Strain of talaromyces fungulosus, fungicide, method and application of talaromyces fungulosus

Abstract

The invention belongs to the technical field of biology, and relates to the technical field of microbial degradation of low-rank coal, in particular to talaromyces funicularis, a fungicide, a method and application. The invention provides a talaromyces funiculosuus HG14, and the preservation number of the talaromyces funiculosuus HG14 is CGMCC (China General Microbiological Culture Collection Center) No.41631. The talaromyces funiculosuus HG14 provided by the invention can be used for efficiently degrading low-rank coal to produce humic acid. The obtained humic acid is high in yield and oxygen-containing group content, has good growth promoting and yield increasing effects on corn in agriculture, and also has the effects of adsorbing greenhouse gas and reducing emission of the greenhouse gas. The talaromyces rope HG14 disclosed by the invention can be used for extracting humic acid from low-rank coal, and has a good application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial degradation of low-rank coal, and in particular to a rope-shaped basket fungus, a bacterial agent, a method and an application thereof. Background Art

[0002] my country has rich reserves of coal resources, of which lignite, weathered coal, sub-bituminous coal and other low-rank coals account for more than 50%. According to the international coal classification standards, coal with a random reflectance R of less than 0.5% and a high calorific value of less than 24MJ / kg on a water-free ash basis is defined as low-rank coal. Low-rank coal has significant characteristics such as high water content, low calorific value and high volatile matter. Its traditional direct combustion or gasification utilization method has the problem of low efficiency, and will also produce a large amount of pollutants and carbon emissions, which puts great pressure on the environment. However, low-rank coal is rich in organic matter, especially a large number of aromatic compounds that are important precursors of humic acid, as well as oxygen-containing functional groups such as carboxyl, hydroxyl and carbonyl, which provides potential for its high-value utilization. Humic acid has attracted much attention due to its wide application prospects in many fields. In agriculture, it can be used as a biostimulant, soil conditioner, and fertilizer / pesticide synergist to effectively promote the growth and development of crops, improve soil fertility and fertilizer utilization rate; in the industrial field, it can act as a wastewater treatment agent, drilling mud stabilizer, and concrete ceramic additive, exerting its unique physical and chemical properties; in the environmental field, it can be used as a soil remediation agent and harmful gas adsorbent to help repair and improve the ecological environment; in the medical field, it can be used as a drug carrier and health product raw material, showing certain medicinal value; in the energy field, it can also be used as a catalyst for biodiesel production and an additive for fuel cell electrode materials, etc., providing new ideas for the development of the energy industry. Therefore, converting organic matter in low-rank coal into humic acid has become a key way to achieve clean and efficient utilization of low-rank coal.

[0003] At present, the main methods for extracting humic acid from low-rank coal include chemical activation, microbial conversion and pyrolysis activation. Although the chemical activation method has the advantages of simple process and high efficiency, the humic acid extracted by it has low purity, poor biological activity in agricultural applications, and is easy to pollute the environment during the production process; the pyrolysis activation method has the disadvantages of high equipment cost, high energy consumption and harsh reaction conditions, which limit its large-scale application; in contrast, the microbial conversion method has gradually become a research hotspot in the field of coal degradation, conversion and resource utilization due to its simple equipment, low energy consumption, mild reaction conditions and high biological activity of the humic acid products produced.

[0004] In the relevant research on microbial degradation of low-rank coal, it has been found that a variety of microorganisms can degrade low-rank coal. Bacteria include Pseudomonas, Bacillus, Sphingobacillus, etc., actinomycetes are represented by Streptomyces, fungi include white rot fungi (such as Pseudomonas chrysosporium, Pseudomonas velvetii, etc.), Deuteromyces (such as Aspergillus terreus, Penicillium, etc.), ascomycete fungi (such as Neurospora crassa, etc.), zygomycetes (such as Cunninghamella elegans, etc.), yeast-like fungi (such as Candida, etc.). There are no reports on the use of fungus to degrade and transform low-rank coal into humic acid in the prior art. Summary of the invention

[0005] The present invention aims to solve the above-mentioned problems existing in the existing technology of converting low-rank coal into humic acid, and provides a rope-shaped basket fungus, a bacterial agent, a method and an application. The rope-shaped basket fungus HG14 can simultaneously and efficiently degrade and convert low-rank coal into humic acid, opening up a new way for the clean and efficient utilization of low-rank coal.

[0006] In order to solve the above technical problems, the following technical solutions are proposed:

[0007] The invention provides a strain of Talaromyces funiculosus HG14, whose deposit number is CGMCC No.41631.

[0008] The present invention provides a bacterial agent, comprising the rope-shaped basket fungus HG14 described in the above technical solution.

[0009] The present invention provides the use of the rope-shaped basket fungus HG14 described in the above technical solution or the bacterial agent described in the above technical solution in the following 1) to 4);

[0010] 1) Degradation of low-rank coal;

[0011] 2) Degrading low-rank coal to produce humic acid;

[0012] 3) Improve the yield of humic acid produced by degrading low-rank coal;

[0013] 4) Preparation of humic acid products with high biological activity.

[0014] Preferably, the degradation method includes liquid fermentation, and a carbon source and an inorganic salt are added during the liquid fermentation.

[0015] Preferably, the carbon source comprises sucrose;

[0016] The inorganic salts include KNO3, K2HPO4, KH2PO4, MgSO4·7H2O and CaCl2·2H2O;

[0017] To every 1 g of coal, add 1.5-2.0 g of sucrose, 0.3-0.5 g of KNO3, 0.03-0.05 g of K2HPO4, 0.1-0.15 g of KH2PO4, 0.03-0.05 g of MgSO4·7H2O, 0.001-0.003 g of CaCl2·2H2O and 95 mL of water.

[0018] Preferably, the low-rank coal includes one or more of sub-bituminous coal, lignite and weathered coal; and the low-rank coal is further subjected to photo-oxygen oxidation before being degraded.

[0019] The present invention provides a method for preparing humic acid or a method for degrading low-rank coal, comprising: mixing the rope-shaped basket fungus HG14 described in the above technical solution or the bacterial agent described in the above technical solution with low-rank coal to degrade or prepare humic acid.

[0020] Preferably, the application form of the funicularia HG14 includes a monospore suspension; the number of viable bacteria in the monospore suspension is (1-5)×10 8 / mL; the degradation method includes liquid fermentation; during the liquid fermentation, the inoculation amount of the spores of T. funiculatus HG14 is 3% to 7% of the volume of the liquid fermentation system.

[0021] The present invention provides humic acid obtained by the method described in the above technical scheme.

[0022] The present invention provides the use of humic acid described in the above technical solution in promoting plant growth and / or reducing greenhouse gas emissions.

[0023] Beneficial effects of the present invention: The rope-shaped basket fungus HG14 of the present invention has unique properties and can simultaneously and efficiently degrade and convert lignite and sub-bituminous coal in low-rank coal into humic acid, filling the gap in existing research on the degradation of low-rank coal by rope-shaped basket fungi to produce humic acid, and opening up a new way for the clean and efficient utilization of low-rank coal.

[0024] The rope-shaped basket fungus HG14 of the present invention has the following significant advantages:

[0025] (1) Wide substrate adaptability: Different from other reported microorganisms, Bacillaceae HG14 can not only effectively degrade and transform lignite, but also has excellent degradation ability for sub-bituminous coal with a high degree of coalification, greatly expanding the range of available coal resources.

[0026] (2) Mild reaction conditions: Under conventional microbial culture conditions, such as suitable temperature, pH value and nutrient environment, the degradation and conversion of low-rank coal can be achieved without the need for harsh reaction conditions such as high temperature and high pressure, thus reducing energy consumption and equipment requirements.

[0027] (3) Humic acid products with high biological activity: Humic acid produced by the transformation of lignite and sub-bituminous coal by T. funiculatus HG14 has high biological activity and can play a more significant role in applications in agriculture, environment and other fields. In agriculture, it can be used as a biostimulant to more effectively promote plant growth and increase crop yields. In the environmental field, it can more effectively absorb greenhouse gases (N2O and CO2).

[0028] In summary, the purpose of the present invention is to provide a strain of Basilicum, a bacterial agent, a method and an application. The Basilicum HG14 provided by the present invention can simultaneously degrade sub-bituminous coal and lignite to produce humic acid, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is a graph showing the coal liquefaction effect of the rope-shaped basket fungus HG14 on a PDA solid culture medium plate;

[0030] Figure 2 This is a graph showing the growth of the funicularia HG14 on a PDA solid culture medium plate;

[0031] Figure 3 is the phylogenetic tree of T. funiculi HG14;

[0032] Figure 4 For MHA and CHA 13 C NMR spectrum analysis chart.

[0033] Biological Deposit Description

[0034] Talaromyces funiculosus HG14 was deposited in the General Microbiology Center (CGMCC) of China Microorganism Culture Collection Administration on November 18, 2024, with the deposit number CGMCC No.41631. The address of the deposit unit is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. DETAILED DESCRIPTION

[0035] The invention provides a strain of Talaromyces funiculosus HG14, whose deposit number is CGMCC No.41631.

[0036] The fungus HG14 of the present invention is a fungus, which is separated and screened from a sub-bituminous coal sample, grows well on red Bengal and PDA culture media, and colonies can be seen after culturing at 28°C for 2 to 3 days. The colonies of the strain are green, irregular in shape, and have a hairy surface. It is easy to produce spores, and has a loose texture and is easy to pick up. The present invention uses the ITS sequence of the fungus HG14 to perform a BLAST homologous sequence search in NCBI, and determines that the strain HG14 is a fungus (Talaromyces funiculosus). The ITS gene sequence of the fungus HG14 is shown in SEQ ID NO.1.

[0037] The rope-shaped basket fungus HG14 of the present invention can transform lignite and sub-bituminous coal to produce humic acid, and can simultaneously degrade and transform lignite and sub-bituminous coal.

[0038] The present invention provides a bacterial agent, comprising the rope-shaped basket fungus HG14 described in the above technical solution.

[0039] As an optional embodiment, the application form of the funicular fungus HG14 of the present invention includes a HG14 monospore suspension. As an optional embodiment, the preparation method of the HG14 monospore suspension includes the following steps:

[0040] The funicular basket fungus HG14 is inoculated into a solid culture medium for activation culture to obtain mature spores; the temperature of the activation culture is 27-29°C, preferably 28°C; in a specific embodiment of the present invention, the culture temperature is 27, 28 or 29°C. The activation culture time of the present invention is 3-5 days, and in a specific embodiment of the present invention, the activation culture time is 4 or 5 days. The activation culture of the present invention is dark culture.

[0041] As an optional embodiment, the present invention uses a solution to elute spores and obtain a monospore suspension after shaking. As an optional embodiment, the solution for eluting spores in the present invention includes 0.1% sterile saline. In a specific embodiment of the present invention, the 0.1% sterile saline is used to elute the spores into a conical flask, and a monospore suspension is obtained after shaking.

[0042] As an optional embodiment, the culture medium used in the activation culture of the present invention includes liquid potato dextrose culture medium, namely PDA culture medium.

[0043] As an optional implementation manner, the oscillation time is 28 to 32 minutes, more preferably 30 minutes.

[0044] As an optional embodiment, the number of viable bacteria in the monospore suspension is (1-5)×10 8 / mL, or (3-4)×108 Pieces / mL.

[0045] The present invention provides the use of the rope-shaped basket fungus HG14 bacterial agent described in the above technical solution in degrading low-rank coal.

[0046] As an optional embodiment, the low-rank coal of the present invention includes one or more of sub-bituminous coal, lignite and weathered coal. In a specific embodiment of the present invention, lignite and sub-bituminous coal taken from the coal mine area of ​​Yima City, Sanmenxia were used for experimental verification.

[0047] As an optional embodiment, the low-rank coal of the present invention is subjected to a photo-oxygen oxidation pretreatment before degradation; the photo-oxygen oxidation pretreatment of the low-rank coal can increase the oxygen content of the low-rank coal, which is beneficial to improving the degradation rate of the low-rank coal by microorganisms. As an optional embodiment, the photo-oxygen oxidation pretreatment of the present invention is completed by a photoreactor. In a specific embodiment of the present invention, the parameters of the photo-oxygen oxidation of sub-bituminous coal are: the oxygen flow rate of the photo-oxygen oxidation is 10 to 40 mL / min, the power of the ultraviolet lamp of the photo-oxygen oxidation is 160 to 200 W, and the oxidation reaction time of the photo-oxygen oxidation is 24 to 48 hours.

[0048] As an optional embodiment, the rope-shaped basket fungus HG14 inoculant includes liquid fermentation in the manner of degrading low-rank coal. As an optional embodiment, a carbon source and an inorganic salt are added during the liquid fermentation of the present invention. As an optional embodiment, the carbon source of the present invention includes sucrose. The inorganic salts of the present invention include KNO3, K2HPO4, KH2PO4, MgSO4·7H2O and CaCl2·2H2O.

[0049] As an optional embodiment, 1.5-2.0 g of sucrose, 0.3-0.5 g of KNO3, 0.03-0.05 g of K2HPO4, 0.1-0.15 g of KH2PO4, 0.03-0.05 g of MgSO4·7H2O, 0.001-0.003 g of CaCl2·2H2O and 95 mL of water are added to every 1 g of coal, and preferably 1.5 g of sucrose, 0.3 g of KNO3, 0.05 g of K2HPO4, 0.1 g of KH2PO4, 0.05 g of MgSO4·7H2O, 0.002 g of CaCl2·2H2O and 95 mL of water are added to every 1 g of coal. As an optional embodiment, the coal is coal pretreated by light-oxygen oxidation. The present invention mixes the coal, carbon source and inorganic salts and conducts liquid fermentation. As an optional embodiment, the present invention regards the mixture of the coal after light-oxygen oxidation with the carbon source, inorganic salt components and water as a culture medium, and inoculates the rope-shaped basket fungus HG14 into the culture medium for liquid fermentation to achieve coal degradation. As an optional embodiment, the inoculation form of the rope-shaped basket fungus HG14 includes an HG14 monospore suspension. The preparation method of the HG14 monospore suspension has been discussed above and will not be repeated here. The volume of the HG14 monospore suspension and water in the present invention is recorded as the total volume. The inoculation amount of the HG14 monospore suspension is preferably 3% to 7% of the total volume, and can also be 4% to 6%, and more preferably 5%. The number of viable bacteria in the monospore suspension is (1 to 5)×10 8 / mL, or (3-4)×10 8 The number of spores in the liquid fermentation system after inoculation of the HG14 monospore suspension during the liquid fermentation of the present invention is ≥1×10 6 Pieces / mL.

[0050] As an optional embodiment, the temperature of the liquid fermentation is 25°C to 30°C, or 26 to 29°C; in a specific embodiment of the present invention, the temperature of the liquid fermentation is 25, 26, 27, 28, 29 or 30°C. The time of the liquid fermentation of the present invention is 6 to 8 days, more preferably 7 days. In a specific embodiment of the present invention, the time of the liquid fermentation is 6, 7 or 8 days. As an optional embodiment, the rotation speed of the liquid fermentation of the present invention is 120 to 160 rpm, or 140 to 150 rpm. During the liquid fermentation process, the concentration of humic acid, a coal-soluble product in the liquid fermentation process, no longer changes, which means that the liquid fermentation is over.

[0051] The present invention provides the use of the rope-shaped basket fungus HG14 described in the above technical solution or the bacterial agent described in the above technical solution in degrading low-rank coal to produce humic acid.

[0052] The type of coal, the temperature, time, rotation speed, method of coal degradation, and the carbon source and inorganic salt added during liquid fermentation of the present invention have been discussed above and will not be repeated here. As an optional embodiment, after the liquid fermentation is completed, a culture solution is obtained; after filtering and acid precipitation of the culture solution, humic acid is obtained.

[0053] The present invention does not specifically limit the filtering method, and a conventional method can be used. As an optional embodiment, the present invention performs acid precipitation and centrifugation on the filtrate obtained by filtration to obtain humic acid. The acid precipitation method of the present invention comprises: adjusting the pH of the filtrate with HCl solution and then performing a precipitation reaction, the molar concentration of the HCl solution of the present invention is 6.0M, the pH of the adjusted filtrate is 1.8, and the precipitation reaction time is 12 to 24 hours. As an optional embodiment, the centrifugal speed is 10000rpm, and the centrifugal time is 10min. The liquid fermentation and extraction process of the present invention does not use chemical solvents and does not produce secondary waste that pollutes the environment.

[0054] The present invention provides the use of the rope-shaped basket fungus HG14 described in the above technical solution or the bacterial agent described in the above technical solution in improving the yield of humic acid produced by degrading low-rank coal.

[0055] The types of low-rank coal described in the present invention, the temperature, time, rotation speed, method for degrading low-rank coal, the carbon source and inorganic salt composition added during liquid fermentation, and the extraction parameters of humic acid produced by degrading low-rank coal have been discussed above and will not be repeated here.

[0056] The rope-shaped basket fungus HG14 of the present invention can degrade low-rank coal to produce humic acid, and the yield and purity of humic acid are significantly improved compared with the chemical method. After the lignite is biodegraded by the strain HG14, the humic acid yield is increased from 43.32% to 66.41%, and the ash content in the humic acid is reduced from 15.06% to 9.45%; after the sub-bituminous coal is biodegraded by the strain HG14, the humic acid yield is increased from 2.99% to 41.47%, and the ash content of the humic acid is reduced from 8.64% to 5.22%. Compared with the humic acid CHA extracted from lignite and sub-bituminous coal by the chemical method, the humic acid MHA obtained by degrading lignite and sub-bituminous coal by HG14 has an increased degree of lipidation, a reduced degree of aromaticity, and an increased content of oxygen / nitrogen groups.

[0057] The present invention provides the use of the rope-shaped basket fungus HG14 described in the above technical solution or the bacterial agent described in the above technical solution in the preparation of a humic acid product with high biological activity.

[0058] The types of low-rank coal described in the present invention, the temperature, time, rotation speed, method for degrading low-rank coal, the carbon source and inorganic salt composition added during liquid fermentation, and the extraction parameters of humic acid produced by degrading low-rank coal have been discussed above and will not be repeated here.

[0059] As an optional embodiment, the high biological activity of the present invention is an improvement in the growth-promoting effect of humic acid. Compared with humic acid prepared by chemical methods, the growth-promoting effect of the present invention using the funicular Bacillaceae HG14 to degrade low-rank coal to produce humic acid is better.

[0060] The present invention provides a method for preparing humic acid or a method for degrading low-rank coal, comprising: mixing the rope-shaped basket fungus HG14 described in the above technical solution or the bacterial agent described in the above technical solution with low-rank coal for degradation.

[0061] As an optional implementation, the present invention performs photo-oxygen oxidation on the coal before degrading or preparing humic acid; the parameters of the photo-oxygen oxidation have been discussed above and will not be repeated here.

[0062] As an optional embodiment, the present invention adds inorganic salts, carbon sources and water to the coal before degradation. As another optional embodiment, the present invention adds inorganic salts, carbon sources and water to the low-rank coal after light-oxygen oxidation before degradation. As an optional embodiment, the types and addition amounts of the inorganic salts and carbon sources have been discussed above and will not be repeated here.

[0063] As an optional embodiment, the application form of the rope-shaped basket fungus HG14 includes an HG14 monospore suspension; as an optional embodiment, the degradation method includes liquid fermentation; the volume of the HG14 monospore suspension and water in the present invention is recorded as the total volume, and the inoculation amount of the HG14 monospore suspension is preferably 3% to 7% of the total volume, or 4% to 6%, and more preferably 5%.

[0064] The present invention provides humic acid obtained by the preparation method described in the above technical solution. The humic acid of the present invention has an increased aliphatic carbon content; the aliphatic carbon of the present invention includes C Alk-H,R , C Alk-O,N , C Alk-O and C Alk-di-O One or more of the following: the aromatic carbon content of the humic acid of the present invention is reduced; the aromatic carbon includes C Ar-H,R and / or C Ar-O,N .

[0065] The rope-shaped basket fungus HG14 of the present invention is used to degrade lignite to prepare humic acid MHA-L, thereby increasing the aliphatic carbon content. The C content of the obtained humic acid MHA-L is Alk-H,R The content is 33% to 34%, C Alk-O,N The content is 12% to 13%, C Alk-O The content of MHA-L is 16% to 17%; MHA-L reduces the aromatic carbon content, and the C Ar-H,RThe content is 15% to 16%; the C of the obtained humic acid MHA-L Ar-O,N The content is 5% to 6%.

[0066] The present invention utilizes the funicularia HG14 to degrade subbituminous coal to prepare humic acid MHA-S, thereby increasing the aliphatic carbon content and the C content of the obtained humic acid MHA-S. Alk-di-O The content is 5.5% to 6.0%, C Alk-O,N The content is 5% to 6%, C Alk-O The content of humic acid MHA-S is 8% to 9%; MHA-S reduces the aromatic carbon content, and the C Ar-HR The content is 34% to 35%; the C of the obtained humic acid MHA-L Ar-ON The content is 13%~13.8%.

[0067] Changes in the structure and functional groups of humic acid have significant effects on soil and plants. When the fatty carbon increases and the aromatic carbon decreases, the molecular structure and functional group composition of humic acid are conducive to binding to plant cell surface receptors, activating physiological and biochemical reactions in plants, promoting root growth and development, improving water and nutrient absorption efficiency, and enhancing stress resistance. At the same time, the increase in fatty carbon increases its flexibility, allowing it to penetrate between soil particles and bond soil particles through physical and chemical effects; the reduction in aromatic carbon reduces the rigid structure, which is conducive to adsorption and bridging on the surface of soil particles, jointly promoting the formation of soil aggregates and improving porosity and air permeability. In addition, the increase in humic acid oxygen-containing groups can enhance its own hydrophilicity, solubility, ion exchange and chemical reaction activity, improve soil structure, regulate pH, promote microbial activity, promote plant nutrient absorption, stimulate growth, enhance stress resistance, and increase crop yield and quality. The increase in oxygen-containing groups enhances the ion exchange capacity of humic acid and affects the form and transformation of nitrogen in the soil. Ammonium nitrogen is adsorbed and fixed, reducing its conversion to nitrate nitrogen, inhibiting denitrification and reducing nitrous oxide emissions. At the same time, changes in soil aeration will also change the activity of nitrifying and denitrifying microorganisms, affecting the production of nitrous oxide. The reduction in aromatic carbon in humic acid indicates that the strain degrades low-rank coal, opens the aromatic ring, and increases the fatty chain.

[0068] The content of oxygen / nitrogen functional groups in the humic acid of the present invention is increased, and the ratios of H / C, N / C and O / C are all increased to varying degrees.

[0069] The present invention provides the application of humic acid described in the above technical solution in promoting plant growth.

[0070] As an alternative embodiment, the plant comprises corn.

[0071] As an optional embodiment, the growth promotion includes one or more of the following 1) to 4),

[0072] 1) Number of grains per spike; 2) 1000-grain weight; 3) Dry matter mass of aboveground parts of plants; 4) Yield of plants.

[0073] As an optional embodiment, the amount of humic acid added is 28-32 kg / hm2 based on the mass of the cultivated soil sample. 2 , more preferably 30kg / hm 2 As an optional embodiment, the application method of the humic acid includes using the humic acid as a base fertilizer, and the humic acid is applied simultaneously with a nitrogen, phosphorus and potassium compound fertilizer.

[0074] The present invention provides the use of humic acid described in the above technical solution in reducing greenhouse gas emissions.

[0075] As an optional embodiment, the greenhouse gas includes N2O and / or CO2.

[0076] This experiment used field plot experiments to verify the effects of humic acid (CHA, MHA) extracted by two extraction methods on corn growth and greenhouse gas emissions. CHA (CHA-L, CHA-S) was humic acid extracted from lignite and sub-bituminous coal using the alkali dissolution and acid precipitation method, and MHA (MHA-L, MHA-S) was humic acid converted by degrading lignite and sub-bituminous coal using the strain HG14. Compared with CK, the aboveground dry matter, number of grains per ear, thousand-grain weight and yield of corn increased significantly after adding HA. Compared with adding CHA-L and CHA-S, the increase of MHA-L and MHA-S was greater. After adding HA, the cumulative emission of N2O and CO2 decreased significantly, indicating that the addition of HA can effectively reduce the emission of N2O and CO2 in the soil. Compared with CK, MHA-L and MHA-S have better emission reduction effects, with N2O reduced by 41.04% and 47.35%, respectively, and CO2 reduced by 40.63% and 46.88%, respectively. It can be seen that HA can promote corn growth, increase corn yield, and reduce soil N2O and CO2 emissions. The application of strain HG14 to degrade MHA-L and MHA-S converted from low-rank coal can achieve the effect of increasing yield and reducing agricultural greenhouse gas emissions.

[0077] In summary, the humic acid of the present invention can play a more significant role in the application of agriculture, environment and other fields. For example, in agriculture, it can be used as a biostimulant to more effectively promote the growth of corn, thereby increasing corn yields. In the environmental field, it can more effectively adsorb greenhouse gases and reduce the release of N2O and CO2 from agricultural soil to the atmosphere.

[0078] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0079] The composition of the red Bengal culture medium is: 5g peptone, 10g glucose, 1g potassium dihydrogen phosphate, 0.5g magnesium sulfate (MgSO4·7H2O), 20g agar, 0.03g red Bengal, 0.1g chloramphenicol and 1000mL distilled water; preparation method: After the above ingredients are dissolved in distilled water, the red Bengal solution is added. Add to the culture medium, package, and sterilize at 121℃ for 20min.

[0080] The composition of potato dextrose medium (PD) is: 200 g potato, 20 g glucose and 1000 mL distilled water; the composition of potato dextrose agar medium (PDA) is: adding 20 g / L agar powder to PD medium.

[0081] Example 1 Isolation of low-rank coal-degrading bacteria

[0082] 1. The coal samples for this test were taken from the coal mining area of ​​Yima City, Sanmenxia. Industrial analysis (moisture content, ash content, volatile matter, fixed carbon), elemental analysis, calorific value and vitrinite reflectance were carried out on coal samples A and B. According to the results, it was concluded that coal sample A was lignite and coal sample B was sub-bituminous coal. The results are shown in Table 1.

[0083] Table 1 Industrial analysis, elemental analysis, calorific value and vitrinite reflectance analysis results of coal samples

[0084]

[0085] 2. Isolate, screen and culture fungi from Yima lignite and sub-bituminous coal samples to obtain a batch of microbial strains that can be used to degrade Yima low-rank coal. The specific steps are:

[0086] Take 1g of coal sample with a particle size of 0.150mm, add sterile water, shake on a shaker to mix for 2h, use an inoculation loop to take a ring of the plate and streak it on the Bengal red culture medium, then place it in a 28℃ constant temperature incubator for static culture. After colonies grow, select colonies of different morphologies and inoculate them on PDA solid culture medium plates for purification. A total of 36 strains were isolated.

[0087] The obtained strains were further screened to obtain a strain HG14 that can dissolve solid low-rank coal into black liquid. The specific steps are: 36 strains were inoculated onto PDA solid culture medium plates, and placed in a 28°C incubator for 3 to 5 days. After the strains grew all over the culture medium, a layer of high-temperature sterilized Yima lignite powder was evenly added, and the culture was continued for 48 to 72 hours. Black droplets were observed on the surface of the colony of one of the strains. After the strain was cultured again, it was evenly sprinkled with high-temperature sterilized sub-bituminous coal powder, and black droplets were also produced on the surface of the colony. It can be seen that the strain can degrade lignite and weathered coal, and the effect is shown. Figure 1 After multiple tests, it was verified that its degradation effect was relatively stable, and the strain was named HG14.

[0088] Example 2 DNA extraction and strain identification of Talaromyces fungi HG14

[0089] 1. Colony morphology

[0090] The strain HG14 was inoculated on a PDA solid medium plate and cultured at 28°C for 4 days. The colony characteristics were green irregular colonies with a hairy surface, easy to produce spores, loose texture, and easy to pick up. Figure 2 .

[0091] 2. PCR amplification and sequencing of ITS sequences

[0092] The strain HG14 obtained in Example 1 was inoculated on a PDA medium plate and cultured at 28°C for 4 days to obtain mycelia, which were scraped and quickly frozen with liquid nitrogen and then crushed in a high-speed tissue grinder. Fungal DNA was extracted according to the method of the kit (Solebo Product No. D2300) and stored in a -80°C refrigerator for later use. The ITS sequence of the strain was PCR amplified using primers ITS1 (SEQ ID NO.2: TCCGTAGGTGAACCTGCGG) and ITS4 (SEQ ID NO.3: TCGMCCGCTTATTGATATGC). The PCR reaction system (25 μL) was: 2×F5 TaqPCR MasterMix (Beijing Zhuangmeng International Biogene Technology Co., Ltd.) 12.5 μL, DNA template 1 μL, ITS 11 μL, ITS 41 μL, ddH2O 9.5 μL; the PCR amplification conditions were 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 56°C annealing for 30 s, and 72°C extension for 1 min, with the denaturation, annealing and extension stages cycled 35 times, and finally extended at 72°C for 10 min.

[0093] The obtained PCR amplification product was detected by 1% agarose gel electrophoresis and then sent to Shanghai Biotech Co., Ltd. for sequencing. The ITS sequence sequencing result is shown in SEQ ID NO.1:

[0094] SEQ ID NO.1: AGACGTAGCTTCGTAGGTGACCTGCGGAGGATCATTAC CGAGTGCGGGCCCTCGCGGCCCCAACGMCCCACCCTTGTCTCTCTACACCT GTTGCTTTGGCGGGCCCACTGGGGCTCCCTGGTCGCCGGGGGACACCCGTCCCCGGGCCCGCGCCCGCCGAAGCGCTTCGTGAACCCTGATGAAGAAGGGCTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAGAACGCAGCA.

[0095] The obtained ITS sequences were used to perform BLAST homologous sequence search in GenBank, and the Neighbor-Joining Tree method in MEGA software was used to construct an ITS phylogenetic tree by repeated sampling 1000 times. The results are shown in Figure 3 .according to Figure 3 It can be seen that strain HG14 and MW724155.1Talaromyces funiculosus isolate220MAR are on the same evolutionary branch, indicating that the two strains are most closely related. In addition, combined with morphological observation and physiological and biochemical characteristics analysis, strain HG14 was determined to be Talaromyces funiculosus, that is, Talaromyces funiculosus HG14.

[0096] Example 3 Experiment on degradation of low-rank coal by coal-dissolving bacteria HG14

[0097] 1. Coal sample processing

[0098] The coal samples used in the experiment were sub-bituminous coal (denoted as YMS) and lignite (denoted as YML) taken from Yima City, Sanmenxia, ​​Henan Province. After grinding and screening, the coal samples were obtained into coal powder with a particle size range of 0.075mm to 0.150mm. The coal powders were vacuum dried at 105℃ for 2h and then placed in a photoreactor for light-oxygen oxidation pretreatment. The controlled oxidation conditions were: 20g coal sample, oxygen flow rate of 10-40mL / min to make oxygen saturated, ultraviolet light power of 160W, oxidation reaction time of 48h, and sub-bituminous coal (denoted as GYMS) after light-oxygen oxidation and lignite (denoted as GYML) after light-oxygen oxidation were obtained. Light-oxygen oxidation pretreatment of low-rank coal can increase the oxygen content of low-rank coal, which is beneficial to improve the degradation rate of coal by microorganisms.

[0099] 2. Preparation of monospore suspension

[0100] The HG14 strain stored at 4°C was transferred to PDA medium and placed in a 28°C constant temperature incubator for dark culture for 5 days to obtain mature spores. Under aseptic operation, the spores were washed with 0.1% sterile saline, poured into a sterile conical bottle filled with glass beads, and shaken thoroughly for 30 minutes. After the spores were fully dispersed, they were counted with a hemocytometer and prepared into a concentration of 1×10 8 / mL single spore suspension.

[0101] 3. Microbial fermentation

[0102] Liquid coal-soluble culture medium: (1) 1.5 g sucrose, 0.3 g KNO3, 0.05 g K2HPO4, 0.1 g KH2PO4, 0.05 g MgSO4·7H2O, 0.002 g CaCl2·2H2O, 1 g photo-oxygen oxidized subbituminous coal and 95 mL deionized water, pH 6.5-7.0, recorded as subbituminous coal culture medium. The volume of the culture medium prepared with the above-mentioned substances is calculated based on the volume of deionized water, that is, 95 mL subbituminous coal culture medium is obtained.

[0103] (2) 1.5 g of sucrose, 0.3 g of KNO3, 0.05 g of K2HPO4, 0.1 g of KH2PO4, 0.05 g of MgSO4·7H2O, 0.002 g of CaCl2·2H2O, 1 g of light-oxygen oxidized lignite and 95 mL of deionized water, pH 6.5-7.0, recorded as lignite culture medium. The volume of the culture medium prepared with the above-mentioned substances is calculated based on the volume of deionized water, that is, 95 mL of subbituminous coal culture medium is obtained.

[0104] Under sterile conditions, 5 mL of HG14 monospore suspension was added to 95 mL of subbituminous coal culture medium, shaken immediately, and cultured in a shaker at 28°C, with a rotation speed of 150 rpm and a culture time of 7 days to obtain subbituminous coal culture solution.

[0105] Under sterile conditions, 5 mL of HG14 monospore suspension was added to 95 mL of lignite culture medium, shaken immediately, and cultured in a shaker at 28°C, with a rotation speed of 150 rpm and a culture time of 7 days to obtain lignite culture solution.

[0106] 4. Humic acid extraction

[0107] After the cultivation in step 3 is completed, the sub-bituminous coal culture solution and the lignite culture solution are filtered to obtain water-soluble humic acid filtrate, and the pH of the filtrate is adjusted to 1.8 with 6.0M HCl solution. After standing and settling for 24 hours, the filtrate is centrifuged at 10000 rpm for 10 minutes, and the precipitated humic acid is collected, washed with distilled water for 3 times, and then dried at 60°C to constant weight and stored at 4°C. This is the humic acid converted by microbial degradation of lignite (i.e., MHA-L) and the humic acid converted by microbial degradation of sub-bituminous coal (i.e., MHA-S).

[0108] The humic acid extracted by the alkaline dissolution and acid precipitation method was used as the control group. The specific steps were as follows: 1g of YMS and YML coal powders with a particle size of 0.075mm to 0.150mm dried to constant weight were taken, and 100mL of NaOH solution with a molar concentration of 0.1M was added respectively. After continuous shaking on a shaker at 30°C and 160rpm for 24h, the resulting solution was centrifuged at 8000rpm for 10min and filtered. The pH of the resulting filtrate was adjusted to 1.8 with 6.0M HCl, and after standing and settling for 24h, it was centrifuged at 10000rpm for 10min, and the precipitated sub-bituminous coal humic acid (ie, CHA-S) and lignite humic acid (ie, CHA-L) were collected and precipitated respectively, washed with distilled water 3 times, dried at 60°C to constant weight, and the yield of humic acid was determined by the Eq method according to the following formula:

[0109] η=(m1 / m0)×100%(1);

[0110] In formula (1), η is the humic acid yield (%); m0 is the initial mass of the coal sample (g); and m1 is the mass of humic acid (g).

[0111] 5. Analysis of MHA-L, MHA-S, CHA-L and CHA-S products

[0112] (1) Humic acid yield and organic element analysis

[0113] The yield of humic acid and the analysis results of organic elements showed (Table 2) that after the lignite was biodegraded by strain HG14, the yield of humic acid increased from 43.32% to 66.41%, and the ash content of humic acid MHA-L decreased from 15.06% to 9.45%; after the sub-bituminous coal was biodegraded by strain HG14, the yield of humic acid MHA-S increased from 2.99% to 41.47%, and the ash content of humic acid decreased from 8.64% to 5.22%. After the degradation by strain HG14, the MHA-L and MHA- The ash content of S was greatly reduced, indicating that the humic acid extracted by microbial degradation method had fewer impurities and higher purity than that extracted by chemical method. The elemental analysis results showed that compared with CHA-L extracted from lignite by chemical method, the mass proportion of H (H%), N (N%) and O (O%), as well as the hydrogen-carbon ratio (H / C), nitrogen-carbon ratio (N / C) and oxygen-carbon ratio (O / C) in MHA-L obtained from lignite by microbial method increased to varying degrees, the mass proportion of C (C%) changed less, and the mass proportion of S (S%) decreased. Compared with CHA-S extracted from sub-bituminous coal by chemical method, the H%, N% and O% and the H / C, N / C and O / C ratios in MHA-S obtained from sub-bituminous coal by microbial method increased significantly, while C% decreased significantly and S% increased slightly. The higher the H / C value, the lower the degree of aromatization. The O / C and N / C values ​​can reflect the content of oxygen / nitrogen functional groups in the HA structure. Compared with humic acid CHA extracted from lignite and sub-bituminous coal by chemical method, the H / C, N / C and O / C ratios of humic acid MHA-L and MHA-S extracted from the two coals by microbial method increased to varying degrees, indicating that after degradation by HG14, the aromaticity of humic acid decreased and the content of oxygen / nitrogen functional groups increased. The yield of humic acid biotransformed by strain HG14 was greatly improved compared with that of humic acid extracted by chemical method, among which the yield of humic acid in sub-bituminous coal increased by 12.87 times and the yield of humic acid in lignite increased by 53.30%.

[0114] Table 2 Elemental composition (organic), atomic ratio and yield of two humic acids

[0115]

[0116] (2) Humic acid 13 C NMR spectroscopy analysis

[0117] 13 C NMR spectral analysis can provide important basic information on the structural composition of humic acid macromolecules. The peak signals at different chemical shifts can be used to infer the structure of humic acid. The analysis results show that ( Figure 4 , Table 3): Compared with CHA-L extracted from lignite by chemical method, the aliphatic carbon (C Alk-H,R , CAlk-O,N , C Alk-O ) increased, which increased its lipidation degree by 25.39% compared with CHA-L, while the aromatic carbon (C Ar-H,R , C Ar-O,N ) was significantly reduced, resulting in a 43.24% decrease in aromaticity compared to CHA-L. In addition, compared to CHA-L, the oxygen / nitrogen groups (C Alk-O,N , C Alk-O , C COO-H,R , C C＝O Compared with CHA-S extracted from sub-bituminous coal by chemical method, the aliphatic carbon (C Alk-O,N , C Alk-O , C Alk-di-O ) increased, which increased its lipidation degree by 20.93% compared with CHA-S, while the aromatic carbon (C Ar-H,R , C Ar-O,N ) is significantly reduced, resulting in a 15.79% decrease in aromaticity compared to CHA-S. In addition, compared to CHA-S, the oxygen / nitrogen groups (C Alk-O,N , C Alk-O , C Alk-di-O , C COO-H,R , C C＝O ) also increased. Compared with subbituminous coal, HG14 strain had a higher degree of degradation of lignite and a greater degree of change in its humic acid structure.

[0118] Table 3 Solid-state CP / MAS 13 Determination of Carbon Distribution in CHA and MHA by C NRM Spectroscopy

[0119] Carbon distribution (C%) ppm CHA-L MHA-L CHA-S MHA-S <![CDATA[C Alk-H,R ]]> 0-45 28.2 33.2 23.4 21.0 <![CDATA[C Alk-O,N ]]> 45-60 7.1 12.2 4.1 5.2 <![CDATA[C Alk-O ]]> 60-91 10.0 16.3 3.8 8.3 <![CDATA[C Alk-di-O ]]> 91-110 5.0 3.1 5.2 5.5 <![CDATA[C Ar-H,R ]]> 110-142 26.1 15.6 43.0 34.5 <![CDATA[C Ar-O,N ]]> 142-156 11.3 5.1 14.1 13.8 <![CDATA[C COO-H,R ]]> 156-186 11.1 12.2 5.5 10.3 <![CDATA[C C＝O ]]> 186-230 1.1 2.4 1.0 1.4 <![CDATA[ a Aroma]]> - 0.37 0.21 0.57 0.48 <![CDATA[ b Lipid content]]> - 0.63 0.79 0.43 0.52

[0120] a Aroma = [C Ar-H,R (110-142ppm)+C Ar-O,N (142-156ppm)] / C(0-230ppm).

[0121] b Degree of fatification = 1-degree of aroma.

[0122] Example 4 Verification of the effect of humic acid (CHA, MHA) converted from low-rank coal under different treatments

[0123] 1. Purpose of the experiment: This experiment used field plot experiments to verify the effects of humic acid (CHA, MHA) extracted by two extraction methods on corn growth and greenhouse gas emissions. CHA (CHA-L, CHA-S) is humic acid extracted from lignite and sub-bituminous coal using the alkali dissolution and acid precipitation method, and MHA (MHA-L, MHA-S) is humic acid converted by the degradation of lignite and sub-bituminous coal using the strain HG14.

[0124] 2. Experimental design: The experiment was conducted at the Henan Provincial Grain Crop Nutrition and Fertilization Field Scientific Observation and Research Station in Suqiao Town, Xuchang City, Henan Province. The tested corn variety was Zhengdan 958. A randomized block experimental design was adopted, with 5 treatments, namely, no addition of humic acid HA (CK) under conventional fertilization conditions and addition of CHA-L, MHA-L, CHA-S, and MHA-S under conventional fertilization conditions; the plot area was 24m 2 (3*8m), each treatment was repeated 3 times, with a 1m isolation zone between the repeated treatments. Nitrogen, phosphorus and potassium fertilizers were applied as basal fertilizers at one time, and humic acid was evenly spread into the soil at one time with the basal fertilizer. The application rate of humic acid was 30kg / hm 2 The fertilizer used in the experiment was compound fertilizer, with a nitrogen, phosphorus and potassium formula of 30-5-5 and a fertilizer application rate of 750 kg / hm 2 The management of irrigation, weeding, pest and disease control in the field plots is the same as the local high-yield management measures.

[0125] 3. Inspection indicators:

[0126] After corn harvest, 30 corn plants were selected from each plot and dried at 60°C to constant weight, weighed, and the aboveground dry matter was calculated. At the same time, the number of kernels per ear and the thousand-kernel weight of the corn kernels were measured and the yield was calculated.

[0127] Collection and determination of greenhouse gases in soil: A closed static box is used to collect gas samples. The static box and the bottom frame are made of stainless steel, and the gas sampling hole is located in the middle of the top of the box. The bottom frame is placed before the application of corn base fertilizer, with a depth of about 15 cm, and there are corn plants in the bottom frame. Field sampling starts after fertilization (July 2, 2024) and ends at crop harvest (September 30, 2024). The sampling frequency is generally once a week. The sampling time is 9:00-10:00 in the morning. Each sampling is done with a 50mL syringe pumped back and forth 8 times to ensure uniform gas. 50mL of mixed gas is extracted from the box at 0, 10, 20, and 30 minutes for N2O and CO2 content. While collecting gas, record the temperature and humidity of the upper 0-10cm of the soil. The concentration of the gas to be tested is calculated by the peak area of ​​the standard gas and the gas to be tested.

[0128] Greenhouse gas emission flux calculation:

[0129] F=ρ×H×Δc / Δt×273 / (273+T)------------Formula (1)

[0130] Where: F is the emission flux of N2O [mg / (m 2 ·h)], ρ is the gas density under standard conditions (ρ N2O =1.964kg / m 3 , ρ CO2 =1.997kg / m 3 ) ; H is the height of the sampling box (m); Δc is the gas concentration difference; Δt is the time interval (h); Δc / Δt is the slope of the four sampling time points; T is the temperature inside the box during sampling (℃).

[0131] Determination of the accumulated soil greenhouse gas emissions (ANE): The accumulated N2O and CO2 emissions (Formula 2) were time-weighted by the average production rate of the gas in each time period according to the emission flux formula (Formula 1).

[0132]

[0133] Where: ANE is the cumulative emission of N2O and CO2, kg·hm -2 ; F i and F i+1 are the emission fluxes at the i-th and i+1-th measurements respectively; t i+1 -t i is the number of days between the i-th sampling and the i+1-th sampling, d.

[0134] 4. Test results

[0135] Table 4 Effects of HA application on corn growth and greenhouse gas emissions

[0136]

[0137]

[0138] Note: Different lowercase letters represent significant differences among treatments (p<0.05).

[0139] The test results show (Table 4) that compared with the CK treatment, the aboveground dry matter, number of grains per ear, thousand-grain weight and yield of corn increased significantly after adding HA. Compared with the addition of CHA-L and CHA-S, the increase of MHA-L and MHA-S was greater. The cumulative emission of N2O and CO2 decreased significantly after adding HA. Compared with the CK treatment, the N2O of CHA-L and CHA-S treatments decreased by 22.29% and 20.10%, and CO2 decreased by 16.15% and 8.85%, respectively. The N2O of MHA-L and MHA-S treatments decreased by 41.04% and 47.35%, and CO2 decreased by 40.63% and 46.88%, respectively. This shows that adding HA can effectively reduce the emission of N2O and CO2 in the soil, and the emission reduction effect of MHA-L and MHA-S is better. It can be seen that HA can promote corn growth and increase corn yield, while reducing soil N2O and CO2 emissions. The application of strain HG14 to degrade MHA-L and MHA-S converted from low-rank coal can better achieve the effect of increasing yield and reducing agricultural greenhouse gas emissions.

[0140] In summary, the present invention isolated and cultured a rope-shaped basket fungus HG14 from Yima low-rank coal, which can degrade low-rank coal, increase the humic acid yield and the biological activity of humic acid, and its product humic acid can significantly promote corn growth and reduce greenhouse gas emissions in the soil.

[0141] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Talaromyces funiculosus HG14, with the deposit number being CGMCC No.41631.

2. A bacterial agent, characterized in that Including the fungus HG14 described in claim 1.

3. Use of the funicularia HG14 of claim 1 or the bacterial agent of claim 2 in the following 1) to 4); 1) Degradation of low-rank coal; 2) Degrading low-rank coal to produce humic acid; 3) Improve the yield of humic acid produced by degrading low-rank coal; 4) Preparation of humic acid products with high biological activity.

4. The use according to claim 3, characterized in that: The degradation method includes liquid fermentation, and a carbon source and an inorganic salt are added during the liquid fermentation.

5. The use according to claim 4, characterized in that: The carbon source includes sucrose; The inorganic salts include KNO3, K2HPO4, KH2PO4, MgSO4·7H2O and CaCl2·2H2O; To every 1 g of coal, add 1.5-2.0 g of sucrose, 0.3-0.5 g of KNO3, 0.03-0.05 g of K2HPO4, 0.1-0.15 g of KH2PO4, 0.03-0.05 g of MgSO4·7H2O, 0.001-0.003 g of CaCl2·2H2O and 95 mL of water.

6. The use according to claim 3, characterized in that: The low-rank coal includes one or more of sub-bituminous coal, lignite and weathered coal; before the low-rank coal is degraded, it also includes light-oxygen oxidation.

7. A method for preparing humic acid or a method for degrading low-rank coal, characterized in that: include: The fungus HG14 described in claim 1 or the bacterial agent described in claim 2 is mixed with low-rank coal to degrade or prepare humic acid.

8. The method according to claim 7, characterized in that The application form of the rope-shaped basket fungus HG14 includes a monospore suspension; the number of viable bacteria in the monospore suspension is (1-5)×10 8 / mL; the degradation method includes liquid fermentation; during the liquid fermentation, the inoculation amount of the spores of T. funiculatus HG14 is 3% to 7% of the volume of the liquid fermentation system.

9. Humic acid obtained by the method of claim 7 or 8.

10. Use of the humic acid according to claim 9 in promoting plant growth and / or reducing greenhouse gas emissions.

Images