providing a method and idea with application potential for the detection of bacterial secretions.

[0009] The present invention first prepared a core-shell structure Au@AgPt@ZIF-8, which has strong peroxidase activity due to the presence of Pt and ZIF-8. In an acetate buffer solution with a pH of 4.0 and an H2O2 system, Au@AgPt@ZIF-8 can cause the oxidation reaction of 3,3',5,5'-tetramethylbenzidine (TMB). On the one hand, it can turn the reaction solution from colorless to blue, thus realizing colorimetric analysis detection. On the other hand, the molecular structure of TMB changes to form oxTMB, which can realize SERS analysis detection. At the same time, the MOF material ZIF-8 can further enhance the CM on the basis of the EM enhancement of Au@AgPt to exert a dual-enhanced SERS effect, and protect Au@AgPt NPs from oxidation and denaturation, playing a role in stabilizing and enhancing the SERS signal and improving the detection sensitivity.

[0010] Meanwhile, in order to separate the target from impurities, an AuMNP nanomaterial internally modified with 4-mercaptobenzonitrile (4-MBN) was also synthesized. Among them, since the Raman characteristic peaks of 4-MBN are relatively simple and its characteristic peak (2225 cm -1 -1) is in the silent region of general Raman reporter molecules, it is used as an internal standard molecule to improve the accuracy of the detection results. And Au MNPs also have the functions of magnetic enrichment and SERS enhancement, which can further improve the detection sensitivity. Therefore, Au@AgPt@ZIF-8 and Au MNPs are simultaneously used in the detection of LPS to achieve accurate, sensitive and highly specific colorimetric-SERS dual-mode detection.

[0011] Finally, based on LBA (the specific aptamer of LPS), the sequences of the primer strand S, hairpin probes H1 and H2 were designed. H2 and H1 were respectively modified on the surfaces of Au@AgPt@ZIF-8 and Au MNPs. The LPS signal was converted into a nucleic acid signal through an aptamer competition strategy, and then the nucleic acid signal was amplified by the CHA (catalytic hairpin assembly reaction) strategy. Finally, an Au MNPs-H1-H2-Au@AgPt@ZIF-8 composite structure was formed. The principle is as follows: In the absence of LPS, LBA binds to the S strand to form double-stranded DNA (dsDNA), and the CHA reaction cannot be initiated; in the presence of LPS, since LPS has a stronger binding affinity with LBA, the S strand in LBA-S is competitively displaced to form an LPS-LBA complex, and the released S strand can bind to the specific recognition sequence on H1 through the base complementary pairing principle and open the hairpin structure of the H1 strand to form an H1-S double strand. Then, H2 has a specific recognition site with the H1 strand on H1-S and forms a more stable double strand H1-H2. The S strand is released from H1, and the released S strand can bind to other H1s and enter the next CHA cycle, thus forming more H1-H2 double strands, playing a role in signal amplification. The Au MNP modified with H1 has an enrichment effect and a SERS enhancement effect, and the modified 4-MBN can be used as an IS molecule, playing a role in improving the accuracy of SERS detection. The Au@AgPt@ZIF-8 modified with H2 has a peroxidase-like effect, a SERS enhancement effect, and a certain stabilizing effect on the core structure Au@AgPt NPs. Finally, by establishing a linear relationship between the absorption characteristic peak of ox-TMB and the LPS concentration, the colorimetric detection of LPS was realized; at the same time, a linear relationship between the ratio of the characteristic peaks of oxTMB and 4-MBN (I 1337 / I 2225 ) and the LPS concentration was established to achieve accurate, sensitive and highly specific colorimetric and SERS dual-mode detection of LPS.

[0012] To achieve the above object, the present invention adopts the following technical solutions:

[0013] A colorimetric-SERS nanozyme sensor containing H2-Au@AgPt@ZIF-8, H1-Au MNPs and LBA-S.

[0014] Furthermore, the preparation method of the H2-Au@AgPt@ZIF-8 is as follows:

[0015] 1) Preparation of Au@AgPt@ZIF-8

[0016] (1) Add 50 mL of 1 mM HAuCl4 solution to a 100 mL round-bottom flask, heat it under reflux in an oil bath at 120 °C until boiling. After boiling for 5 - 10 min, quickly add 5 mL of 38.8 mM sodium citrate, continue heating and reacting for 15 - 20 min. Finally, a dark red 10 nm Au NPs colloidal solution is obtained. After cooling to room temperature, store it in the dark at 4 °C for later use.

[0017] (2) Add 11.5 mL of ultrapure water, 1 mL of 10 nm Au NPs, and 12 mL of 10 mM cetyltrimethylammonium chloride to a 25 mL round-bottom flask, stir at room temperature for 20 min. Then add 300 μL of 100 mM ascorbic acid solution and 500 μL of 200 mM NaOH solution respectively, and continue stirring for 20 min. Under the condition of 25 - 35 °C, quickly add 1 mL of 10 mM AgNO3 solution, and dropwise add 0.5 mL of 10 mM H2PtCl6 every 20 - 30 s. After the addition is completed, continue reacting for 60 min. Finally, a black-brown Au@AgPt NPs is obtained and stored at 4 °C for later use.

[0018] (3) Add 2 mL of 10 mM cetyltrimethylammonium bromide and 1 mL of 1.32 M 2-methylimidazole to a 20 mL glass test tube, ultrasonically mix for 60 min. Then add 10 mL of 0.5 M Zn(NO3)2 and 1 mL of Au@AgPt NPs respectively, and ultrasonically mix and react at 70 °C for 20 min. Then place it in a water bath at 30 °C and react for 2 - 3 h to obtain a gray-black product Au@AgPt@ZIF-8. Centrifuge and wash it 3 times with ultrapure water, and store it at 4 °C for later use.

[0019] 2) Modification of H2 chains on Au@AgPt@ZIF-8

[0020] (1) Add 100 μL of 80 μg / mL streptavidin to 1 mL of Au@AgPt@ZIF-8, stir and incubate at 4 °C for 18 - 24 h; centrifuge, and redisperse the obtained SA-Au@AgPt@ZIF-8 in 1 mL of PBS with pH = 7.4 for later use.

[0021] (2) Denature Bio-H2 at 95 °C for 10 min and anneal at 40 °C for 1 h to obtain denatured and annealed Bio-H2.

[0022] (3) Mix 100 μL of SA-Au@AgPt@ZIF-8 with 5 μL of denatured and annealed Bio-H2 at 100 μM, incubate with slow shaking for 1.5 h at room temperature, and finally centrifuge and wash the product to obtain H2-Au@AgPt@ZIF-8, which is redispersed in 1 mL of PBS with pH = 7.4 for standby.

[0023] The Bio-H2 is 5'-TTTTTTTTTTAAAGTCAAAGTCCTATCTCGTCTCCTGACTTTGACTTTACAGGAGAC-3'; SEQ ID NO.2; the 5' end is modified with Bio.

[0024] Further, the preparation method of the H1-Au MNPs is as follows:

[0025] 1) Preparation of Au MNPs

[0026] (1) Add 100 mL of ethylene glycol and 1.43 g of FeCl3×6H2O to a 250 mL round-bottom flask and mix well by ultrasound. Then add 0.2 g of polyethylene glycol and 0.4 g of anhydrous sodium acetate. Stir the resulting mixture vigorously overnight. After thorough mixing, transfer the resulting mixture to a Teflon-lined stainless steel autoclave and react at 180 - 200 °C for 10 hours. After the reaction is complete, perform magnetic separation on the product, and wash it 3 times each with ultrapure water and absolute ethanol successively. Finally, air-dry the product naturally at room temperature to obtain Fe3O4 NPs, which are sealed and stored for standby.

[0027] (2) Add 180 mL of ultrapure water, 5 mL of 5 mM HAuCl4, and 10 mL of 5 mM sodium citrate to a 250 mL round-bottom flask, stir vigorously for 5 min to mix well, and finally add 5 mL of 0.1 M NaBH4 and stir vigorously for 2 - 4 hours to obtain a brownish-red 4 nm Au NPs colloidal solution.

[0028] (3) Add 0.3 g of polyethyleneimine to 50 mL of ultrapure water and mix well by ultrasound for 10 - 15 min to obtain a PEI solution; then weigh 10 mg of Fe3O4 NPs and add them to the PEI solution, react by ultrasound for 20 min, and then wash 3 times with ultrapure water to obtain Fe3O4-PEI.

[0029] (4) Weigh 10 mg of Fe3O4-PEI and add it to an excess of 4 nm Au NPs solution, react under ultrasonic conditions for 2 h, then perform magnetic separation, and wash 3 times each with ultrapure water and absolute ethanol successively to obtain Fe3O4@Au NPs.

[0030] (5) Add 10 mL of 10 -3 M 4-MBN to 1 mL of 5 mg / mL Fe3O4@Au NPs. Place the resulting mixture in a -20 °C refrigerator and incubate for 30 min. Let it cool to room temperature naturally, and make up the volume to 10 ml with absolute ethanol to obtain 4-MBN-Fe3O4@Au NPs.

[0031] (6) Mix 10 mg of 4-MBN-Fe3O4@Au NPs, 100 mL of ultrapure water, and 300 μL of 0.1 M HAuCl4. Then, under vigorous ultrasonic conditions at 30 °C, add 1 mL of 300 mg / mL NH2OH×HCl and react for 10 - 15 min. Add 500 mg of polyvinylpyrrolidone and continue to react for 35 min. After the reaction, wash three times with ultrapure water, and finally make up the volume to 5 mg / mL with absolute ethanol to obtain Au MNPs, which are stored in the dark at 4 °C.

[0032] 2) Modification of H1 chain on Au MNP

[0033] (1) Denature SH-H1 at 95 °C for 10 min and anneal at 40 °C for 1 h to obtain denatured and annealed SH-H1.

[0034] (2) Mix 100 μL of Au MNPs and 5 μL of 100 μM denatured and annealed SH-H1, incubate at 30 °C and 200 rpm for 10 h, then add 100 μL of 1% BSA and continue to incubate for 3 h. Finally, wash with ultrapure water and disperse the product in 1 mL of PBS solution to obtain H1-Au MNPs.

[0035] The SH-H1 is 5'- TTTTTTTTTTATCTCGTCTCCTGTAAAGTCAAAGTCAGGAGACGAGATAGGCGGACACT-3'; SEQ ID NO.1; with SH modification at the 5' end.

[0036] Further, the preparation method of the LBA-S is as follows:

[0037] Mix the LBA sequence and the S chain sequence in a 1:1 ratio, denature at 95 °C for 10 min, and anneal at 40 °C for 1 h to form the LBA-S double strand.

[0038] The S chain sequence: 5'-AGTGTCCGCCTATCTCGTCTCCTG-3'; SEQ ID NO.3.

[0039] The LBA sequence: 5'-CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT-3'; SEQ ID NO.4.

[0040] Furthermore, the application of the colorimetric-SERS nanozyme sensor in the preparation of an LPS detection kit.

[0041] Based on nucleic acid signal amplification, the design and preparation of Au@AgPt@ZIF-8 nanozyme, the present invention constructs a colorimetric-SERS dual-mode sensing strategy for accurate, sensitive and highly specific detection of LPS.

[0042] It can be seen from the above technical solutions that compared with the prior art, the present invention discloses a colorimetric-SERS nanozyme sensor and its application in the preparation of an LPS detection kit, having the following beneficial effects:

[0043] (1) Au@AgPt@ZIF-8 NPs have peroxidase activity and high SERS enhancement performance, and Au MNPs have both magnetic separation and SERS enhancement dual functions; the present invention applies both of them to the construction of a biosensor, which can achieve accurate, sensitive and highly specific colorimetric and SERS dual-mode detection of the target analyte LPS.

[0044] (2) The present invention adopts the CHA nucleic acid signal amplification technology, and further realizes ultrasensitive and cascade anti-interference detection of LPS on the basis of colorimetric-SERS dual-mode sensing of Au@AgPt@ZIF-8, Au MNPs and the specific aptamer (LBA) of LPS. Description of the Drawings

[0045] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.

[0046] Figure 1 TEM images of (A) Au NPs, (B) Au@AgPt NPs, (C) Au@AgPt@ZIF-8 of the present invention (the inset is a single nanomaterial) and (D) ultraviolet-visible spectroscopy diagram.

[0047] Figure 2For the present invention, the (A) Zeta potential and (B) particle size distribution of Au NPs, Au@AgPt NPs, and Au@AgPt.

[0048] Figure 3 TEM images and characterizations of the synthesis process of Au MNPs of the present invention: (A) Fe3O4 NPs; (B) Fe3O4@AuNPs; (C) Au MNPs; (D) XRD spectra of Fe3O4 NPs, Fe3O4@Au NPs, and Au MNPs; (E) corresponding hysteresis curves, and the inset shows the magnetic enrichment performance of Au MNPs.

[0049] Figure 4 For the present invention, the (A) Zeta potential and (B) particle size distribution of Fe3O4 NPs, Fe3O4@PEI, Fe3O4@Au NPs, and Au MNPs.

[0050] Figure 5 Verification of the detection strategy of the present invention: (A) UV absorption spectra of different component solutions a, b, c, d; (B) SERS spectra of different component solutions a, b, c, d; a: H1-Au MNPs; b: H1-Au MNPs + H2-Au@AgPt@ZIF-8; c: H1-Au MNPs + H2-Au@AgPt@ZIF-8 + S-LBA; d: H1-Au MNP + H2-Au@AgPt@ZIF-8 + S-LBA + LPS.

[0051] Figure 6 Investigation of the reproducibility of SERS detection results of the present invention: (A) Three-dimensional Raman spectra collected at 30 randomly selected detection sites in the same 10 ng / mL LPS detection product, its (B) 2D SERS spectra, and (C) corresponding Raman intensity distribution at 1337 cm -1 of and (D) distribution of the I 1337 / I 2225 ratio.

[0052] Figure 7 Investigation of the specificity of LPS detection of the present invention; MIX = LPS + NaCl + Na2CO3 + NaH2PO4 + NaHSO3 + Glucose + K2HPO4 + cysteine + AA + EDTA-2Na.

[0053] Figure 8 Establishment of a colorimetric detection linear curve: (A) UV-Vis spectra of different concentrations of LPS (in the figure, 10 3 -0 ng / ml is 10 3 、10 2 、101 、 1, 10 -1 、 10 -2 、 10 -3 、 10 -4 、 10 -5 、 0 ng / ml); and its (B) linear relationship between the absorbance at 650 nm and the LPS concentration.

[0054] Figure 9 For the establishment of the SERS detection linear curve: (A) SERS spectra of different concentrations of LPS (B) linear relationship between the corresponding I1337 / I2225 and the LPS concentration.

[0055] Figure 10 For the establishment of the linear curve of the Pierce™ chromogenic endotoxin quantification kit: (A) 0.1 - 1 EU / mL (B) 0.01 - 0.1 EU / mL and (C) 10 -4 -1.0 EU / mL concentration range, the linear relationship between the absorbance at 405 nm and the LPS concentration.

[0056] Figure 11 Absorbance intensities of different concentrations of LPS in glucose injection: a: Pierce™ chromogenic endotoxin quantification kit (405 nm); b: TMB colorimetric method of the present invention (650 nm), (above the illustration is the color development result of the kit, and below is the color development result of the TMB colorimetric method of the present invention). Detailed implementation manners

[0057] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.

[0058] Example 1 Preparation and Characterization of Au@AgPt@ZIF-8

[0059] 50 mL of HAuCl4 solution (1 mM) was added to a 100 mL round-bottom flask and heated under reflux in an oil bath at 120 °C until boiling. After boiling for 5 - 10 min, 5 mL of sodium citrate (38.8 mM) was quickly added, and the reaction was continued by heating for 15 - 20 min. Finally, a dark red 10 nm Au NPs colloidal solution was obtained. After cooling to room temperature, it was stored in the dark at 4 °C for later use. Then, 11.5 mL of ultrapure water, 1 mL of 10 nm Au NPs, and 12 mL of 10 mM CTAC (cetyltrimethylammonium chloride) were added to a 25 mL round-bottom flask and stirred at room temperature for 20 min. Then, 300 μL of 100 mM AA (ascorbic acid) solution and 500 μL of NaOH solution (200 mM) were added respectively, and the stirring was continued for 20 min. Under the condition of 25 - 35 °C, 1 mL of AgNO3 solution (10 mM) was quickly added, and 0.5 mL of H2PtCl6 (10 mM) was added dropwise every 20 - 30 s. After the addition was completed, the reaction was continued for 60 min, and finally black-brown Au@AgPt NPs were obtained and stored at 4 °C for later use. Finally, 2 mL of CTAB (cetyltrimethylammonium bromide) (10 mM) and 1 mL of 2-methylimidazole (1.32 M) were added to a 20 mL glass test tube and mixed evenly by ultrasonic for 60 min. Then, 10 mL of 0.5 M Zn(NO3)2 and 1 mL of Au@AgPt NPs were added respectively, and the ultrasonic mixing reaction was carried out at 70 °C for 20 min to obtain Au@AgPt NPs wrapped with ZIF-8 nanomaterials. Finally, the reaction was carried out in a water bath at 30 °C for 2 - 3 h to obtain a gray-black product Au@AgPt@ZIF-8, which was centrifuged and washed 3 times with ultrapure water and stored at 4 °C for later use.

[0060] Analysis of the TEM images of the as-prepared Au NPs, Au@AgPt NPs, and Au@AgPt@ZIF-8 ( Figure 1 ), it can be seen that Au NPs with a size of about 10 nm were first synthesized, see (A) in Figure 1 . Then, Au@AgPt NPs with a size of about 40 nm were synthesized by a one-pot method, see (B) in Figure 1 , and their morphology was popcorn-like. Subsequently, it was wrapped with ZIF-8, and finally a cubic core-shell structure Au@AgPt@ZIF-8 was formed, see (C) in Figure 1 , with a size of about 150 nm. According to the UV absorption spectra, see Figure 1In (D), a significant characteristic absorption peak appears at 520 nm for Au NPs in Au@AgPt@ZIF-8. However, when further synthesizing Au@AgPt NPs, this characteristic absorption peak disappears. This is because the damping effect of Pt causes the absorption peak of Au NPs to disappear, which also indicates the deposition of Pt. Finally, when Au@AgPt@ZIF-8 is synthesized, since Au@AgPt NPs are encapsulated in ZIF-8 and ZIF-8 has no obvious absorption peak, Au@AgPt@ZIF-8 has no obvious absorption peak.

[0061] Figure 2 In (A), the Zeta potential of the nanoparticles formed during the preparation of Au@AgPt@ZIF-8 was detected. Au NPs are negatively charged. When Au@AgPt NPs are synthesized, due to the presence of the surfactant CTAC, the charge changes from negative to positive. Similarly, since Au@AgPt@ZIF-8 contains CTAB, it also has a positive charge form. Figure 2 In (B) are the particle sizes of the nanoparticles. The sizes of Au NPs, Au@AgPt NPs, and Au@AgPt@ZIF-8 are approximately 10 nm, 40 nm, and 150 nm respectively, which is consistent with the TEM results.

[0062] Example 2 Preparation and Characterization of Au MNPs

[0063] Add 100 mL of ethylene glycol and 1.43 g of FeCl3×6H2O to a 250 mL round-bottom flask and mix well using ultrasound. Then add 0.2 g of polyethylene glycol and 0.4 g of anhydrous sodium acetate. Stir the resulting mixture vigorously overnight to mix thoroughly. After thorough mixing, transfer the resulting mixture to a Teflon-lined stainless steel autoclave and react at 180 - 200 °C for 10 hours. After the reaction is complete, perform magnetic separation on the product using a magnet, and wash it 3 times each with ultrapure water and anhydrous ethanol successively to remove unreacted reactants. Finally, air-dry the product naturally at room temperature to obtain Fe3O4 magnetic nanoparticles (Fe3O4 NPs), and seal and store for later use. Secondly, add 180 mL of ultrapure water, 5 mL of HAuCl4 (5 mM), and 10 mL of sodium citrate (5 mM) to a 250 mL round-bottom flask respectively. Stir vigorously for 5 min to mix thoroughly. Finally, add 5 mL of freshly prepared NaBH4 (sodium borohydride) (0.1 M), and stir vigorously for 2 - 4 hours to obtain a brownish-red colloidal solution of 4 nm Au NPs. Then add 0.3 g of PEI (polyethyleneimine) to 50 mL of ultrapure water and mix well by ultrasound for 10 - 15 min to obtain a PEI solution. Then weigh 10 mg of Fe3O4 NPs and add them to the above PEI solution, and react by ultrasound for 20 min. Then wash 3 times with ultrapure water to remove excess PEI to obtain PEI-modified Fe3O4 nanoparticles (Fe3O4-PEI). Then weigh 10 mg of Fe3O4-PEI and add it to an excess of 4 nm Au NPs solution, and react under ultrasound conditions for 2 h. Then perform magnetic separation using a magnet, and wash 3 times each with ultrapure water and anhydrous ethanol successively to remove excess Au NPs. Finally, obtain Fe3O4 magnetic nanoparticles with Au NPs surface modification (Fe3O4@Au NPs). Add 10 mL of 4-MBN (10 -3M) was added to 1 mL of 5 mg / mL Fe3O4@Au NPs. The resulting mixture was incubated in a -20 °C refrigerator for 30 min, then cooled to room temperature naturally, and made up to 10 mL with absolute ethanol to obtain 4-MBN-modified Fe3O4@Au NPs (4-MBN-Fe3O4@Au NPs). Finally, 10 mg of 4-MBN-Fe3O4@Au NPs, 100 mL of ultrapure water, and 300 μL of HAuCl4 (0.1 M) were mixed evenly. Then, under the condition of intense ultrasonic treatment at 30 °C, 1 mL of NH2OH×HCl (300 mg / mL) was added, and the reaction was carried out for 10 - 15 min. Finally, 500 mg of PVP (polyvinylpyrrolidone) was added, and the reaction was continued for 35 min. After the reaction, it was washed 3 times with ultrapure water, and finally made up to 5 mg / mL with absolute ethanol to obtain Au MNPs, which were stored in the dark at 4 °C.

[0064] As Figure 3 shown in the TEM image of (A) in Figure 3 , the average particle size of the prepared Fe3O4 NPs is about 300 nm, and the morphology is relatively uniform. After modifying Au NPs on the surface of Fe3O4 NPs, the surface of Fe3O4 NPs becomes rough, indicating that Au NPs are successfully modified. See Figure 3 in (B) of Figure 3 . After growing the Au shell, the surface of Fe3O4 NPs is wrapped with a layer of Au shell with a thickness of about 20 nm. Finally, the size of the prepared Au MNPs is about 400 nm. See Figure 3 in (C) of Figure 3 . As shown in (D) of Figure 3 , the crystal structure of AuMNPs was characterized by XRD technology. The experimental results show that diffraction peaks of Fe3O4 appear at 62.7, 57.0, 53.4, 43.2, 35.6, and 30.1, which correspond to the crystal planes of (224), (303), (220), (211), (112), and (024) of orthorhombic Fe3O4, respectively. When Au NPs are modified and the Au shell is grown, diffraction peaks of 77.3, 64.4, 43.9, and 38.0 appear, corresponding to the crystal planes of (311), (220), (200), and (111) of cubic Au, respectively. VSM magnetic detection was also carried out on Fe3O4 NPs, Fe3O4-Au NPs, and AuMNPs respectively. As Figure 3 shown in (E) of Figure 3 , the results show that the magnetism of the three decreases in turn. The magnetic saturation values of Fe3O4 NPs, Fe3O4@Au NPs, and Au MNPs are 83.5, 75.2 emu / g, and 44.3 emu / g, respectively. Therefore, the synthesized AuMNPs exhibit good magnetic enrichment performance and can meet the requirements for the capture and enrichment of the target in the detection experiment.

[0065] Figure 4 In (A), the Zeta potential of the nanoparticles formed during the synthesis of Au MNPs was detected. Fe3O4 NPs showed a weak positive charge close to neutral. When PEI was modified on the surface of Fe3O4 NPs, since PEI has ammonium ions, the overall charge of Fe3O4@PEI was positive. After that, when Au NPs were modified, since Au NPs are negatively charged, they neutralized the positive charges in Fe3O4@PEI, resulting in Fe3O4@Au NPs showing a weak positive charge. Finally, since Fe3O4 was completely wrapped by a layer of Au, AuMNPs were overall negatively charged. Figure 4 In (B), it is the particle size of the nanoparticles. The sizes of Fe3O4, Fe3O4@PEI, Fe3O4@Au NPs, and Au MNPs are about 300 nm, 310 nm, 340 nm, and 450 nm respectively, and the sizes gradually increase, which is basically consistent with the SEM results.

[0066] Example 3 Detection of Bacterial Endotoxin by a Colorimetric-SERS Dual-Mode Sensor Based on CHA

[0067] 1) Modification of H1 strand on Au MNP

[0068] Based on the formation mechanism of Au-S bonds, the thiolated DNA strand (SH-H1) (5'- TTTTTTTTTTATCTCGTCTCCTGTAAAGTCAAAGTCAGGAGACGAGATAGGCGGACACT-3'; SEQ ID NO.1; SH is modified at the 5' end) was modified on the surface of Au MNPs. First, SH-H1 was denatured (95 °C, 10 min) and annealed (40 °C, 1 h). Then, 100 μL of Au MNPs and 5 μL of the denatured and annealed SH-H1 (100 μM) were mixed and incubated at 30 °C and 200 rpm for 10 h to form Au-S bonds. After that, 100 μL of BSA (1%) was added and incubated for another 3 h to prevent non-specific adsorption. Finally, it was washed with ultrapure water to remove excess impurities, and the product was dispersed in 1 mL of PBS solution to obtain H1-modified Au MNPs (H1-Au MNPs).

[0069] 2) Modification of H2 strand on Au@AgPt@ZIF-8

[0070] Based on the specific linkage between biotin (Bio-) and streptavidin (SA-), the biotinylated H2 strand (Bio-H2) (5'-TTTTTTTTTTAAAGTCAAAGTCCTATCTCGTCTCCTGACTTTGACTTTACAGGAGAC-3'; SEQ ID NO.2; Bio modified at the 5' end) was modified onto the surface of Au@AgPt@ZIF-8. First, 100 μL of SA (80 μg / mL) was added to 1 mL of Au@AgPt@ZIF-8, and then incubated with stirring at 4 °C for 18 - 24 h. Then, the excess SA was removed by centrifugation, and the obtained SA-Au@AgPt@ZIF-8 was redispersed in 1 mL of PBS (pH = 7.4) for standby. Bio-H2 was denatured (95 °C, 10 min) and annealed (40 °C, 1 h), and then 100 μL of SA-Au@AgPt@ZIF-8 and 5 μL of the denatured and annealed Bio-H2 (100 μM) were mixed, and incubated with slow shaking at room temperature for 1.5 h. Finally, the product was centrifuged and washed to obtain H2-modified Au@AgPt@ZIF-8 (H2-Au@AgPt@ZIF-8), which was redispersed in 1 mL of PBS (pH = 7.4) for standby.

[0071] The results of the detection showed that ( Figure 5 ), where a represents 300 mM 12 μL of H1-Au MNPs, b represents H1-Au MNPs + H2-Au@AgPt@ZIF-8 (6 μL each with a concentration of 300 mM), c represents H1-Au MNPs + H2-Au@AgPt@ZIF-8 + S-LBA (4 μL each with a concentration of 300 mM), d represents H1-Au MNP + H2-Au@AgPt@ZIF-8 + S-LBA + LPS (3 μL each with a concentration of 300 mM), as Figure 5As shown in (A) therein, only when H1-Au MNPs, H2-Au@AgPt@ZIF-8, LBA-S (LBA and S strands were mixed evenly at a ratio of 1:1, denatured (95 °C, 10 min), and annealed (40 °C, 1 h) to form LBA-S double strands; S sequence: 5'-AGTGTCCGCCTATCTCGTCTCCTG-3'; SEQ ID NO.3; LBA sequence: 5'-CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT-3'; SEQ ID NO.4), and LPS coexist simultaneously, can an obvious TMB color reaction occur, and the solution changes from colorless to obviously blue. In control groups a, b, and c, since the blocking agent BSA cannot completely shield the catalytic performance of Au MNPs on TMB, there will be weak TMB catalysis, showing a slight light blue color, but this color change is within the allowable range of experimental error. As Figure 5 As shown in (B) therein, only when H1-Au MNP, H2-Au@AgPt@ZIF-8, LBA-S, and LPS coexist simultaneously, can a significant oxTMB SERS signal appear, while the control group has an extremely weak SERS signal of oxTMB, and the signal intensity is within the allowable range of experimental error. Therefore, the feasibility of the entire strategy was successfully verified by this experiment.

[0072] Example 4 Research on the Reproducibility and Specificity of the Detection Strategy

[0073] A reproducibility study was conducted on the composite structure formed for LPS detection in the present invention. As Figure 6 As shown in (A) therein, 30 detection sites were randomly selected for the same sample, and the corresponding three-dimensional SERS spectra were finally obtained, and the average intensity and relative standard deviation (RSD) of the characteristic peak ratio were calculated. See Figure 6 (C) and (D) therein. The distribution and intensity of each SERS characteristic peak can be visually observed from the three-dimensional SERS spectra. Among them, a Raman characteristic peak of the IS molecule 4-mercaptobenzonitrile (4-MBN) is in the silent region of the Raman peak (2225 cm -1 )), which can avoid the interference of other matrices in the sample; as shown in the figure, when calculating the RSD value without adding the characteristic peak of the IS molecule, the obtained RSD value is 17.7%, while when calculating with the addition of the characteristic peak of the IS molecule, the calculated RSD value drops to 5.2%. After comparison, it is concluded that the latter detection result shows good reproducibility, which indicates that the reproducibility of the SERS detection result is significantly improved after adding the IS molecule.

[0074] To evaluate the specificity of the sensor platform, some excipients commonly found in injections such as NaCl and AA were selected as interferents. First, 5 μL of LBA-S (300 mM), 12 μL of H1-Au MNP, and 5 μL of H2-Au@AgPt@ZIF-8 were mixed respectively. Then, interferents were separately prepared into 0.1 ng / ml solutions with 0.1 M PBS (pH = 7.0), and 5 μL of each was added to the mixture. Finally, 5 μL of LPS (0.01 ng / ml) was added. In addition, a mixed sample solution of each 0.1 ng / ml interferent was prepared, and the interferent mixed sample and LPS were dissolved and diluted with 0.1 M PBS (pH = 7.0). The concentration ratio of the interferent mixed sample to LPS was 10:1, and the blank control (Blank) was a sample without any interferent and LPS added. The above solutions were placed at 37 °C for reaction for 1.5 h. After the reaction, magnetic separation was carried out with a magnet to remove the supernatant. Then, 100 μL of NaAc-Hac (pH = 4.0), 17 μL of TMB (12 mM), and 15 μL of H2O2 (30%) were added respectively, mixed well, and placed at 35 °C for reaction for 25 min. Finally, the absorbance values of each sample at 650 nm were measured. As Figure 7 shown, compared with the absorbance values at 650 nm of LPS and the mixed sample, the absorbance values at 650 nm of each interferent were very weak, indicating that the sensor has good specificity for the analysis and detection of LPS.

[0075] Study on the sensitivity of Example 5

[0076] To establish the standard curve for the colorimetric detection of the present invention. First, 5 μL of LBA-S (300 mM), 12 μL of H1-Au MNP, and 5 μL of H2-Au@AgPt@ZIF-8 were mixed respectively. Then, 5 μL of endotoxin test water prepared with Pierce™ Chromogenic Endotoxin Quantification Kit was added respectively to prepare a series of different concentrations (0, 10 -5 、10 -4 、10 -3 、10 -2 、10 -1 、1、10 1 、10 2 、10 3LPS at a concentration of Figure 8 as shown in the figure, as the concentration of LPS decreased, the absorbance at 650 nm also decreased, showing a good linear correlation with the LPS concentration. The linear range of the LPS concentration was 10 -5 -10 3 ng / mL, and the LOD was 10.0 fg / mL. Subsequently, the samples detected by the above colorimetric method were subjected to SERS detection to establish the corresponding SERS detection standard curve. The experimental results are as Figure 9 shown in the figure. As the LPS concentration decreased, the SERS characteristic peak of oxTMB (1337 cm -1 -1) also decreased, while the SERS characteristic peak of the IS molecule 4-MBN (2225 cm -1 -1) remained basically unchanged. The LPS concentration had a wide and good linear relationship with the ratio of the SERS characteristic peaks of oxTMB and 4-MBN (I1337 / I2225). The linear range of the LPS concentration was 10 -5 -10 3 ng / mL, and the LOD was 10.0 fg / mL.

[0077] To investigate the detection sensitivity of the colorimetric-SERS dual-mode sensor constructed in the present invention for LPS, the Pierce™ Chromogenic Endotoxin Quantification Kit and the method constructed in the present invention were used to determine the LPS in glucose injection samples. First, a series of LPS standard solutions with a concentration gradient were prepared using the endotoxin test water and LPS standard provided in the kit. The colorimetric detection of each sample was performed in triplicate using the method of the present invention and the kit detection method, and the absorbance at 650 nm and 405 nm was detected respectively to establish the corresponding standard curve. As Figure 10 shown in the figure, both methods had a wide linear relationship with the LPS concentration. The linear range of the LPS concentration for the kit detection method was 10 -2 -1.0 EU / mL, see (A) and (B) in Figure 10 ; the linear range of the LPS concentration for the method of the present invention was 10 -4 -1.0 EU / mL, see (C) in Figure 10 . Therefore, the method of the present invention has higher sensitivity than the kit detection method.

[0078] After diluting the glucose injection tenfold with 1×PBS (pH = 7.4), a series of LPS solutions with different concentrations in the range of 10 -4 -1.0 EU / mL were prepared using the diluted injection. From Figure 11 It can be seen that when detecting different concentrations of LPS in the glucose injection by the Pierce™ Chromogenic Endotoxin Quantification Kit method and the colorimetric method of the present invention, both detection methods show a certain linear trend, but the colorimetric method of the present invention has higher sensitivity than the colorimetric method of the kit.

[0079] The experimental results show that colorimetric and SERS detections show a linear relationship in the concentration range of 10 -5 ~10 3 ng / mL, and the LOD is 10.0 fg / mL. After comparison with the commercially available Pierce™ Chromogenic Endotoxin Quantification Kit, it shows that the LOD of the method of the present invention is lower than that of the kit. Therefore, the colorimetric-SERS dual-mode sensor constructed in the present invention can accurately and sensitively analyze and evaluate LPS in the injection.

[0080] The present invention synthesized core-shell structured Au@AgPt@ZIF-8 nanozymes with uniform particle size, peroxidase activity, and SERS enhancement performance, and constructed a colorimetric-SERS dual-mode sensing detection platform based on the nucleic acid amplification and amplification CHA strategy to achieve highly specific, accurate, and sensitive detection of LPS, which is expected to provide new ideas for analytical detection in the fields of biomedicine, disease diagnosis, etc.

[0081] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A colorimetric-SERS nanozyme sensor, characterized in that, Containing H2-Au@AgPt@ZIF-8, H1-Au MNPs and LBA-S; The preparation method of the H2-Au@AgPt@ZIF-8 is as follows: 1) Preparation of Au@AgPt@ZIF-8 2) Modification of H2 chain on Au@AgPt@ZIF-8 (1) Add 100 μL of 80 μg / mL streptavidin to 1 mL of Au@AgPt@ZIF-8, and stir and incubate at 4 °C for 18 - 24 h; Centrifuge, and redisperse the obtained SA-Au@AgPt@ZIF-8 in 1 mL of PBS with pH = 7.4 for standby; (2) Denature Bio-H2 at 95 °C for 10 min and anneal at 40 °C for 1 h to obtain denatured and annealed Bio-H2; (3) Mix 100 μL of SA-Au@AgPt@ZIF-8 and 5 μL of 100 μM denatured and annealed Bio-H2, slowly shake and incubate at room temperature for 1.5 h, and finally centrifuge and wash the product to finally obtain H2-Au@AgPt@ZIF-8, and redisperse it in 1 mL of PBS with pH = 7.4 for standby; The Bio-H2 is 5'-TTTTTTTTTTAAAGTCAAAGTCCTATCTCGTCTCCTGACTTTGACTTTACAGGAGAC-3'; SEQ ID NO.2; the 5' end is modified with Bio; The preparation method of the H1-Au MNPs is as follows: 1) Preparation of Au MNPs Mix 10 mg of 4-MBN-Fe3O4@Au NPs, 100 mL of ultrapure water and 300 μL of 0.1 M HAuCl4, then under the condition of intense ultrasound at 30 °C, add 1 mL of 300 mg / mL NH2OH×HCl, react for 10 - 15 min, add 500 mg of polyvinylpyrrolidone, and continue to react for 35 min. After the reaction, wash 3 times with ultrapure water, and finally make the volume up to 5 mg / mL with absolute ethanol to obtain Au MNPs, and store them in the dark at 4 °C; 2) Modification of H1 chain on Au MNP (1) Denature SH-H1 at 95 °C for 10 min and anneal at 40 °C for 1 h to obtain denatured and annealed SH-H1; (2) Mix 100 μL of Au MNPs and 5 μL of 100 μM denatured and annealed SH-H1, incubate at 30 °C and 200 rpm for 10 h, then add 100 μL of 1% BSA and continue to incubate for 3 h, and finally wash with ultrapure water and disperse the product in 1 mL of PBS solution to obtain H1-Au MNPs; The SH-H1 is 5'- TTTTTTTTTTATCTCGTCTCCTGTAAAGTCAAAGTCAGGAGACGAGATAGGCGGACACT-3'; SEQ ID NO.1; the 5' end is modified with SH; The preparation method of LBA-S is as follows: Mix the LBA sequence and the S chain sequence at a ratio of 1:1, denature at 95 °C for 10 min, and anneal at 40 °C for 1 h to form the LBA-S double strand; The S chain sequence: 5'-AGTGTCCGCCTATCTCGTCTCCTG-3'; SEQ ID NO.3; The LBA sequence: 5'-CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT-3'; SEQ ID NO.

4.

2. The colorimetric-SERS nanozyme sensor according to claim 1, wherein, The preparation method of Au@AgPt@ZIF-8 is as follows: (1) Add 50 mL of 1 mM HAuCl4 solution to a 100 mL round-bottom flask, heat and reflux in an oil bath at 120 °C until boiling. After boiling for 5 - 10 min, quickly add 5 mL of 38.8 mM sodium citrate, continue heating and reacting for 15 - 20 min. Finally, obtain a dark red 10 nm Au NPs colloidal solution. After cooling to room temperature, store it in the dark at 4 °C for later use; (2) In a 25 mL round-bottom flask, add 11.5 mL of ultrapure water, 1 mL of 10 nm Au NPs, and 12 mL of 10 mM cetyltrimethylammonium chloride respectively, stir at room temperature for 20 min. Then add 300 μL of 100 mM ascorbic acid solution and 500 μL of 200 mM NaOH solution respectively, and continue stirring for 20 min. Under the condition of 25 - 35 °C, quickly add 1 mL of 10 mM AgNO3 solution, and add 0.5 mL of 10 mM H2PtCl6 drop by drop every 20 - 30 s. After the addition is completed, continue reacting for 60 min to finally obtain dark brown Au@AgPt NPs, and store them at 4 °C for later use; (3) In a 20 mL glass test tube, add 2 mL of 10 mM cetyltrimethylammonium bromide and 1 mL of 1.32 M 2-methylimidazole respectively, mix evenly by ultrasonic for 60 min. Then add 10 mL of 0.5 M Zn(NO3)2 and 1 mL of Au@AgPt NPs respectively, carry out ultrasonic mixing reaction at 70 °C for 20 min, and then place it in a water bath at 30 °C and react for 2 - 3 h to obtain the gray-black product Au@AgPt@ZIF-8. Wash it 3 times by centrifugation with ultrapure water and store it at 4 °C for later use.

3. The colorimetric-SERS nanozyme sensor according to claim 1, wherein The preparation method of 4-MBN-Fe3O4@Au NPs is as follows: (1) Add 100 mL of ethylene glycol and 1.43 g of FeCl3×6H2O into a 250 mL round-bottom flask and mix well by ultrasound. Then add 0.2 g of polyethylene glycol and 0.4 g of anhydrous sodium acetate. Stir the resulting mixture vigorously overnight to mix thoroughly. After thorough mixing, transfer the resulting mixture to a Teflon-lined stainless steel autoclave and react at 180 - 200 °C for 10 hours. After the reaction is complete, perform magnetic separation on the product, and wash it 3 times each with ultrapure water and absolute ethanol successively. Finally, air-dry the product naturally at room temperature to obtain Fe3O4 NPs, and store it sealed for later use; (2) Add 180 mL of ultrapure water, 5 mL of 5 mM HAuCl4, and 10 mL of 5 mM sodium citrate into a 250 mL round-bottom flask respectively. Stir vigorously for 5 min to mix thoroughly. Finally, add 5 mL of 0.1 M NaBH4 and stir vigorously for 2 - 4 hours to finally obtain a brownish-red 4 nm Au NPs colloidal solution; (3) Add 0.3 g of polyethyleneimine into 50 mL of ultrapure water and mix well by ultrasound for 10 - 15 min to obtain a PEI solution; Then weigh 10 mg of Fe3O4 NPs and add them into the PEI solution, react by ultrasound for 20 min, and then wash it 3 times with ultrapure water to obtain Fe3O4-PEI; (4) Weigh 10 mg of Fe3O4-PEI and add it into an excess of 4 nm Au NPs solution, and react under ultrasonic conditions for 2 h. Then perform magnetic separation and wash it 3 times each with ultrapure water and absolute ethanol successively to obtain Fe3O4@Au NPs; (5) Add 10 mL of 10 -3 M 4-MBN to 1 mL of 5 mg / mL Fe3O4@Au NPs. Place the resulting mixture in a -20 °C refrigerator and incubate for 30 min. Let it cool naturally to room temperature and make up the volume to 10 mL with absolute ethanol to obtain 4-MBN-Fe3O4@AuNPs.

4. Use of the colorimetric-SERS nanozyme sensor described in claim 1 in the preparation of an LPS detection kit.

Images