Antibiotic resistance gene photoelectric detection sensor and its preparation method and application

By using Bi2S3/ZnIn2S4 heterojunction material and a photoelectric sensor with aptamer-fixed electron donors, combined with catalytic hairpin self-assembly technology, the problem of efficient detection of antibiotic resistance genes in resource-limited areas was solved, and simple and sensitive CTX-M-15 quantitative detection was achieved.

CN119959324BActive Publication Date: 2025-10-03ANHUI NORMAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510101036.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-22
Publication Date
2025-10-03
Estimated Expiration
2045-01-22

AI Technical Summary

Technical Problem

Existing technologies make it difficult to detect antibiotic resistance genes, especially CTX-M-15, efficiently and conveniently in resource-limited areas. Traditional methods require expensive instruments and professionals, limiting their applicability to on-site environmental monitoring.

Method used

Bi2S3/ZnIn2S4 heterojunction material is used as the basis of the photoelectric sensor, combined with aptamer-fixed electron donor and catalytic hairpin self-assembly technology, to achieve quantitative detection of CTX-M-15 through nucleic acid recognition, avoiding the use of high concentration electron donors in the solution.

Benefits of technology

It achieves simple and sensitive detection of antibiotic resistance genes, improves detection efficiency, reduces resource requirements, and is suitable for on-site environmental monitoring.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119959324B_ABST
    Figure CN119959324B_ABST
Patent Text Reader

Abstract

The present invention provides a photoelectric detection sensor for antibiotic resistance genes, its preparation method, and application. The present invention designs a Bi2S3 / ZnIn2S4 heterojunction as a photoelectric material, combined with a method of fixing electron donors with aptamers, to construct a biosensor system for detecting resistance genes. The system consists of two parts: catalytic hairpin self-assembly and DNAzyme cleavage. Compared with the prior art, the present invention can fix the electron donor through the aptamer, and cyclically amplify the target through the method of catalytic hairpin self-assembly. The recognition interaction between nucleic acids can achieve quantitative detection of CTX-M-15, which is simple to operate and highly sensitive.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of environmental detection, and in particular relates to an antibiotic resistance gene photoelectric detection sensor and a preparation method and application thereof. Background Art

[0002] Difficult-to-treat antibiotic-resistant bacteria are becoming increasingly common and have become a serious global health crisis. Antibiotic resistance is encoded by specific genes, some of which can be transferred between bacteria via plasmids. Detection of antibiotic resistance genes (ARGs) has significant clinical diagnostic value, providing physicians with guidance on appropriate treatment for antibiotic-resistant patients at the early stages of bacterial infection, thereby improving antibiotic efficacy.

[0003] Antibiotic resistance genes, emerging pollutants in the environment, have attracted widespread attention due to their widespread dissemination through horizontal gene transfer and environmental persistence, posing a serious threat to ecological security and human health. Resistance genes are "easy to acquire, hard to lose" and are present in various environmental media, such as air, soil, and wastewater. Furthermore, different types of resistance genes may often coexist in the same area, leading to the emergence of multidrug-resistant bacteria and posing an even greater threat to human health.

[0004] However, existing conventional methods for detecting ARGs mainly rely on metagenomic sequencing and polymerase chain reaction (PCR, such as quantitative PCR and droplet digital PCR). Although these are accurate and reliable measurement methods, these analyses require expensive instruments, highly trained professionals, and complex thermal cycling. This hinders their applicability for on-site environmental monitoring, especially in resource-limited areas.

[0005] Photoelectrochemical (PEC) sensing, a novel sensing technology that combines the PEC process with target recognition reactions, has rapidly developed in the field of analytical detection. Therefore, it is necessary to provide novel, efficient, and convenient PEC strategies for photoelectric detection of antibiotic resistance genes. Summary of the Invention

[0006] The present invention aims to provide an antibiotic resistance gene photoelectric detection sensor and a preparation method thereof. An aptamer is used to immobilize an electron donor, and a catalytic hairpin self-assembly method is used to cyclically amplify the target. The recognition interaction between nucleic acids can achieve quantitative detection of CTX-M-15. The sensor is simple to operate, highly sensitive, convenient and efficient.

[0007] The present invention also provides an application of an antibiotic resistance gene photoelectric detection sensor for detecting the resistance gene CTX-M-15.

[0008] The specific technical solutions of the present invention are as follows:

[0009] A method for preparing an antibiotic resistance gene photoelectric detection sensor comprises the following steps:

[0010] 1) After Bi2S3 / ZnIn2S4 (BZ) material is aminated, it is dispersed in water to prepare a solution, which is then added dropwise to an ITO electrode to prepare a BZ / ITO electrode;

[0011] 2) Place the hairpin DNA H P The H was activated by placing it in a mixed solution containing N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS). Subsequently, the obtained solution was dropped onto the BZ / ITO electrode and incubated to obtain H P / BZ / ITO electrode;

[0012] 3) Add a series of different concentrations of antibiotic resistance genes to the mixture of DNA H1, DNA H2 and DNA H3, and react; then, drop the resulting mixture onto H P / BZ / ITO electrode, reaction;

[0013] 4) React the electrode prepared in step 3) with the buffer solution containing 0.1 mL of 20 mM dopamine DA and the Split-2 solution to obtain DA / Apt DA / BZ / ITO electrode;

[0014] 5) Under xenon lamp irradiation, DA / Apt DA The / BZ / ITO electrode was subjected to photoelectrochemical (PEC) detection in Tris-HCl solution to establish a linear relationship between the PEC signal intensity of the electrode and the concentration of antibiotic resistance genes, thereby achieving quantitative detection of antibiotic resistance genes.

[0015] The preparation method of the Bi2S3 / ZnIn2S4 material in step 1) is:

[0016] 1-1) Mix 1,3,5-benzenetricarboxylic acid H3BTC and Bi(NO3)3·5H2O, add methanol, heat to react, separate, wash, and dry to obtain Bi-MOFs;

[0017] 1-2) Dispersing Bi-MOFs in a mixed solvent of water and glycerol, stirring and mixing, adjusting the pH to 2.5, then sequentially adding InCl3⋅4H2O, ZnCl2, and thioacetamide, heating for reaction, separating, washing, and drying to obtain Bi2S3 / ZnIn2S4 material;

[0018] In step 1-1), the mass ratio of 1,3,5-benzenetricarboxylic acid H3BTC and Bi(NO3)3·5H2O is 5:1;

[0019] In step 1-1), the usage ratio of 1,3,5-benzenetricarboxylic acid and methanol is 0.012-0.015 g / mL;

[0020] In step 1-1), the heating reaction refers to a reaction at 120°C for 24 hours; preferably, the reaction is carried out in a Teflon tube at 120°C for 24 hours, the precipitate is collected by centrifugation, washed with methanol, and dried at 60°C overnight to obtain Bi-MOFs;

[0021] In steps 1-2), the volume ratio of water to glycerol is 4:1;

[0022] In step 1-2), the ratio of Bi-MOFs to the mixed solvent of water and glycerol was 0.01 g / mL;

[0023] In step 1-2), the molar ratio of InCl3⋅4H2O, ZnCl2 and thioacetamide is 2:1:4;

[0024] In step 1-2), the ratio of Bi-MOFs to InCl3⋅4H2O is 1:4 g / mmol;

[0025] In step 1-2), the heating reaction refers to reacting at 80°C for 2 hours; preferably, the reaction is carried out at 80°C for 2 hours in a Teflon-lined autoclave, and the resulting product is repeatedly washed with deionized water and ethanol, and dried at 60°C overnight to obtain Bi2S3 / ZnIn2S4 material.

[0026] Preferably, the Bi2S3 / ZnIn2S4 material preparation method is:

[0027] 1-1) After mixing 0.75 g of H3BTC and 0.15 g of Bi(NO3)3·5H2O, 60 mL of methanol was added and the mixture was stirred at room temperature for 30 minutes; the reaction mixture was heated to 120°C under sealed conditions for 24 hours; the precipitate was collected by centrifugation, washed with methanol, and dried at 60°C overnight;

[0028] 1-2) 0.1 g Bi-MOFs was dispersed in a mixed solution of 8.0 mL water and 2.0 mL glycerol, stirred for 0.5 h, and after adding 1 mM HCl solution to adjust the pH to 2.5, 0.4 mmol InCl3⋅4H2O, 0.2 mmol ZnCl2, and 0.8 mmol thioacetamide (TAA) were added sequentially; the mixture was reacted in an oil bath at 80 °C for 2 h, and then the black solid was collected by centrifugation, washed with deionized water and anhydrous ethanol, and then dried in an oven at 60 °C overnight to obtain Bi2S3 / ZnIn2S4 material, referred to as BZ.

[0029] The Bi2S3 / ZnIn2S4 material is subjected to amination:

[0030] The Bi2S3 / ZnIn2S4 material was dispersed in N,N-dimethylformamide (DMF), (3-aminopropyl)triethoxysilane (APTES) was added, and the mixture was heated to reflux. The product was collected and dried to obtain a surface functionalized Bi2S3 / ZnIn2S4 material with amino groups, referred to as BZ-NH2.

[0031] The dosage ratio of the Bi2S3 / ZnIn2S4 material and N,N-dimethylformamide is 6-7 mg / mL;

[0032] The volume ratio of the N,N-dimethylformamide and (3-aminopropyl)triethoxysilane is 75:1;

[0033] The heating reflux refers to reflux reaction at 120°C for 2h;

[0034] Preferably, the Bi2S3 / ZnIn2S4 material is subjected to amination by:

[0035] 100 mg of BZ was dispersed in 15 mL of N,N-dimethylformamide (DMF), and then 200 μL of (3-aminopropyl)triethoxysilane (APTES) was added and refluxed at 120 °C for 2 hours. The product was collected and dried at 60 °C for 12 hours to obtain surface-functionalized BZ with amine groups (BZ-NH2).

[0036] In step 2), the hairpin DNA H P The gene sequence is:

[0037] 5'-COOH-TTTTGCTGCAGTGAGGTGTGGACGCTTACTAT / rA / GCATAGGACCACAGGTCAATGCAGC-3'; The sequence is shown in SEQ ID NO. 1; it contains a split aptamer DNA that can specifically recognize dopamine;

[0038] In step 3), the antibiotic resistance gene is CTX-M-15;

[0039] In step 3), the concentrations of DNA H1, DNA H2, and DNA H3 in the resulting mixture are all 50 nM;

[0040] Step 3) is preferably: H PAfter the / BZ / ITO electrode was lightly washed, a series of different concentrations of CTX-M-15 (from 0.1 fM to 1.0 nM) were added to the mixed solution of DNA H1, DNA H2 and DNA H3, respectively. The concentrations of DNA H1, DNA H2 and DNA H3 in the mixed solution were all 50 nM. The reaction was carried out at 25 °C for 2 h. Subsequently, the obtained mixed solution was dropped onto the H P / BZ / ITO electrode and reacted at 25℃ for 30 minutes.

[0041] In step 3), the gene sequence of the DNA H1 is:

[0042] 5'-CATCTCTTCAGCGATGGAAGATACGAAGGTATTAATTCGTATCTTCCAGAATAAGATCACCCATGTTAGTTAGT-3'; The sequence is shown in SEQ ID NO. 2;

[0043] In step 3), the gene sequence of the DNA H2 is: 5'-CATCTCTTCACGCGATTACTTATTCTGGAAGATACGAAGAACCAGAATAAGTATAATCCTTCCCACCCATCTTAGT-3'; the sequence is shown in SEQ ID NO. 3;

[0044] In step 3), the gene sequence of the DNA H3 is:

[0045] 5'-CATCTCTTCAGCGATGGAAGGATTATACTTATTCTGGTTCACATTAATCCTTCGTATCTTCCAGCACCCAT-3'; the sequence is shown in SEQ ID NO. 4;

[0046] In step 4), a buffer solution containing 0.1 mL of 20 mM dopamine DA and a buffer solution from Split-2 are reacted with the electrode prepared in step 3) for 30 minutes to induce the formation of a DA-AptDA complex; a DA / AptDA / BZ / ITO electrode is prepared; the electrode is then thoroughly washed with a buffer solution; the resulting modified electrode can be used for electrochemical and photoelectrochemical measurements.

[0047] In step 5), the test was performed with 5 mL of 0.1 M Tris-HCl solution at pH 7.4 under irradiation with a xenon lamp at λ>420 nm.

[0048] The present invention provides an antibiotic resistance gene photoelectric detection sensor, which is prepared by the above method.

[0049] The present invention provides an application of an antibiotic resistance gene photoelectric detection sensor for detecting the resistance gene CTX-M-15 to achieve quantitative detection. The detection method is:

[0050] The sensor prepared as above is used to detect the sample to be detected, and the quantitative detection of CTX-M-15 is achieved based on the obtained electrical signal and the linear relationship.

[0051] The linear relationship is Y = 1.020 X + 8.145, R 2 = 0.9916; Y is the photocurrent in μA, and X is the logarithm of the target concentration in nM. The detection range is 0.1 fM to 1.0 nM, and the detection limit is 3.24 aM.

[0052] All DNA chains in the present invention were diluted in annealing buffer (150 mM NaCl, 10 mM Tris, 10 mM MgCl2·6H2O, pH=7.4).

[0053] All PEC tests were performed under xenon lamp irradiation at λ>420 nm with 5 mL of 0.1 M Tris-HCl solution at pH 7.4.

[0054] To achieve PEC detection, the photoelectric conversion efficiency of the material can generally be improved by adjusting the structure and morphology of the interface or doping. In addition, electron donors such as ascorbic acid (AA) and dopamine (DA) are often dissolved into the test solution to further accelerate the generation of photoelectrons to obtain a strong PEC signal. However, high concentrations of electron donors are required to overcome the double layer and diffusion effects of the sensing interface. This can lead to unstable photocurrent, high background, reagent waste, and biochemical interface contamination.

[0055] This paper designs a biosensor system for detecting resistance genes, using a Bi2S3 / ZnIn2S4 heterojunction as a photoelectric material and an aptamer-immobilized electron donor. The system consists of two parts: catalytic hairpin self-assembly and DNAzyme cleavage. In the presence of the resistance gene CTX-M-15, it hybridizes with the complementary sequence of H1 and unfolds H1 to produce a T-H1 assembly. Its newly exposed binding domain then opens H2 to produce a T-H1-H2 complex. The newly exposed T-H1-H2 domain can then react with H3, forming a complex with three Mg residues at the ends of H1, H2, and H3. 2+ The CHA product of the DNA enzyme can release a large number of initiating T sequences, and each T copy can be used in the reverse direction for the CHA assembly process, generating a continuous positive feedback. Subsequently, the DNA enzyme connects to the H immobilized on the BZ / ITO electrode. p Substrate hairpin hybridization, in Mg 2+ions, can cleave H at the rA site p To release the Split-1 sequence. In addition, trivalent DNAzyme linkage can effectively cleave H p This releases a large amount of Split-1, which can bind to a large number of DA molecules and combine with Split-2 to generate a large current signal, enabling highly sensitive photoelectrochemical identification of ARGs. The gene sequence of Split-1 is: 5'- TTCGCAGGTGTGGAGTGACGTCG -3', as shown in SEQ ID NO. 5; the gene sequence of Split-2 is: 5'-COOH-CGACGCCAGTTTGAAGGTTCG-3', as shown in SEQ ID NO. 6; and the gene sequence of the T sequence is: CTTATTCTGGAAGATACGAA, as shown in SEQ ID NO. 7.

[0056] The inventors have found that it is desirable to introduce electron donors in a reasonable and effective manner to further enhance the PEC signal. Constructing a method based on aptamer-immobilized electron donors to enhance the photoelectric signal intensity and using it for the detection of antibiotic resistance genes has broad application prospects. The aptamer-induced spatially confined electron donor provided by the present invention enables the Bi2S3 / ZnIn2S4 heterojunction coating electrode to be used in the photoelectrochemical detection method of antibiotic resistance genes. Enhancing the PEC signal by spatially confining electron donors through aptamer assembly at the Bi2S3 / ZnIn2S4 heterojunction is a novel method that can effectively and sensitively improve the photoelectric conversion efficiency. This progress is expected to stimulate more interest in the development of bioanalysis.

[0057] Compared to existing technologies, the antibiotic resistance gene detection method constructed by the present invention utilizes aptamers to immobilize electron donors and, through catalytic hairpin self-assembly, cyclically amplifies the target. This method, leveraging the recognition interaction between nucleic acids, enables quantitative detection of CTX-M-15. This method is simple to operate and highly sensitive. This method avoids the strong background signal caused by the addition of high-concentration electron donor reagents to the PEC test solution. Neither the electron donor nor the aptamer alone can trigger the catalytic hybrid self-assembly and DNAzyme cleavage reactions. Using Bi2S3 / ZnIn2S4 heterojunction-assembled aptamers to spatially confine the electron donor to enhance the PEC signal is a novel approach that can effectively and sensitively improve photoelectric conversion efficiency. This advance is expected to stimulate further interest in the development of bioanalysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 Schematic comparison of PEC responses with and without aptamer-restricted electron donors;

[0059] Figure 2 Schematic diagram of the present invention for detecting ARGs by anchoring electron donors on the electrode surface;

[0060] Figure 3 Detection diagrams of the products prepared in the present invention: (A) SEM image of -BZ, (B) TEM image of -BZ, (C) elemental mapping of -BZ, (D) HRTEM image, (E) powder XRD patterns of -BS, BZ and ZIS, (F) XPS measurement spectrum of -BZ, (G) PEC responses of -BS, BZ and ZIS;

[0061] Figure 4 To verify the EIS, CV and PEC test diagrams of the electrodes in ASED, the A- and B- diagrams are the bare electrode, BZ / ITO, and Apt DA / BZ / ITO and DA / Apt DA EIS curves and CV curves of / BZ / ITO, C-bare ITO, BZ / ITO, Apt / BZ / ITO, DA / Apt DA PEC responses of / BZ / ITO and DA (5 nM) in solution;

[0062] Figure 5 For detection, calibration, and selectivity testing; A - PEC response in tris-HCl containing different concentrations of DA and the corresponding calibration curve for DA analysis, (B) - Stability of the PEC sensor in the presence of 8 nM DA for 15 cycles of continuous light off, and (C) - Selectivity of the sensor;

[0063] Figure 6 Electrode testing diagrams for resistance gene detection experiments; (A) EIS plots of different electrodes; (B) PEC testing with Split-2, DA, and target T as variables, while other detection conditions remained unchanged; and (C) Polyacrylamide gel electrophoresis verifying the feasibility of the CHA system.

[0064] Figure 7 Detection graphs; (A) - PEC response in tris-HCl containing different concentrations of target (from 0.1 fM to 1.0 nM), (B) - linear correlation curve of ARGs analysis, inset: corresponding calibration curve of ARGs sensor, (C) - stability of PEC sensor in the presence of 25 pM target and continuous on-off light for 20 cycles, and (D) - selectivity of the prepared sensor for detection of different targets;

[0065] Figure 8 This is a possible electron transfer mechanism for the ASED strategy. DETAILED DESCRIPTION

[0066] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0067] Unless otherwise specified, the test materials and reagents used in the following examples can be obtained from commercial sources.

[0068] If no specific techniques or conditions are specified in the examples, they can be carried out according to the techniques or conditions described in the literature in the field or according to the product instructions.

[0069] All DNA chains in the present invention were diluted in annealing buffer (150 mM NaCl, 10 mM Tris, 10 mM MgCl2·6H2O, pH=7.4) before use, i.e., DNA H P The solvents of DNA H1, DNA H2, and DNA H3 solutions were all buffer (150 mM NaCl, 10 mM Tris, 10 mM MgCl2·6H2O, pH=7.4).

[0070] All PEC tests were performed under irradiation with a xenon lamp at λ>420 nm and a 5 mL Tris-HCl solution of 0.1 M and pH 7.4.

[0071] The present invention prepares Bi2S3 and ZnIn2S4 for comparison:

[0072] Method for preparing Bi2S3: 1.82 g Bi(NO3)3·5H2O, 1.35 g Na2S·9H2O and 1.92 g urea were added to 75 mL ethylene glycol (EG) solution and stirred vigorously for 20 minutes; the resulting mixture was then transferred to a Teflon-lined autoclave and heated at 180°C for 24 hours; the resulting product was repeatedly washed with deionized water and ethanol and dried at 60°C overnight to obtain Bi2S3, abbreviated as BS.

[0073] The preparation method of ZnIn2S4 is:

[0074] Under ultrasonic treatment, 1.317 g Zn(C2H3O2)2·2H2O, 2.654 g InCl3, and 2.404 g TAA were dissolved in 500 mL deionized water for 20 min; then, the obtained solution was sealed and placed in a 100°C oven for 7 h. The yellow precipitate was collected by centrifugation, washed three times with deionized water, and then dried in a vacuum freeze-drying equipment for 24 h to obtain ZnIn2S4, abbreviated as ZIS. Example 1

[0075] A method for preparing an antibiotic resistance gene photoelectric detection sensor comprises the following steps:

[0076] 1) H3BTC (0.75 g) and Bi(NO3)3 5H2O (0.15 g) were added to a 100 mL reactor. Methanol (60 mL) was then added and the mixture was vigorously stirred at room temperature for 30 minutes. The reactor was then placed in a steel container, sealed, and heated to 120°C for 24 hours. The precipitate was collected by centrifugation, washed three times with methanol, and dried at 60°C overnight to obtain Bi-MOFs.

[0077] 2) The synthesized Bi-MOFs (0.1 g) were dispersed in a mixed solution of 8.0 mL of water and 2.0 mL of glycerol and stirred for 0.5 h. After the pH value was adjusted to 2.5 by adding 1 mM HCl solution, 0.4 mmol InCl3⋅4H2O, 0.2 mmol ZnCl2, and 0.8 mmol thioacetamide (TAA) were added sequentially. The mixture was reacted at 80°C in an oil bath for 2 h, and the black solid was collected by centrifugation, washed with deionized water and anhydrous ethanol, and then dried in an oven at 60°C overnight to obtain Bi2S3 / ZnIn2S4 (BZ). This achieved a one-pot synthesis of BZ heterojunction.

[0078] 3) 100 mg of BZ was dispersed in 15 mL of N,N-dimethylformamide (DMF), and then 200 μL of (3-aminopropyl)triethoxysilane (APTES) was added and refluxed at 120°C for 2 hours; the product was collected and dried at 60°C for 12 hours to obtain surface-functionalized BZ with amino groups (BZ-NH2), realizing the amination reaction of the BZ heterojunction.

[0079] 4) Disperse the BZ-NH2 material in deionized water to prepare a Bi2S3 / ZnIn2S4 solution with a concentration of 3 mg / mL. First, add 0.05 mL of the solution onto an ITO electrode and dry it at 60°C. Then, add another 0.05 mL onto the ITO electrode and dry it at 60°C to prepare a BZ / ITO electrode.

[0080] 5) Add 60 μL (100 μM) hairpin DNA HP The solution was placed in a -1 N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC) and 200 mg mL -1 The electrode was activated in a mixed solution (1 mL) of N-hydroxysuccinimide (NHS) for 0.5 h at 4 °C to activate the carboxyl groups. Subsequently, the resulting solution was dropped onto the electrode and incubated for 12 h to obtain H P / BZ / ITO electrode;

[0081] 6) H P After rinsing the / BZ / ITO electrode three times with Tris-HCl buffer (0.2 mM, pH 7.4), a series of different concentrations (ranging from 0.1 fM to 1.0 nM) of the target compound CTX-M-15 were added to a solution containing DNA H1 (50 nM), DNA H2 (50 nM), and DNA H3 (50 nM) (in annealing buffer, 150 mM NaCl, 10 mM Tris, 10 mM MgCl₂·6H₂O, pH 7.4) and allowed to react at 25°C for 2 h. Subsequently, 0.1 mL of the prepared mixed solution was dripped onto the electrode prepared in step 5) and allowed to react at 25°C for 30 min.

[0082] 7) 0.1 mL of 20 mM Tirs-HCl buffer containing DA (0.2 mM) and the buffer of Split-2 were added to the electrode prepared in step 6) and incubated for 30 minutes to obtain DA / Apt DA / BZ / ITO electrode, rinse the electrode thoroughly with buffer.

[0083] 8) By immersing the corresponding electrodes in a solution containing 5.0 mM [Fe(CN)6] 3- / 4- Cyclic voltammetry (CV) was performed at different scan rates in 5 mL Tris-HCl solution containing 0.1 M KCl and 10.0 mM [Fe(CN)6] 3- and [Fe(CN)6] 4- Electrochemical impedance spectroscopy (EIS) of different electrodes was performed in 0.1 M KCl solution. PEC measurements were performed in Tris-HCl solution (5 mL, 0.1 M, pH 7.4) under irradiation with a xenon lamp (λ>420 nm).

[0084] The aptamer-induced spatially restricted electron donor strategy is called (ASED); the verification of the ASED strategy of the present invention includes the following steps:

[0085] 1) The Bi2S3 / ZnIn2S4 (BZ) material prepared by the same method as above was aminated, dispersed in water to prepare a solution, and then dropped onto the ITO electrode to prepare a BZ / ITO electrode;

[0086] 2) 60 μL (100 μM) of the aptamer Split-1 was activated in a mixed solution (1 mL) containing 20 mg·mL⁻¹ N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC) and 200 mg·mL⁻¹ N-hydroxysuccinimide (NHS) for 0.5 h at 4 °C to activate the carboxyl groups. Subsequently, the above solution was dripped onto the electrode and incubated for 12 h.

[0087] 3) 60 μL (100 μM) of aptamer Split-2 buffer was reacted with the electrode prepared in step 2) for 30 min to prepare Apt DA / BZ / ITO electrode;

[0088] 4) 0.1 mL of buffer solution containing different concentrations of dopamine (DA) from 1 to 14 nM was reacted with the electrode prepared in step 3) for 30 minutes to induce DA-Apt. DA Complex production; preparation of DA / Apt DA Photoelectrochemical (PEC) detection was performed in Tris-HCl solution under xenon lamp irradiation to establish a linear relationship between the PEC signal intensity of the electrode and the dopamine concentration, thereby verifying the feasibility of the ASED system.

[0089] Figure 1 The figure shows a comparison of the PEC response diagrams with and without aptamer-restricted electron donors. It can be seen from the figure that compared with adding electron donors to the solution, using aptamers to immobilize electron donors can effectively enhance the photoelectric signal.

[0090] Figure 2 Schematic diagram of the present invention for detecting ARGs by anchoring electron donors on the electrode surface. First, the modified H p (containing Split-1 sequence) containing H p In the presence of the resistance gene CTX-M-15 (T), the / BZ / ITO electrode hybridizes with the complementary sequence of H1 and unfolds H1 to produce a T-H1 assembly. Its newly exposed binding domain then opens H2 to produce a T-H1-H2 complex. The newly exposed T-H1-H2 domain can then react with H3 to form a complex with three Mg at the ends of H1, H2, and H3. 2+The CHA product of the DNA enzyme can release a large number of initiating T sequences, and each T copy can be used in the reverse direction for the CHA assembly process, generating a continuous positive feedback. Subsequently, the DNA enzyme connects to the H immobilized on the BZ / ITO electrode. p Substrate hairpin hybridization, in Mg 2+ ions, can cleave H at the rA site p To release the Split-1 sequence and obtain Apt DA / BZ / ITO electrode. In addition, trivalent DNAzyme can effectively cleave H p To release a large amount of Split-1, Split-1 can bind to a large number of DA molecules and combine with Split-2 to form an aptamer-DA complex electrode (DA / Apt DA / BZ / ITO electrode) generates a large amount of current signal for high-sensitivity photoelectrochemical identification of ARGs.

[0091] Figure 3 Detection images of the products prepared in this invention include: (A) SEM image of -BZ, (B) TEM image of -BZ, (C) elemental mapping of -BZ, (D) HRTEM image of BZ, (E) powder XRD patterns of -BS, BZ, and ZIS, (F) XPS spectrum of -BZ, and (G) PEC responses of -BS, BZ, and ZIS. BS material was dispersed in deionized water to prepare a BS solution (3 mg / mL) for preparing a BS / ITO electrode. ZIS material was dispersed in deionized water to prepare a ZIS solution (3 mg / mL) for preparing a ZIS / ITO electrode for testing.

[0092] Figure 3 In the one-pot synthesis using Bi-MOF as a template, the BZ heterojunction exhibited a columnar morphology composed of thin sheets (Figure 3A and Figure 3B). The corresponding elemental mapping images of BZ showed that bismuth, indium, zinc, and sulfur atoms were uniformly dispersed throughout the matrix ( Figure 3 In addition, high-resolution transmission electron microscopy (HRTEM) images of BZ showed two lattice fringes of 0.188 and 0.359 nm ( Figure 3 D), which are assigned to the (113) crystal plane of ZIS and the (130) crystal plane of BS, respectively. The diffraction peaks of the BZ heterojunction match well with the hexagonal phase of high-purity BS (JCPDS-17-0320), indicating a complete transformation of Bi-MOF to BS. No characteristic peaks of Bi-MOF were found, while the peaks corresponding to ZIS (JCPDS-65-2023) were obvious, reflecting the successful construction of the BZ heterojunction ( Figure 3(E). X-ray photoelectron spectroscopy (XPS) was used to determine the elemental composition and chemical state of the BZ surface. The full spectrum of BZ reveals the presence of Bi, S, Zn, and In. These results confirm the formation of a close and uniform interface between the ZIS and BS. The PEC signal of the BZ electrode is significantly enhanced compared to the pure BS and ZIS electrodes. This is likely due to the highest separation efficiency of photogenerated charge carriers in the BZ heterostructure.

[0093] Figure 4 During the modification process, the impedance gradually increased and the CV gradually decreased, which proved that the DA detection platform was successfully prepared. Compared with the BZ / ITO electrode, DA was confined to the electrode surface, and a larger PEC change could be seen. When DA was added to the test solution, the PEC signal intensity increased relative to the BZ / ITO electrode, but it was still lower than anchoring it on the electrode surface. This shows that the modification of the aptamer on the electrode surface can effectively confine the electron donor to the electrode surface, and the distance between the electron donor and the PEC electrode is greatly reduced. This further highlights the advantages of fixed electron donors to the PEC system, and effectively avoids the waste of electron donors, effectively enhancing the PEC signal. Among them, by immersing the corresponding electrode in a solution containing 5.0 mM [Fe(CN)6] 3- / 4- Cyclic voltammetry (CV) was performed in 5 mL Tris-HCl solution containing 0.1 M KCl at a scan rate of 0.1 mV / s. 3- / 4- Electrochemical impedance spectroscopy (EIS) was performed on different electrodes in 0.1 M KCl solution. The process parameters for testing the photocurrent were consistent, and PEC measurements were all performed in Tris-HCl solution (5 mL, 0.1 M, pH 7.4) under irradiation with a xenon lamp (λ>420 nm).

[0094] Figure 5 It can be seen that a good linear relationship was obtained when the DA concentration range was 1-14 nM ( Figure 5 The obtained repetitive photocurrent response for 15 alternating “on-off” cycles shows the good stability of the proposed platform ( Figure 5 (B). Therefore, the PEC platform based on confined aptamers is a promising candidate for enhancing PEC signals. To investigate the selectivity of this PEC sensor, several electron donors, such as AA, L-cys, NaCl, resorcinol, H2O2, HQ, and GA, were selected as interfering analytes. Mix is ​​a mixture of AA, L-cys, NaCl, resorcinol, H2O2, HQ, GA, and DA. The concentration of these interfering substances was 20 nM. Figure 5As shown in Figure C, even at a concentration 2.5 times higher than that of the target DA, the non-target molecule only produced a relatively low photocurrent response, which is basically consistent with the blank group. Therefore, the PEC platform based on confined aptamers on electrodes is a promising candidate for enhancing PEC signals.

[0095] Figure 6 The results in Figure A show that bare ITO shows a small Ret. When Hp is fixed on the electrode, Ret increases, which is attributed to the H p The negative charge on the phosphate backbone repels [Fe(CN)6] 3- / 4- However, with the addition of CTX-M-15 and DA to the system, Ret gradually increased. The EIS results not only confirmed the successful assembly process but also preliminarily demonstrated the feasibility of this sensing strategy. Figure 6 Figure B is obtained by performing PEC tests using Split-2, DA, and target T as variables, while keeping other detection conditions unchanged. This further shows that only when dopamine, target T, and split-2 are present at the same time will a significant photocurrent signal be generated. In contrast, no matter which one is missing, the photocurrent signal has only slight or negligible changes. In addition, Figure 6 Figure C shows the feasibility of the CHA system verified by polyacrylamide gel electrophoresis. The mixture of H1, H2, and H3 showed three distinct mixed bands (lane b) because the three hairpins did not hybridize (lanes ce). Incubation of T with the mixture of H1, H2, and H3 resulted in the formation of a new band (lane f) with a highly reduced electrophoretic mobility and a reduced intensity of the hairpin band, indicating that T triggered the assembly of the three hairpins. These results show that the trivalent DNAzyme structure is capable of ultrasensitive monitoring of T. Among them, at room temperature, in the presence of 5.0 mM [Fe(CN)6] 3- / 4- Electrochemical impedance spectroscopy (EIS) was performed on different electrodes in 0.1 M KCl solution. The process parameters for testing the photocurrent were consistent, and PEC measurements were all performed in Tris-HCl solution (5 mL, 0.1 M, pH 7.4) under irradiation with a xenon lamp (λ>420 nm).

[0096] Figure 7Figure 1 shows (A) PEC response in Tris-HCl containing different target concentrations (from 0.1 fM to 1.0 nM), (B) linear correlation curve for ARGs analysis, inset: corresponding calibration curve for the ARGs sensor, (C) stability of the PEC sensor in the presence of 25 pM target and 20 cycles of continuous on-off light, and (D) selectivity of the prepared sensor for different target detection. The PEC response gradually increased with increasing CTX-M-15 concentration. A good linear relationship between the current and the logarithm of the target CTX-M-15 concentration was observed in the range of 0.1 fM to 1.0 nM. I (μA) = 1.020logC was obtained. Target +8.145 (R 2 =0.9916), C Target The unit is nm; when the signal-to-noise ratio is 3 (S / N=3), the detection limit drops to 3.24 aM.

[0097] Figure 7 The reliability of the ASED sensing planar model was demonstrated, and the stability of the PEC biosensing platform was investigated. Negligible changes in photocurrent were observed over 400 seconds, demonstrating the excellent stability of this design strategy. Furthermore, to investigate the specificity of the proposed biosensor, the PEC responses of the biosensor to CTX-M-15 were compared with those of other ARGs, including tetA, tetC, tetG, tetD, single-base mismatches (1-mut), double-base mismatches (2-mut), triple-base mismatches (3-mut), and mixtures of these sequences, under the same experimental conditions. The concentration of the other ARGs was 10 times higher (100 nM) than that of CTX-M-15 (10 pM). The PEC responses of the other ARGs (except CTX-M-15) showed slight changes compared to the blank (background signal without the ARG). However, in the presence of the target, the PEC response increased significantly, demonstrating the good specificity of the biosensor for the target, CTX-M-15. The PEC response values ​​of 1-mut, 2-mut, and 3-mut were nearly 0.75-, 0.70-, and 0.41-fold lower than those of CTX-M-15, respectively, indicating that the developed biosensor was able to distinguish single-base, double-base, and triple-base mismatch sequences from the target sequence.

[0098] Figure 8This is a possible electron transfer mechanism for the ASED strategy. Under visible light illumination, electron-hole pairs are generated at the BZ heterojunction. The conduction band (CB) of ZnIn2S4 is more negative than that of Bi2S3, which facilitates the transfer of photogenerated electrons from the CB of ZnIn2S4 to the CB of Bi2S3, and photogenerated holes from the VB of ZnIn2S4 to the VB of Bi2S3. Specifically, the electron donor DA interacts with the accumulated holes on ZnIn2S4, increasing the rate of hole depletion and thus enhancing the photocurrent response. Example 2

[0099] The present invention provides an application of an antibiotic resistance gene photoelectric detection sensor for detecting resistance genes, specifically:

[0100] The sensor prepared in the above embodiment was used to detect the sample to be detected. Based on the obtained electrical signal, the linear relationship was used to achieve quantitative detection of CTX-M-15. The detection results are shown in Table 1. Table 1. Detection results of the resistance genes in different water samples using the method of the present invention

[0101]

[0102] This paper reports for the first time an aptamer-induced spatially confined electron donor strategy for enhanced PEC signal biosensing. First, the present invention successfully synthesized a porous layered heterojunction functional material, Bi2S3 / ZnIn2S4 (BZ), with enhanced interfacial charge transfer capability. The BZ heterojunction, as a conductive layer, possesses a large number of active sites, providing excellent electronic conductivity, superior electron absorption and transport properties, and a broadened light absorption range. Through material design and the introduction of the ASED strategy, it was demonstrated that this method can effectively enhance the photoelectric signal by approximately 22 times. Furthermore, to expand the universality of the ASED strategy, a catalytic hairpin assembly (CHA) and DNAzyme were combined and successfully applied to the detection of antibiotic resistance genes (ARGs). BZ as a PEC material combined with the ASED strategy achieved ultrasensitive detection of ARGs.

[0103] The present invention integrates aptamer-immobilized electron donors, catalytic hybrid self-assembly, and DNAzyme cleavage reactions, not only demonstrating that aptamer-immobilized electron donors can effectively enhance photoelectric signals, but also, compared with other detection technologies, the anchored donor strategy can overcome the shortcomings of traditional PEC detection, reduce detection background, shorten the distance between the sacrificial agent and the semiconductor, amplify the photocurrent signal, and improve the stability of the PEC system.

[0104] The above embodiments are described to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A method for preparing an antibiotic resistance gene photoelectric detection sensor, characterized in that: The preparation method comprises the following steps: 1) After Bi2S3 / ZnIn2S4 material is aminated, it is dispersed in water to prepare a solution, which is then added dropwise to an ITO electrode to prepare a BZ / ITO electrode; 2) Place the hairpin DNA H P The H was activated by placing it in a mixed solution containing N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide. Subsequently, the obtained solution was dropped onto the BZ / ITO electrode and incubated to obtain H P / BZ / ITO electrode; 3) Add a series of different concentrations of antibiotic resistance genes to the mixture of DNA H1, DNA H2 and DNA H3, and react; then, drop the resulting mixture onto H P / BZ / ITO electrode, reaction; 4) React the electrode prepared in step 3) with the buffer solution containing 0.1 mL of 20 mM dopamine DA and the Split-2 solution to obtain DA / Apt DA / BZ / ITO electrode; 5) Under xenon lamp irradiation, DA / Apt DA The / BZ / ITO electrode was used for photoelectrochemical detection in Tris-HCl solution to establish a linear relationship between the electrode's PEC signal intensity and the concentration of antibiotic resistance genes, thereby achieving quantitative detection of antibiotic resistance genes. In step 2), the hairpin DNA H P The gene sequence is shown in SEQ ID NO. 1; In step 3), the gene sequence of the DNA H1 is shown as SEQ ID NO. 2; the gene sequence of the DNA H2 is shown as SEQ ID NO. 3; the gene sequence of the DNA H3 is shown as SEQ ID NO. 4; and the antibiotic resistance gene is CTX-M-15; The gene sequence of Split-1 is shown in SEQ ID NO.5; the gene sequence of Split-2 is shown in SEQ ID NO.6; The hairpin DNA H P , DNA H1, DNA H2, DNA H3, Split-1 and Split-2 were all diluted in annealing buffer before use; the composition of the annealing buffer was 150 mM NaCl, 10 mM Tris, 10 mM MgCl2·6H2O, pH=7.

4.

2. The preparation method according to claim 1, characterized in that The preparation method of the Bi2S3 / ZnIn2S4 material in step 1) is: 1-1) Mix 1,3,5-benzenetricarboxylic acid H3BTC and Bi(NO3)3·5H2O, add methanol, heat to react, separate, wash, and dry to obtain Bi-MOFs; 1-2) Disperse Bi-MOFs in a mixed solvent of water and glycerol, stir and mix, adjust the pH to 2.5, then add InCl3⋅4H2O, ZnCl2, and thioacetamide in sequence. After heating for reaction, separate, wash, and dry to obtain Bi2S3 / ZnIn2S4 material.

3. The preparation method according to claim 1, characterized in that The Bi2S3 / ZnIn2S4 material is subjected to amination: The Bi2S3 / ZnIn2S4 material was dispersed in N,N-dimethylformamide (DMF), (3-aminopropyl)triethoxysilane (APTES) was added, and the mixture was heated to reflux. The product was collected and dried to obtain a surface-functionalized Bi2S3 / ZnIn2S4 material with amino groups.

4. The preparation method according to claim 1, characterized in that The linear relationship described in step 4) is Y = 1.020 X + 8.145, R 2 = 0.9916; Y is the photocurrent, in μA, and X is the logarithm of the target concentration.

5. An antibiotic resistance gene photoelectric detection sensor, prepared by the preparation method according to any one of claims 1 to 4.

6. An application of an antibiotic resistance gene photoelectric detection sensor for detecting the resistance gene CTX-M-15 to achieve quantitative detection. The detection method comprises: using the sensor according to claim 5 to detect a sample to be detected, and based on the obtained electrical signal, using a linear relationship to achieve quantitative detection of CTX-M-15.

Citation Information

Patent Citations

  • Method for photoelectrochemically detecting organophosphorus pesticide based on bismuth oxybromide / bismuth sulfide semiconductor heterojunction generated by biological induction

    CN112098492A

  • Chloramphenicol photoelectrochemical aptamer sensor, preparation method and application thereof

    CN112683971A