Proteins that reduce corn plant height and leaf angle

Abstract

The application discloses a protein ipa1 with an amino acid sequence as shown in SEQ ID NO:1, which can be expressed in corn to significantly reduce the corn plant height and leaf angle, but does not affect the development of ears and kernels, the hundred-grain weight and ear-grain weight and other agronomic characters, and has important significance for creating short-stalk and compact plant type corn germplasm resources and new variety breeding.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of agricultural biotechnology, and particularly relates to a protein ipa1 with an amino acid sequence as shown in SEQ ID NO: 1 and its application in reducing plant height and leaf angle and creating compact crop germplasm resources. BACKGROUND

[0002] Corn is an important food, feed and industrial raw material. Since 2012, the total yield and planting area of corn has become the largest crop in China. In 2024, China's corn production reached 290 million tons, and due to the increasing demand for corn, more than 20 million tons still need to be imported annually. China's per capita arable land area is only 1 / 3 of the world average, and it is difficult to increase the planting area of corn. Therefore, it is still necessary to increase the yield per unit area of corn to support the stable supply of corn in China. Studies have shown that the increase in yield per unit area is more due to the continuous increase in density tolerance and planting density, and the increase in yield per plant and heterosis of hybrid corn is not obvious for the increase in yield per unit area [1]. In the past few decades, the yield per plant of corn in the United States has not increased significantly, but the yield per mu has increased by more than 7 times, mainly due to the breeding and promotion of dense planting varieties [2]; at present, the planting density of corn in China is also gradually increasing. Improving the density tolerance and planting density of varieties has become an important goal and trend of modern corn breeding.

[0003] Reducing the height and leaf angle of corn is the key to improving the density tolerance of corn. Excessive height of corn plants will increase the probability of lodging and folding, reduce corn yield by 33.8%-62.2% or even lead to absolute yield, and seriously affect mechanized harvesting, increase harvesting cost and time; and it is also not conducive to ventilation and light transmission within the population, and will cause the population to absorb more red light from the environment, and the far-red light will be refracted and radiated to the middle and lower layers of the plant, thereby reducing the ratio of red light / far-red light in the population. This will lead to the shade avoidance response of the plant, resulting in excessive growth of the plant, thinning of the stem, reduction of the vascular bundle, change in the composition and content of cell wall lignocellulose, and reduction of the mechanical strength of the stem, thereby aggravating the occurrence of lodging [3]. Moderate dwarfing and smaller leaf angle can reduce the mutual shading between corn plants, improve the overall canopy structure in the field, and enhance the ventilation and light transmission between plants, which is conducive to photosynthesis, and also greatly increases the ratio of red light / far-red light in the lower layer of the plant, reduces the density planting shade avoidance response, thereby improving the population yield of corn. Dwarf compact plant type is crucial to corn density breeding. Transformation of flat and spread corn varieties into compact types can significantly improve the density tolerance and increase yield by 16.9%, and vice versa, transformation of compact corn varieties into flat and spread types can reduce yield by 13.79% under dense planting conditions [4].

[0004] Maize plant height and leaf angle are complex quantitative traits regulated by multiple genes. Although some key genes for plant height and leaf angle have been cloned, most of these genes have mutants that often carry some adverse effects, such as changes in the development of floral organs, excessive reduction in plant height, smaller ears, and smaller kernels, which are not conducive to the formation of maize yield and are difficult to apply in maize breeding practice [5]. Br2 (Brachytic2) is the most studied and utilized gene in maize dwarf breeding and is also the first cloned maize dwarf gene. This gene encodes a auxin transporter protein, P-glycoprotein. Individual mutations of br2 lead to shortening of internodes in maize plants, especially the shortening of internodes below the ears, resulting in a reduction of plant height by about 50%. The significant increase in stem diameter and circumference greatly enhances stem strength. The plant type is sparse at the top and dense at the bottom, which helps ventilation and light penetration. The well-developed root system makes the plant highly tolerant to water and fertilizer. It is a recognized gene for improving plant height with considerable commercial value [6]. Researchers used the "high-low hybridization and selection of dwarf plants" breeding method to improve the unfavorable traits of br2 such as overlapping leaves and low seed setting rate, and bred the dwarf maize hybrid Aidan 268. This variety has an average yield of 636 kg per mu at a planting density of 4500 plants / mu, and the yield in the high-yield demonstration field can reach 903 kg per mu [7]. By selectively editing the fifth exon of Br2, seven alleles with continuous rod-lowering effects were created, among which two alleles, M1 and M2, do not affect the yield [8]. These excellent allelic variations will help in the breeding of dwarf maize varieties, but the plant height is still some distance from the dwarf standard, and it is still necessary to increase the identification of favorable alleles for dwarf maize, the development of molecular markers for dwarf, and the creation of dwarf germplasm resources. Summary of the Invention

[0005] In our research on breeding high-density maize varieties, we performed EMS mutagenesis on the fka1 (fln1m reported in the patent document with publication number CN116769817B) of the B73 background, obtaining a semi-dwarf mutant. This mutant exhibited a 20%-29% decrease in plant height and a significantly lower ear position, but this did not affect ear and kernel development; the 100-kernel weight and ear weight remained unchanged. Furthermore, the leaf angle of the upper ear leaves was significantly reduced, resulting in a compact plant type. However, other agronomic traits such as flowering time and tassel size did not show significant changes. These phenotypes are very close to the ideal plant type, and we named this mutant ipa1 (ideal plant architecture). BSA sequencing and genotype linkage analysis revealed that this mutant was caused by a non-synonymous mutation in the second exon of the Brachytic2 (Br2) gene, resulting in a change of one amino acid. Simultaneously, a molecular marker for this superior variant was developed. Introducing this marker into the B73 background resulted in stable semi-dwarf, compact plant type phenotypes with small leaf angles, without affecting yield traits or other agronomic traits. Based on these research findings, this invention includes the following technical solutions.

[0006] The first aspect of the present invention provides a polypeptide selected from the group consisting of:

[0007] (a) The polypeptide with the amino acid sequence shown in SEQ ID NO:1 is a mutant of auxin transporter protein P-glycoprotein, namely auxin transporter protein ZmABCB15, named ipa1 (ideal plant architecture 1).

[0008] (b) A conserved variant polypeptide derived from (a) having the polypeptide function of (a) formed by substituting, deleting or adding one or more amino acid residues of the amino acid sequence SEQ ID NO:1.

[0009] (c) A conserved variant polypeptide derived from (a) having 95% or more homology with the polypeptide sequence defined in (a), preferably 96% or more homology, preferably 97% or more homology, preferably 98% or more homology, more preferably 99% or more homology, and having the function of the polypeptide in (a); or

[0010] (d) A derivative polypeptide containing the polypeptide sequence described in (a), (b), or (c).

[0011] The aforementioned function refers to the ability of maize to reduce plant height and leaf angle.

[0012] A second aspect of the present invention provides a polynucleotide selected from the group consisting of:

[0013] (A) A polynucleotide encoding the polypeptide described above;

[0014] (B) A polynucleotide encoding a polypeptide with the amino acid sequence shown in SEQ ID NO:1;

[0015] (C) The polynucleotide sequence shown in SEQ ID NO:2 is the gene encoding the polypeptide ipa1;

[0016] (D) A polynucleotide whose nucleotide sequence is ≥95%, preferably ≥96%, preferably ≥97%, preferably ≥98%, more preferably ≥99% homology with the nucleotide sequence shown in SEQ ID NO:2;

[0017] (E) A nucleotide sequence complementary to any of the nucleotide sequences described in (A)-(D).

[0018] A third aspect of the invention provides a DNA molecule comprising, as described above, a polynucleotide, such as an expression cassette / expression box for the polypeptide ipa1.

[0019] In one embodiment, the DNA molecule comprises a polypeptide ipal-encoding gene ipal and a promoter upstream thereof, such as a Cauliflower Mosaic Virus (CAMV) 35S promoter, a Ubiquitin promoter of maize, i.e., a Ubi promoter, which is an expression cassette / expression frame of the polypeptide ipal-encoding gene ipal.

[0020] A fourth aspect of the present application provides a recombinant plasmid, characterized in that it comprises the DNA molecule of claim 3 or 4, which is formed by cloning the DNA molecule as described above in a plasmid vector suitable for expression in Agrobacterium, selected from binary Agrobacterium vectors and vectors useful for plant microprojectile bombardment, such as pHB-YFP, pHB-FLAG, pBin19, pUN1301, the fluorescent reporter vector pGreenll0800-LUC, pCAMBIA3300, pCAMBIA1301, pCAMBIA2301, pBI121, or pTF102, and the like plant transgene vectors or modified vectors.

[0021] A fifth aspect of the present application provides a microbial engineering bacterium, which is a transformant comprising the recombinant plasmid as described above, for mediating the transfer of the recombinant plasmid as described above into a plant, such as a corn, rice, or wheat plant, preferably the microbial engineering bacterium is Agrobacterium, such as Agrobacterium tumefaciens, Agrobacterium EHA105, Agrobacterium GV3101. For example, the recombinant plasmid as described above is transferred into an Agrobacterium strain using a freeze-thaw method to form the microbial engineering bacterium.

[0022] Preferably, the microbial host of the microbial engineering bacterium as described above is Agrobacterium, such as Agrobacterium tumefaciens, Agrobacterium EHA105, Agrobacterium GV3101.

[0023] A sixth aspect of the present application provides the use of the polypeptide, polynucleotide, DNA molecule, recombinant plasmid, or microbial engineering bacterium as described above in reducing the plant height and leaf angle of a plant, such as a monocotyledonous crop plant, improving the agronomic traits of a monocotyledonous crop plant, or breeding a new dwarf compact plant variety.

[0024] The plant as described above can be a monocotyledonous crop plant, selected from the group consisting of wheat, rice, corn, soybean, barley, oat, millet, rye, and sorghum.

[0025] In one specific application embodiment, the polypeptide as described above, such as polypeptide ipal, is overexpressed in a plant, such as a monocotyledonous crop plant, by the following method to reduce the plant height and leaf angle of the plant, such as a monocotyledonous crop plant, improve the agronomic traits of the monocotyledonous crop plant, or breed a new dwarf compact plant variety:

[0026] A. cloning a polynucleotide, for example, a gene encoding polypeptide ipa1, as described above, on a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, i.e., an ipa1 overexpression vector, transforming a plant by Agrobacterium-mediated method to obtain a transgenic plant overexpressing a polypeptide, for example, polypeptide ipa1, as described above; and / or

[0027] B. cloning a polynucleotide, for example, a gene encoding polypeptide ipa1, as described above, on a plant chromosome by gene editing technology to obtain a transgenic plant overexpressing a polypeptide, for example, polypeptide ipa1, as described in claim 1; and / or

[0028] C. replacing a gene with gene number Zm00001d031871 in the corn genome, Brachytic2 (Br2, the nucleotide sequence of which is shown as SEQ ID NO: 4), with a polynucleotide, for example, a gene encoding polypeptide ipa1, as described above, for example, a polynucleotide with a nucleotide sequence shown as SEQ ID NO: 2, by gene editing technology.

[0029] Optionally, the gene editing technology described in steps B and C above can be selected from the group consisting of homologous double exchange, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

[0030] The seventh aspect of the present application provides a method for identifying a transgenic corn overexpressing polypeptide ipa1 obtained in step C of claim 10, comprising the following steps:

[0031] extracting corn genomic DNA, and performing PCR amplification reaction using the following primer pairs,

[0032] forward primer ipa1-F: GGCACCTACTTCACCGTCTT (SEQ ID NO: 5),

[0033] reverse primer ipa1-R: AGGAGCAGCAGAAGGAGAGA (SEQ ID NO: 6),

[0034] when the PCR product size is 171 bp and the amplified sequence is SEQ ID NO: 7, it indicates that the corn genome contains a gene ipa1 with a nucleotide sequence of SEQ ID NO: 2,

[0035] GGCACCTACTTCACCGTCTTCTGCTGCTACGGGCTCCTGCTCTGGTACGGCGGCCACCTCGTGCGCGCCCAGCACACCAACGGCGGGCTCGCCATCGCCACCATGTTCTCCGTCATGATCGG A GGACTGTAAGGCCCACCACACCACGCACTCTCTCCTTCTGCTGCTCCT (SEQ ID NO: 7); and / or

[0036] determining whether the protein expressed by the corn cell contains the polypeptide ipal having the amino acid sequence as shown in SEQ ID NO: 1,

[0037] When the detection result shows that the corn genome contains the gene ipal having the nucleotide sequence of SEQ ID NO: 2, or the protein expressed by the corn cell contains the polypeptide ipal having the amino acid sequence as shown in SEQ ID NO: 1, it indicates that the transgenic corn overexpresses the protein ipal, and the corn variety is a candidate for the short-stalk, compact plant type variety.

[0038] An eighth aspect of the present application provides a kit for implementing the identification method as described above, comprising the following PCR primers for amplifying the gene ipal:

[0039] a forward primer ipal-F: GGCACCTACTTCACCGTCTT (SEQ ID NO: 5),

[0040] a reverse primer ipal-R: AGGAGCAGCAGAAGGAGAGA (SEQ ID NO: 6).

[0041] The kit can further comprise a nucleic acid extraction system for extracting total RNA or DNA from corn plant tissues such as leaves or kernels, and / or a reverse transcription system for reverse transcription into cDNA.

[0042] Further, the kit further comprises an instruction manual, which records the operation steps of extracting plant RNA or DNA, the steps of detecting the gene ipal having the nucleotide sequence as shown in SEQ ID NO: 2, and the identification criteria.

[0043] For example, the instruction manual can be written on bottles, test tubes and the like, plates, or on a separate piece of paper, or on the outside or inside of the container, such as a paper with a two-dimensional code of an operation demonstration video APP download window, and the instruction manual can also be in the form of multimedia, such as a CD, a U disk, a network disk, etc.

[0044] In an embodiment, the PCR amplification described above is a PCR MIX method.

[0045] The present application screens a B73 background dwarf, leaf angle small plant compact excellent variation ipa1 by EMS mutagenesis, the variation site is also located in the Brachytic2 (Br2) gene, which again confirms that the Br2 gene is a maize dwarfing sensitive gene, as reported in the literature [6]. The variation is a nonsynonymous mutation in the second exon of the Br2 gene, i.e. a G→A mutation at position 1346 of the gene CDS, resulting in a G449D change of an amino acid residue in the encoded auxin transporter ZmABCB15. The height of the mutant plant is reduced by 20%-29%, the ear position is significantly lowered, but the development of the ear and the grain is not affected, and the hundred-grain weight and the ear grain weight are not changed. The excellent variation ipa1 can be used for the creation of dwarf, compact plant type germplasm resources and the cultivation of new varieties by combining molecular markers and modern breeding techniques, thereby providing important genetic resources for the molecular breeding of dwarf corn. The application prospect is broad. BRIEF DESCRIPTION OF DRAWINGS

[0046] Figure 1 The comparative phenotypes of screening dwarf mutants by EMS mutagenesis in the background of fka1 (which is a hard grain mutant fln1m reported in the patent document with publication number CN116769817B) are shown. Among them, a: the fka1 mutant grain is hard grain type; b: introducing fka1 into the Zhengdan 958 hybrid can change the leaf to hard grain type; c: the semi-dwarf plant is separated from the fka1 mutagenized M1 ear row.

[0047] Figure 2 The field phenotypes of the dwarf mutant ipa1 in the background of fka1 in the Shanghai Songjiang Test Base of the Excellent Innovation Center of Molecular Plant Science of the Chinese Academy of Sciences are shown. Among them, a: plant photos of wild type and mutant; b: stem photos of wild type and mutant; c: stem photos below the ear of wild type and mutant; d: plant height; e: internode distance shown in figure c; f: fresh weight of aboveground part; g: fresh weight of root; h: leaf angle shown in figure a. t test, **P<0.01.

[0048] Figure 3 The phenotypes of the dwarf mutant ipa1 in the background of fka1 in the Sanya field are shown. Among them, a: the phenotype of plant height in the background of fka1; b-c: determination results of plant height and ear height; d-e: ear and grain phenotypes and hundred-grain fresh weight. *P<0.05, **P<0.01, ***P<0.001.

[0049] Figure 4Figure 1 shows the gene mapping and genotype analysis of the dwarf mutant ipal. Wherein, a: MutMap analysis was performed on the F2 segregants of fkal and ipal, and a significant peak appeared on chromosome 1; b: a G to A mutation occurred on the second exon of the candidate gene Br2, resulting in an amino acid change; c: linkage analysis of the single plants of the F2 population at the site, the genotype of the B73 site was AA, the genotype of the dwarf plants was homozygous aa, and the genotype of the normal plants was AA or Aa, and the variation at the site was completely linked to the plant height phenotype; d: analysis of the expression pattern of the Br2 gene in different tissues of maize using the reported transcriptome data.

[0050] Figure 5 Figure 2 shows the phenotype and genotype analysis comparison of the ipal site introduced into the B73 background. Wherein, a: the phenotype of plant height in the B73 background; b-d: the determination results of the plant height, leaf angle, ear position height of the B73 and ipal type plants separated from the F2 of B73 and ipal; a G to A mutation occurred on the second exon of the candidate gene Br2, resulting in an amino acid change; e: linkage analysis of the single plants of the F2 of B73 and ipal at the mutation site, the plant height phenotype and the ipal site were completely linked. The genotype of the dwarf plants was homozygous aa, and the genotype of the normal plants was AA or Aa; f-g: the ear and kernel phenotype and the fresh weight of 100 kernels of B73 and ipal. *P<0.05, **P<0.01, ***P<0.001. DETAILED DESCRIPTION

[0051] Cultivating new dwarf, semi-dwarf varieties with high density planting can effectively increase the yield of maize. However, most of the dwarf mutants will seriously affect the yield per plant and other important traits, making it difficult to apply in breeding. Therefore, it is particularly important to mine excellent allelic mutations that can cause reasonable dwarf height, small leaf angle, compact plant, while not affecting yield and other agronomic traits, to improve the plant structure and high-density planting of maize and thus increase the yield of maize.

[0052] EMS (Ethylmethanesulfonate) is a commonly used chemical mutagen, which belongs to DNA ethylating agent, can induce a high density of series of allelic point mutations, has the advantages of high efficiency, small negative effect, easy operation, etc., and has been widely used in related genetic research and mutagenic breeding of plants.

[0053] In the development and research of the dense planting of corn varieties, a B73 background mutant is screened by EMS mutagenesis, gene analysis shows that the mutation is a non-synonymous mutation in the second exon of the gene with the gene number Zm00001d031871 (Brachytic2, Br2), which is a G→A mutation at the 1346th base of the CDS (nucleotide sequence changes from SEQ ID NO: 4 to SEQ ID NO: 2), resulting in a G449D change of an amino acid residue in the encoded auxin transporter ZmABCB15 (ABCB transporter family member) (amino acid sequence changes from SEQ ID NO: 3 to SEQ ID NO: 1). The plant height of the mutant decreases by 20%-29%, the ear position decreases significantly, but does not affect the development of ears and grains, and the hundred-grain weight and ear grain weight do not change; moreover, the leaf angle of the ear leaf is significantly smaller, and the plant type is compact; but the flowering period, tassel and other agronomic traits do not change significantly. These phenotypes are close to the ideal plant type, so the mutant is named ipa1 (ideal plant architecture).

[0054] Although the function of the mutant polypeptide ipa1 in reducing the plant height and / or leaf angle of corn is tested in the corn varieties fka1 and B73, etc. in the present application, it can be expected by those skilled in the art that the polypeptide ipa1 can also be applied to other corn varieties, and even can also be applied to other crops in the family Poaceae, such as rice, corn, soybean, millet, barley, oat, rye and sorghum, etc., to cultivate new varieties resistant to dense planting.

[0055] In addition, it can be expected by those skilled in the art that some conservative variant polypeptides of the polypeptide ipa1 also have the same function.

[0056] As used herein, the term "conservatively modified variants" refers to those polypeptides that have substantially the same biological function or activity as the referenced polypeptide. The "conservatively modified variants" can be (i) a polypeptide having one or more conservative or non-conservative amino acid residue substitutions, preferably conservative amino acid residue substitutions, where such substituted amino acid residues can or can not be encoded by the genetic code, or (ii) a polypeptide having a substitution group at one or more amino acid residues, or (iii) a polypeptide formed by fusing the mature polypeptide to another compound, such as a compound that increases the half-life of the polypeptide, e.g., a polyethylene glycol, or (iv) a polypeptide formed by fusion of additional amino acid sequences to the polypeptide, such as leader or secretory sequences or sequences or proteins useful in purification of the polypeptide, or proteinogen sequences. For example, (1) a polypeptide having the amino acid sequence of the polypeptide ipal, formed by substitution, deletion or addition of one or more (e.g., 1-20, preferably 1-10; more preferably 1-5; more preferably 1-3; amino acid residues, and having the function of the polypeptide ipal; (2) a polypeptide having more than 50% (preferably more than 60%; more preferably more than 70%; more preferably more than 80%; more preferably more than 85%; more preferably more than 90%; more preferably more than 95%; more preferably more than 98%; more preferably more than 99%) identity with the sequence of the polypeptide ipal, and having the function of the polypeptide ipal; or (3) a polypeptide formed by adding a tag sequence to the N or C terminus of the polypeptide ipal, or adding a signal peptide sequence to the N terminus thereof. Fragments, derivatives and analogs within the scope of those of ordinary skill in the art are encompassed by the teachings herein. The terms "variant" or "mutation" include, but are not limited to, substitution, deletion, insertion, chemical modification of an amino acid residue, preferably a positive mutation, i.e., a mutation that increases function. The substitutions can be non-conservative substitutions, conservative substitutions, or a combination of non-conservative and conservative substitutions. A "conservative" amino acid substitution or mutation refers to the interchangeability of residues having similar side chains, and thus generally includes the substitution of an amino acid for another amino acid within a defined class. However, as used herein, conservative mutations do not include hydrophilic to hydrophilic, hydrophobic to hydrophobic, hydroxyl-containing to hydroxyl-containing, or small residue to small residue substitutions, if the conservative mutation can alternatively be an aliphatic to aliphatic, non-polar to non-polar, polar to polar, acidic to acidic, basic to basic, aromatic to aromatic, or a restricted residue to restricted residue substitution. Common instances of conservative substitutions are well known in the art and include: interchanges among the aromatic amino acids F, W, Y; interchanges among the hydrophobic amino acids L, I, V; interchanges among the polar amino acids Q, N; interchanges among the basic amino acids K, R, H; interchanges among the acidic amino acids D, E; and interchanges among the hydroxyl amino acids S, T. In addition, A, V, L, or I can be conservatively mutated to another aliphatic residue or another non-polar residue. Exemplary conservative substitutions can be made, for example, according to the following table.

[0057] Original residue Representative substitution Preferred substitution Ala (A) Val; Leu; lie Val Arg (R) Lys; Gin; Asn Lys Asn (N) Gin; His; Lys; Arg Gin Asp (D) Glu Glu Cys (C) Ser Ser Gin (Q) Asn Asn Glu (E) Asp Asp Gly (G) Pro; Ala Ala His (H) Asn; Gin; Lys; Arg Arg lie (I) Leu; Val; Met; Ala; Phe Leu Leu (L) lie; Val; Met; Ala; Phe lie Lys (K) Arg; Gin; Asn Arg Met (M) Leu; Phe; lie Leu Phe (F) Leu; Val; lie; Ala; Tyr Leu Pro (P) Ala Ala Ser (S) Thr Thr Thr (T) Ser Ser Trp (W) Tyr; Phe Tyr Tyr (Y) Trp; Phe; Thr; Ser Phe Val (V) lie; Leu; Met; Phe; Ala Leu

[0058] To express the polypeptide ipal in plants such as maize, the gene encoding it is constructed as a gene expression cassette or expression construct as a DNA molecule, and the expression cassette / construct is operably linked to a plasmid vector by subcloning to obtain a recombinant plasmid, which is then transformed into a host cell to obtain a transformant or genetically engineered bacteria, or is transformed into a plant by Agrobacterium-mediated method to obtain a transgenic plant.

[0059] As used herein, the term “reduced” or “decreased” or “reduction” in (plant) height and / or leaf angle can mean at least 10% reduction compared to a reference level, such as wild-type maize, e.g., B73, for example, at least about 20% reduction, or at least about 30% reduction, or at least about 40% reduction, or at least about 50% reduction, or at least about 60% reduction, or at least about 70% reduction, or at least about 80% reduction, or at least about 90% reduction, or up to and including 100% reduction, or any reduction between 10% and 100%.

[0060] In the description of the technical solutions of the present application, the term “and / or” used in terms such as “A and / or B”, “A and / or B” is intended to include both A and B; A or B; A (alone); and B (alone). Likewise, the term “and / or” as used in phrases such as “A, B, and / or C” is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0061] In this document, for the sake of convenience, a certain protein such as polypeptide ipal is sometimes used interchangeably with its encoding gene (DNA) name ipal, and those skilled in the art should understand that they represent different types of substances in different descriptions. Those skilled in the art can easily understand their meanings according to the context and the context. For example, for ipal, when describing the function or category of the protein for reducing plant height and / or leaf angle, it refers to the protein; when described as a gene, it refers to the encoding gene of the protein.

[0062] As used herein, the “expression cassette” or “gene expression cassette” refers to a gene expression system comprising all necessary elements required for expression of the protein of interest ipal, which generally includes the following elements: a promoter, a gene sequence encoding a polypeptide, a terminator; in addition, a signal peptide coding sequence such as mCherry (red fluorescent protein), GFP (green fluorescent protein), or YFP (yellow fluorescent protein) can be optionally included; these elements are operatively linked.

[0063] As used herein, the term "expression construct" or "expression construct" refers to a recombinant DNA molecule that comprises a nucleic acid coding sequence of interest (e.g., SEQ ID NO: 2), which can comprise one or more gene expression cassettes. The "construct" is typically contained in an expression vector (plasmid vector).

[0064] As used herein, the term "exogenous" or "heterologous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or between a protein (or nucleic acid) from a different source and a host cell. For example, a nucleic acid is exogenous to a host cell if the combination of the nucleic acid and the host cell is not one that would normally occur in nature. A particular sequence is "exogenous" to the cell or organism into which it is inserted.

[0065] As used herein, the term "operably linked" or "operatively linked" refers to the functional placement of two or more nucleic acid regions or nucleic acid sequences in a specific location relative to each other. For example, a promoter region is placed in a specific location relative to a nucleic acid sequence of interest SEQ ID NO: 2 such that transcription of the nucleic acid sequence is directed by the promoter region, and thus the promoter region is "operably linked" to the nucleic acid sequence.

[0066] The nucleic acid construct of the present application can be manipulated in a variety of ways to ensure expression of the polypeptide ipal. Manipulation of the nucleic acid construct prior to its insertion into a vector can be desired for a variety of reasons, for example, to direct the expression of the nucleic acid sequence SEQ ID NO: 2 in a host. The techniques used to manipulate polynucleotide sequences utilizing recombinant DNA methods are known in the art.

[0067] In certain embodiments, the nucleic acid construct is a vector. The vector can be a cloning vector, an expression vector, or a gene knock-in vector. The nucleic acid sequence SEQ ID NO: 2 of the present application can be cloned into a number of types of vectors, for example, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Cloning vectors can be used to provide the coding sequence of the protein or polypeptide of the present application. Expression vectors can be provided to cells in the form of bacterial vectors or viral vectors. Expression of the ipal gene is typically achieved by operably linking the nucleic acid sequence SEQ ID NO: 2 of the present application to a promoter and incorporating the construct into an expression vector. The vector can be suitable for replication and integration into eukaryotic cells. Typical expression vectors contain expression control sequences that are useful in regulating the expression of the desired nucleic acid sequence.

[0068] A gene knock-in vector can be used to integrate the polynucleotide sequence of SEQ ID NO: 2 described herein into the region of interest of the host genome. Typically, the gene knock-in vector contains the 5' homology arm and the 3' homology arm required for genomic homologous recombination in addition to the polynucleotide sequence. In some embodiments, the nucleic acid construct herein contains the 5' homology arm, the polynucleotide sequence described herein, and the 3' homology arm. In using the gene knock-in vector, the polynucleotide sequence can be homologously recombined into the site of interest using the CRISPR / Cas9 technology. The CRISPR / Cas9 technology uses a guide RNA designed to target the gene of interest to direct the Cas9 nuclease to modify the genome at the insertion site, resulting in an increased homologous recombination efficiency at the region of the gene modification, and homologously recombining the fragment of interest of SEQ ID NO: 2 contained in the gene knock-in vector into the site of interest. The steps of the CRISPR / Cas9 technology and the reagents used, such as the Cas9 nuclease, are well known in the art.

[0069] Methods well known to those skilled in the art can be used to construct the nucleic acid constructs. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, and the like. The DNA sequences described can be operably linked to appropriate promoters in expression vectors to direct mRNA synthesis. Representative examples of such promoters are the lac or trp promoter of E. coli, the PL promoter of bacteriophage lambda, eukaryotic promoters including the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the LTRs of retroviruses, and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vectors also include ribosome binding sites for translation initiation and transcription terminators. Additionally, the expression vectors preferably contain one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance in eukaryotic cells and green fluorescent protein (GFP), or tetracycline, ampicillin resistance or chloramphenicol in E. coli, Agrobacterium, and the like.

[0070] The polynucleotides of the present application, when expressed in higher eukaryotic cells, will be transcribed more efficiently if an enhancer sequence is inserted in the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs in length, which act on a promoter to increase its transcription. Examples include the 100- to 270-base pair SV40 enhancer on the late side of the replication origin, the polyoma enhancer on the late side of the replication origin, and enhancers from adenovirus.

[0071] Vectors containing the appropriate DNA sequences, as well as appropriate promoters or control sequences, can be used to transform appropriate host cells to enable them to express the proteins.

[0072] When the polypeptide ipa1 is applied to the improvement of agronomic traits of Gramineae crops or the creation of new crop varieties with dwarf, compact plant type, it is preferred to be introduced into the plant by traditional Agrobacterium-mediated method, for which a recombinant Agrobacterium engineering strain expressing ipa1 needs to be constructed.

[0073] The terms "recombinant bacteria (strain)" and "(genetically) engineered bacteria (strain)" herein have the same meaning, both referring to a strain of wild-type Agrobacterium, such as Agrobacterium tumefaciens, which has been genetically modified to contain an ipa1 overexpression vector.

[0074] In the construction of transgenic plants using traditional Agrobacterium-mediated method, the construction method of transgenic plants includes:

[0075] 1) providing Agrobacterium carrying an expression vector containing the coding sequence of the polypeptide ipa1;

[0076] 2) contacting plant cells or tissues or organs with the Agrobacterium in step 1) to introduce the coding sequence into the plant cells and integrate it into the chromosomes of the plant cells;

[0077] 3) selecting plant cells or tissues into which the coding sequence has been introduced; and

[0078] 4) regenerating the plant from the plant cells or tissues in step 3).

[0079] Whether the construction of transgenic plants is successful can be identified by conventional PCR amplification method. That is, after amplification by conventional tissue DNA extraction, using conventional PCR mix reagent, reaction system and PCR amplification program, and then using forward primer ipa1-F and reverse primer ipa1-R for PCR product sequencing. Among them

[0080] The forward primer is ipa1-F: 5'-GGCACCTACTTCACCGTCTT-3'(SEQ ID NO: 5),

[0081] The reverse primer is ipa1-R: 5'-AGGAGCAGCAGAAGGAGAGA-3'(SEQ ID NO: 6).

[0082] The sequence of the PCR product of the positive transgenic plant, i.e. the ipa1 mutant, is:

[0083] GGCACCTACTTCACCGTCTTCTGCTGCTACGGGCTCCTGCTCTGGTACGGCGGCCACCTCGTGCGCGCCCAGCACACCAACGGCGGGCTCGCCATCGCCACCATGTTCTCCGTCATGATCGG AGGACTGTAAGGCCCACCACACCACGCACTCTCTCCTTCTGCTGCTCCT (SEQ ID NO: 7);

[0084] The normal PCR product sequence in wild plants such as maize B73 is:

[0085] GGCACCTACTTCACCGTCTTCTGCTGCTACGGGCTCCTGCTCTGGTACGGCGGCCACCTCGTGCGCGCCCAGCACACCAACGGCGGGCTCGCCATCGCCACCATGTTCTCCGTCATGATCGG C GGACTGTAAGGCCCACCACACCACGCACTCTCTCCTTCTGCTGCTCCT (SEQ ID NO: 8).

[0086] The PCR product shown in sequence SEQ ID NO: 7 can be used as a molecular marker of the excellent variation ipa1, and the plant compactification and leaf angle reduction improvement of crops is relatively simple, fast, and efficient: the backcrossing and introduction method can be used for tracking detection by using the detection primer, and the technology is relatively conventional; the molecular marker selection can reduce the population size, shorten the improvement period, and greatly save the cost, thereby improving the breeding efficiency.

[0087] The combination of the above-mentioned molecular marker and modern breeding technology can save and accelerate the breeding of dwarf corn. The ipa1 variation site is recessive, and the male parent and the female parent need to be improved at the same time. The ipa1 donor material and the backbone inbred line are used for crossing and backcrossing, the variation site is selected by using the molecular marker, the haploid is doubled after 2-3 generations of backcrossing, the pure line with site homozygosity is obtained, and then screening, large-scale assembly, and field testing are carried out, and excellent combinations are screened for variety approval or production promotion, which greatly shortens the time of dwarf breeding.

[0088] The application will be further described in detail in combination with specific examples. It should be understood that the following examples are only used to illustrate the application but not to limit the scope of the application.

[0089] Examples

[0090] The addition amount, content, and concentration of various substances involved in the examples are described herein, and the percentage content refers to the mass percentage content unless otherwise specified.

[0091] In the examples herein, if no specific description is made for the reaction temperature or operating temperature, the temperature generally refers to room temperature (15-30°C).

[0092] The molecular biology experiments in this embodiment, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. For example, the methods for competent cell transformation and competent cell preparation were both performed according to Chapter 1, page 96 of *Molecular Cloning: A Laboratory Manual* (3rd Edition). Specific experimental conditions could be determined through simple experiments if necessary.

[0093] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0094] EMS mutagenesis, self-pollination, and hybridization of maize are carried out according to conventional breeding methods.

[0095] BSA sequencing analysis was performed by Pasenuo Biotechnology Co., Ltd.

[0096] The primer synthesis and gene sequencing in the examples were all completed by Shanghai Boshan Biotechnology Co., Ltd.

[0097] Molecular biology methods, including the construction of IPA1 overexpression recombinant plasmids and the construction of Agrobacterium-mediated transformation, and transgenic plant construction methods are carried out using techniques commonly used in this field.

[0098] Example 1: Screening for dwarfing mutants by EMS mutagenesis

[0099] EMS mutagenesis of the fka1 flinty mutant (i.e., the fln1m flinty mutant reported in the patent document with publication number CN116769817B) revealed that the fka1 gene can improve dent porcupine kernels to a flinty type, while significantly reducing moisture content without affecting yield. Figure 1 (a) and (b) have important breeding value in cultivating hard-kernel maize that is quick to dehydrate and suitable for machine harvesting. EMS mutagenesis was used to self-pollinate contemporary M0 seeds and harvest seeds from single ears to obtain M1 generation seeds (equivalent to F2). In the next season, each ear was planted in a row, with 15 seeds per row. Phenotypic observations from the jointing and flowering stages revealed dwarfing mutants isolated from multiple ear rows. Most plants were severely dwarfed and exhibited undesirable traits such as yellowing leaves, weak plants, small ears, small kernels, and delayed growth. Additionally, a semi-dwarfing mutant was isolated from one ear row, exhibiting a compact plant type, normal flowering, and no significant changes in tassel, ear, or kernel development. Figure 1 (c) It has significant application potential in the breeding of dwarf maize.

[0100] Example 2: Phenotypic analysis of superior dwarfing variant IPA1

[0101] The selected dwarfing mutants were crossed with fka1 and then self-crossed to obtain F2. These F2 mutants were then planted in a greenhouse at the Shanghai Songjiang Experimental Base of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, from which dwarfed and normal-height materials were isolated. Agronomic traits were investigated during the flowering period. The results showed that the average plant height of the dwarfing mutant decreased from 224 cm to 160 cm, a reduction of 28.7%. Figure 2 (a, d); The significantly shorter length of the internode below the ear leads to a significantly lower ear position ( Figure 2 (b, c, e); the biomass of both the aboveground and underground parts also decreased significantly. Figure 2 In the middle (f, g), the leaf angles of the lower, middle, and upper leaves decreased significantly, by 10 degrees (°), 6 degrees, and 4 degrees respectively, thus exhibiting a compact plant type. Figure 2 (h). Furthermore, phenotypic analysis was conducted again in the field at the Sanya Experimental Base of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences. The results showed that plant height decreased from 190 cm to 134 cm, a reduction of 29.5%. Figure 3 (a, b) The ear position was significantly reduced ( Figure 3 (c) The plants are compact, the ears and grains are developing normally, and the fresh weight of 100 grains has not changed significantly. Figure 3 (d) and (e) are in the fka1 background, and the kernels are hard. Other agronomic traits such as flowering time and tassel development are not significantly altered. This mutant results in a dwarf, compact plant phenotype but does not affect yield or other agronomic traits, closely matching the ideal plant type. Therefore, this mutant is named ipa1.

[0102] Example 3: Gene cloning and linkage analysis of ipa1

[0103] The F2 populations of the ipa1 dwarf mutant and fka1 were planted in the field. Each plant was tagged, and leaves were collected and frozen. Plant height was measured at flowering time, showing clear segregation. Sequencing data from 50 mutant individuals were pooled and analyzed using the MutMap method, along with the sequencing data from fka1. The results showed a distinct peak only on chromosome 1, with the candidate gene being Zm00001d031871 (Brachytic2, Br2). This mutation occurred at the 1346th base (second exon) of the CDS gene, where a G to A mutation resulted in a G (glycine) to D (aspartic acid) mutation at amino acid 449. Figure 4 (a, b). Molecular markers for this variant were developed, and linkage analysis was performed on the genes of 64 dwarf individuals and 56 individuals with normal plant height isolated from F2. The results showed that all dwarf individuals had a homozygous mutation at this locus; 36 individuals with normal plant height were heterozygous and 20 were wild-type. Figure 4(c) Br2 is the most widely used gene in dwarf maize breeding, and a series of dwarfing mutants have also been isolated. Meanwhile, studies on the expression pattern of this gene in published maize transcriptome data revealed that ipa1 is mainly highly expressed in leaves, silks, and cob, but its expression in kernels is relatively low. Figure 4 (Zhong d, Yi et al. 2019). This indicates that the variation at this locus is completely linked to the dwarfing phenotype.

[0104] The steps for genomic DNA extraction are as follows:

[0105] (1) Take corn leaves and put them in a 2mL tube, add steel balls, treat with liquid nitrogen and then grind (60Hz, 60s);

[0106] (2) After grinding, add 0.6 mL of CTAB extraction buffer, mix well, and place in a 65℃ oven for 60 min, mixing every 10-15 min during the process;

[0107] (3) Remove the tube and place it at room temperature for 5-10 minutes. Add an equal volume of chloroform:isoamyl alcohol (24:1) to the centrifuge tube, seal it, and shake for 5 minutes.

[0108] (4) Centrifuge at 13,000 rpm for 15 min at room temperature, and transfer the supernatant to a new 1.5 mL centrifuge tube; add an equal volume of isopropanol, mix by inverting back and forth, and place at -20 degrees for 20 min; centrifuge at 12,000 rpm for 1 min at room temperature, and discard the supernatant.

[0109] (5) Wash the DNA precipitate with 1 mL of 75% ethanol 1 to 2 times, centrifuge at 12000 rpm for 1 min each time, pour out the ethanol, and air dry the DNA precipitate at room temperature.

[0110] (6) Add 0.3 mL ddH2O to dissolve the DNA precipitate.

[0111] PCR identification method:

[0112] (1) PCR reaction was performed using materials from Shanghai Yisheng Biotechnology Co., Ltd. PCR Master Mix reagent was used;

[0113] (2) Prepare a 20 μL reaction system: PCR Master Mix 10 μL, primers 1 μL each, DNA 2 μL, ddH2O 6 μL;

[0114] (3) PCR conditions were: pre-denaturation at 95℃ for 5 min, amplification at 95℃ for 30 s, Tma for 30 s, 72℃ for 1 min, 35 cycles, termination at 72℃ for 10 min, and 16℃ for 1 min.

[0115] Sequencing and identification of PCR products:

[0116] The PCR products were sequenced and validated at a sequencing company. SnapGene software was used to compare and analyze the sequenced sequences with the target sequence of the vector. The target sequence was 334 bp.

[0117] Example 4: Introducing IPA1 into the B73 background can also produce a dwarfing and compact plant phenotype.

[0118] IPA1 and B73 were crossed and then self-crossed. The F2 generation plants were identified using molecular markers fka1 and IPA1 to obtain ears homozygous for the IPA1 locus. Phenotypic analysis showed that plant height decreased from 183 cm to 150 cm, a reduction of 20%. Figure 5 (a, b); the angle between the upper leaves on the spike decreased from 29 degrees to 24.9 degrees, and the plants became more compact. Figure 5 (c) The ear position was significantly reduced ( Figure 5 (d); Simultaneously, the plant height phenotype and the ipa1 genotype are completely linked; the genotype of dwarf plants is aa, and the genotype of normal plant height is AA or Aa. Figure 5 (e); The ears and kernels are developing normally, and the fresh weight of 100 kernels has not changed significantly. Figure 5 The grains (f and g) are the same dent type as B73. Other agronomic traits such as flowering period and tassel development were not significantly altered.

[0119] The above experimental results show that the ipa1 mutant is an excellent variant with dwarfing and compact plant structure. It does not affect maize yield or other agronomic traits and is very close to the requirements of ideal plant type. It has important application potential in dwarfing breeding and dense planting.

[0120] The embodiments described above are merely preferred embodiments for fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention.

[0121] It should be noted that the listing and discussion of previously disclosed documents in this specification should not be construed as an admission that such documents are prior art or common general knowledge.

[0122] Main References

[0123] [1]Troyer AF,Wellin EJ.Heterosis decreasing in hybrids:yield testinbreds[J].Crop Sci,2009,49(6):1969-1976.

[0124] [2]Mansfield BD, Mumm RH. Survey of plant density tolerance in U.S. maize germplasm[J]. Crop Sci, 2014, 54(1):

[0125] [3]Wang BB, Wang HY. Ideal plant architecture shaping for maize density tolerance improvement[J]. Biotechnol Bull, 2023, 39(8): 1

[0126] [4]Li DH, Zhang YH, Zhai YJ, et al. The role of maize plant type in high-yield breeding I. The yield-increasing effect of plant type[J]. Shandong Agricultural Sciences, 1992, 24(3): 4-8.

[0127] [5]Wang TY, Wang R, Wang XQ, et al. Maize dwarf gene and dwarf breeding research[J]. Biotechnol Bull, 2023, 39(8): 43-51.

[0128] [6]Multani DS, Briggs SP, Chamberlin MA, et al. Loss of an MDR transporter in compact stalks of maize Br2 and sorghum dw3 mutants[J]. Science, 2003, 302(5642): 81-84

[0129] [7]Cui SP. Breeding of maize br-2 dwarf hybrid variety aishan268[J]. China Seed Industry, 2014(12): 68-69

[0130] [8]Zhao B, Xia Z, Sun C, et al. CRISPR / Cas9-mediated genomic editing of Brachytic2 creates semi-dwarf mutant alleles for tailored maize breeding[J]. Plant Biotechnol J, 2025, 101-3.

Claims

1. A polypeptide with an amino acid sequence as shown in SEQ ID NO: 1, named ipa1. 2.A polynucleotide with a nucleotide sequence as shown in SEQ ID NO: 2, which is a coding gene ipa1 of the polypeptide ipa1.

3. A DNA molecule, characterized in that, A polynucleotide as claimed in claim 2 and a promoter upstream thereof.

4. A recombinant plasmid, characterized by comprising the nucleotide sequence of SEQ ID NO:

1. A DNA molecule as claimed in claim 3.

5. A microbially engineered bacterium, characterized in that, A transformant comprising the recombinant plasmid as claimed in claim 4.

6. The microorganism engineered bacterium of claim 5, wherein, The microbial host is Agrobacterium. 7.The polypeptide as claimed in claim 1, the polynucleotide as claimed in claim 2, the DNA molecule as claimed in claim 3, the recombinant plasmid as claimed in claim 4, or the microbial engineering bacteria as claimed in claim 6 are used for reducing the plant height and leaf angle of corn, or for cultivating a dwarf compact corn variety.

8. Use according to claim 7, wherein the compound is ###0002### The polypeptide as claimed in claim 1 is overexpressed in corn by the following method to reduce the plant height and / or leaf angle of corn, or to cultivate a dwarf compact corn variety: the gene Brachytic2 with gene number Zm00001d031871 in the corn genome is replaced by the polynucleotide as claimed in claim 2 by gene editing technology.

9. A method for identifying a transgenic maize overexpressing the polypeptide ipal of claim 1 as obtained in claim 8, characterized in that, The method comprises the following steps: Corn genomic DNA is extracted, and a PCR amplification reaction is performed using the following primer pairs, Forward primer ipa1-F: GGCACCTACTTCACCGTCTT (SEQ ID NO: 5), Reverse primer ipa1-R: AGGAGCAGCAGAAGGAGAGA (SEQ ID NO: 6), When the sequence of the PCR amplification product is SEQ ID NO: 7, it indicates that the corn genome contains the gene ipa1 with the nucleotide sequence of SEQ ID NO: 2; and / or It is determined whether the protein expressed by the corn cells contains the polypeptide ipa1 with the amino acid sequence as shown in SEQ ID NO: 1, When the detection result indicates that the corn genome contains the gene ipa1 with the nucleotide sequence of SEQ ID NO: 2, or the protein expressed by the corn cells contains the polypeptide ipa1 with the amino acid sequence as shown in SEQ ID NO: 1, it is suggested that the transgenic corn overexpresses the polypeptide ipa1, and the corn variety is used as a candidate for a dwarf, compact plant type variety.

Images